Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR51037
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Wagner, Nicole; Foster, Mark. "Nearest-neighbor effects modulate loxP spacer DNA chemical shifts and guide oligonucleotide design for nuclear magnetic resonance studies" Biochemistry 61, 67-76 (2022).
PubMed: 34985267
Assembly members:
entity_1, polymer, 22 residues, Formula weight is not available
entity_2, polymer, 22 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available
Experimental source: Production method: obtained from a vendor
Entity Sequences (FASTA):
entity_1: GCGTATAATGTATGCTATAC
GG
entity_2: CCGTATAGCATACATTATAC
GC
Data type | Count |
1H chemical shifts | 33 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | A | 1 |
2 | B | 2 |
Entity 1, A 22 residues - Formula weight is not available
1 | DG | DC | DG | DT | DA | DT | DA | DA | DT | DG | ||||
2 | DT | DA | DT | DG | DC | DT | DA | DT | DA | DC | ||||
3 | DG | DG |
Entity 2, B 22 residues - Formula weight is not available
1 | DC | DC | DG | DT | DA | DT | DA | DG | DC | DA | ||||
2 | DT | DA | DC | DA | DT | DT | DA | DT | DA | DC | ||||
3 | DG | DC |