Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR51349
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Liu, Yaping; Munsayac, Aldrex; Hall, Ian; Keane, Sarah. "Solution structure of NPSL2, a regulatory element in the oncomiR-1 RNA" J. Mol. Biol. ., .-..
Assembly members:
entity_1, polymer, 22 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: In vitro transcription Host organism: In vitro
Entity Sequences (FASTA):
entity_1: GGAGGGAAACUCAAACCCCU
CC
Data type | Count |
13C chemical shifts | 29 |
1H chemical shifts | 170 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | NPSL2_Frag2 | 1 |
Entity 1, NPSL2_Frag2 22 residues - Formula weight is not available
1 | G | G | A | G | G | G | A | A | A | C | ||||
2 | U | C | A | A | A | C | C | C | C | U | ||||
3 | C | C |