BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

Instant search results.

These results are sorted by relevance. You can sort the results by clicking on the table headers.

Entry ID Data summary Entry Title Citation Title Authors
25746 Chemical Shifts: 1 set
G-quadruplex structure G-quadruplexes with (4n - 1) guanines in the G-tetrad core: formation of a G-triadwater complex and implication for small-molecule binding Download bibtex for citation iamge Anh Tuan Phan, Brahim Heddi, Nerea Martin-Pintado, Teuku Kari, Zhalgas Serimbetov
25582 Chemical Shifts: 1 set
structure of a protein Insights into G-quadruplex specific recognition by the DEAH-box helicase RHAU: Solution structure of a peptide-quadruplex complex Download bibtex for citation iamge Anh Tuan AT Phan, Brahim Heddi, Herry Martadinata, Vee Vee VV Cheong
25686 Chemical Shifts: 1 set
Structure of a G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome Structure of a G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome Download bibtex for citation iamge Anh Tuan Phan, Beatrice de Nicola, Brahim Heddi, Christopher Jacques Lech, Sagar Regmi, Sara Richter
25651 Chemical Shifts: 1 set
Isolation and structural characterization of an active G-quadruplex motif from AGRO100 Isolation and structural characterization of an active G-quadruplex motif from AGRO100 Download bibtex for citation iamge Anh Tuan Phan, Brahim Heddi, Wan Jun Chung
25548 Chemical Shifts: 1 set
structure of a peptide Insights into G-quadruplex specific recognition by the DEAH-box helicase RHAU: Solution structure of a peptide-quadruplex complex Download bibtex for citation iamge Anh Tuan AT Phan, Brahim Heddi, Herry Martadinata, Vee Vee VV Cheong
25378 Chemical Shifts: 1 set
A structure of G-quadruplex Xanthine and 8-oxoguanine in G-quadruplexes: formation of a GGXO tetrad Download bibtex for citation iamge Anh Tuan AT Phan, Brahim Heddi, Christopher CJ Lech, Vee Vee VV Cheong
25110 Chemical Shifts: 1 set
Solution structure of a left-handed G-quadruplex Structure of a left-handed DNA G-quadruplex Download bibtex for citation iamge Anh Tuan Phan, Brahim Heddi, Emmanuelle Schmitt, Kah Wai Lim, Wan Jun Chung, Yves Mechulam
19594 Chemical Shifts: 1 set
Solution structure of a G-quadruplex bound to the bisquinolinium compound Phen-DC3 Solution Structure of a G-quadruplex Bound to the Bisquinolinium Compound Phen-DC3. Download bibtex for citation iamge Anh Tuan Phan, Brahim Heddi, Florian Hamon, Marie-Paule Teulade-Fichou, Wan Jun Chung
19402 Chemical Shifts: 1 set
Structure of an antiparallel (2+2) G-quadruplex formed by human telomeric repeats in Na+ solution (with G22-to-BrG substitution) Structure of the human telomere in Na+ solution: an antiparallel (2+2) G-quadruplex scaffold reveals additional diversity. Download bibtex for citation iamge Anh Tuan Phan, Brahim Heddi, Kah Wai Lim, Nerea Martin-Pintado, Veronica Chinn Min Ng
19389 Chemical Shifts: 1 set
Solution structure of a stacked dimeric G-quadruplex formed by a segment of the human CEB1 minisatellite Structure and Conformational Dynamics of a Stacked Dimeric G-Quadruplex Formed by the Human CEB1 Minisatellite Download bibtex for citation iamge Alain Nicolas, Anh Tuan Phan, Brahim Heddi, Christopher J Lech, Ding Jie Ang, Michael Adrian
19387 Chemical Shifts: 1 set
Solution structure of an intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative Solution structure of an intramolecular (3 + 1) human telomeric g-quadruplex bound to a telomestatin derivative. Download bibtex for citation iamge Anh Tuan Phan, Brahim Heddi, Kazuo Nagasawa, Keisuke Iida, Masayuki Tera, Wan Jun Chung
19386 Chemical Shifts: 1 set
parallel-stranded G-quadruplex in DNA poly-G stretches Formation of G-quadruplexes in poly-G sequences: Structure of a propeller-type parallel-stranded G-quadruplex formed by a G15 stretch Download bibtex for citation iamge Anh Tuan Phan, Anjali Sengar, Brahim Heddi
19381 Chemical Shifts: 1 set
Engineering G4: Towards effective incorporation of locked nucleic acid into G-quadruplexes Engineering G4: Towards effective incorporation of locked nucleic acid into G-quadruplexes Download bibtex for citation iamge Anh Tuan Phan, Brahim Heddi, Christopher Lech, Michael Adrian, Zhe Li
19279 Chemical Shifts: 1 set
Structure of d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid Structural basis of DNA quadruplex-duplex junction formation. Download bibtex for citation iamge Anh Tuan Phan, Kah Wai Lim
19280 Chemical Shifts: 1 set
Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybrid Structural basis of DNA quadruplex-duplex junction formation. Download bibtex for citation iamge Anh Tuan Phan, Kah Wai Lim
19281 Chemical Shifts: 1 set
Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid Structural basis of DNA quadruplex-duplex junction formation. Download bibtex for citation iamge Anh Tuan Phan, Kah Wai Lim
19277 Chemical Shifts: 1 set
Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid Structural basis of DNA quadruplex-duplex junction formation. Download bibtex for citation iamge Anh Tuan Phan, Kah Wai Lim
19278 Chemical Shifts: 1 set
Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid Structural basis of DNA quadruplex-duplex junction formation. Download bibtex for citation iamge Anh Tuan Phan, Kah Wai Lim
19276 Chemical Shifts: 1 set
Structure of d[CGCGAAGCATTCGCG] hairpin Structural basis of DNA quadruplex-duplex junction formation. Download bibtex for citation iamge Anh Tuan Phan, Kah Wai Lim
19017 Chemical Shifts: 1 set
Solution structure of an intramolecular propeller-type G-quadruplex containing a single bulge Bulges in g-quadruplexes: broadening the definition of g-quadruplex-forming sequences. Download bibtex for citation iamge Anh Tuan Phan, Vineeth Thachappilly Mukundan
18847 Chemical Shifts: 1 set
Structure of stacked G-quadruplex formed by human TERRA sequence in potassium solution Structure of Human Telomeric RNA (TERRA): Stacking of Two G-Quadruplex Blocks in K(+) Solution. Download bibtex for citation iamge Anh Tuan Phan, Herry Martadinata
18279 Chemical Shifts: 1 set
human CEB25 minisatellite G-quadruplex Formation of pearl-necklace monomorphic G-quadruplexes in the human CEB25 minisatellite. Download bibtex for citation iamge Alain Nicolas, Alexandre Serero, Anh Tuan Phan, Brahim Heddi, Jean-Louis Mergny, Michael Adrian, Samir Amrane
17980 Chemical Shifts: 1 set
Monomer-dimer equilibrium for 5 -5 stacking of propeller-type parallel-stranded G-quadruplexes: NMR structural study Monomer-dimer equilibrium for the 5'-5' stacking of propeller-type parallel-stranded G-quadruplexes: NMR structural study. Download bibtex for citation iamge Anh Tuan Phan, Ngoc Quang Do
17697 Chemical Shifts: 1 set
Structure of a dimeric all-parallel-stranded G-quadruplex stacked via the 5'-to-5' interface Stacking of G-quadruplexes: NMR structure of a G-rich oligonucleotide with potential anti-HIV and anticancer activity. Download bibtex for citation iamge Anh Tuan Phan, Brahim Heddi, Kah Wai Lim, Ming Hoon Teo, Ngoc Quang Do
17655 Chemical Shifts: 1 set
Structure of Human Telomeric DNA in Crowded Solution Structure of Human Telomeric DNA in Crowded Solution Download bibtex for citation iamge Anh Tuan Phan, Brahim Heddi
17504 Chemical Shifts: 1 set
RNA Duplex-Quadruplex Junction Complex with FMRP RGG peptide Structure-function studies of FMRP RGG peptide recognition of an RNA duplex-quadruplex junction. Download bibtex for citation iamge Alexander Serganov, Ananya Majumdar, Anh Tuan Phan, Anna Polonskaia, Cynthia Chen, David Clain, Dinshaw J Patel, Jennifer C Darnell, Robert B Darnell, Serge Ilin, Tanya Raslin, Vitaly Kuryavyi
6430 Chemical Shifts: 1 set
1H and 31P chemical shift assignments for HIV-1 integrase inhibitor 93del An interlocked dimeric parallel-stranded DNA quadruplex: a potent inhibitor of HIV-1 integrase Download bibtex for citation iamge Anh Tuan Phan, Aurelie Faure, Dinshaw J Patel, Jin-Biao Ma, Marie-Line Andreola, Vitaly Kuryavyi