Entry ID |
Data summary |
Entry Title |
Citation Title |
Authors |
25746 |
Chemical Shifts: 1 set |
G-quadruplex structure |
G-quadruplexes with (4n - 1) guanines in the G-tetrad core: formation of a G-triadwater complex and implication for small-molecule binding
|
Anh Tuan Phan, Brahim Heddi, Nerea Martin-Pintado, Teuku Kari, Zhalgas Serimbetov |
25582 |
Chemical Shifts: 1 set |
structure of a protein |
Insights into G-quadruplex specific recognition by the DEAH-box helicase RHAU: Solution structure of a peptide-quadruplex complex
|
Anh Tuan AT Phan, Brahim Heddi, Herry Martadinata, Vee Vee VV Cheong |
25686 |
Chemical Shifts: 1 set |
Structure of a G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome |
Structure of a G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome
|
Anh Tuan Phan, Beatrice de Nicola, Brahim Heddi, Christopher Jacques Lech, Sagar Regmi, Sara Richter |
25651 |
Chemical Shifts: 1 set |
Isolation and structural characterization of an active G-quadruplex motif from AGRO100 |
Isolation and structural characterization of an active G-quadruplex motif from AGRO100
|
Anh Tuan Phan, Brahim Heddi, Wan Jun Chung |
25548 |
Chemical Shifts: 1 set |
structure of a peptide |
Insights into G-quadruplex specific recognition by the DEAH-box helicase RHAU: Solution structure of a peptide-quadruplex complex
|
Anh Tuan AT Phan, Brahim Heddi, Herry Martadinata, Vee Vee VV Cheong |
25378 |
Chemical Shifts: 1 set |
A structure of G-quadruplex |
Xanthine and 8-oxoguanine in G-quadruplexes: formation of a GGXO tetrad
|
Anh Tuan AT Phan, Brahim Heddi, Christopher CJ Lech, Vee Vee VV Cheong |
25110 |
Chemical Shifts: 1 set |
Solution structure of a left-handed G-quadruplex |
Structure of a left-handed DNA G-quadruplex
|
Anh Tuan Phan, Brahim Heddi, Emmanuelle Schmitt, Kah Wai Lim, Wan Jun Chung, Yves Mechulam |
19594 |
Chemical Shifts: 1 set |
Solution structure of a G-quadruplex bound to the bisquinolinium compound Phen-DC3 |
Solution Structure of a G-quadruplex Bound to the Bisquinolinium Compound Phen-DC3.
|
Anh Tuan Phan, Brahim Heddi, Florian Hamon, Marie-Paule Teulade-Fichou, Wan Jun Chung |
19402 |
Chemical Shifts: 1 set |
Structure of an antiparallel (2+2) G-quadruplex formed by human telomeric repeats in Na+ solution (with G22-to-BrG substitution) |
Structure of the human telomere in Na+ solution: an antiparallel (2+2) G-quadruplex scaffold reveals additional diversity.
|
Anh Tuan Phan, Brahim Heddi, Kah Wai Lim, Nerea Martin-Pintado, Veronica Chinn Min Ng |
19389 |
Chemical Shifts: 1 set |
Solution structure of a stacked dimeric G-quadruplex formed by a segment of the human CEB1 minisatellite |
Structure and Conformational Dynamics of a Stacked Dimeric G-Quadruplex Formed by the Human CEB1 Minisatellite
|
Alain Nicolas, Anh Tuan Phan, Brahim Heddi, Christopher J Lech, Ding Jie Ang, Michael Adrian |
19387 |
Chemical Shifts: 1 set |
Solution structure of an intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative |
Solution structure of an intramolecular (3 + 1) human telomeric g-quadruplex bound to a telomestatin derivative.
|
Anh Tuan Phan, Brahim Heddi, Kazuo Nagasawa, Keisuke Iida, Masayuki Tera, Wan Jun Chung |
19386 |
Chemical Shifts: 1 set |
parallel-stranded G-quadruplex in DNA poly-G stretches |
Formation of G-quadruplexes in poly-G sequences: Structure of a propeller-type parallel-stranded G-quadruplex formed by a G15 stretch
|
Anh Tuan Phan, Anjali Sengar, Brahim Heddi |
19381 |
Chemical Shifts: 1 set |
Engineering G4: Towards effective incorporation of locked nucleic acid into G-quadruplexes |
Engineering G4: Towards effective incorporation of locked nucleic acid into G-quadruplexes
|
Anh Tuan Phan, Brahim Heddi, Christopher Lech, Michael Adrian, Zhe Li |
19279 |
Chemical Shifts: 1 set |
Structure of d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid |
Structural basis of DNA quadruplex-duplex junction formation.
|
Anh Tuan Phan, Kah Wai Lim |
19280 |
Chemical Shifts: 1 set |
Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybrid |
Structural basis of DNA quadruplex-duplex junction formation.
|
Anh Tuan Phan, Kah Wai Lim |
19281 |
Chemical Shifts: 1 set |
Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid |
Structural basis of DNA quadruplex-duplex junction formation.
|
Anh Tuan Phan, Kah Wai Lim |
19277 |
Chemical Shifts: 1 set |
Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid |
Structural basis of DNA quadruplex-duplex junction formation.
|
Anh Tuan Phan, Kah Wai Lim |
19278 |
Chemical Shifts: 1 set |
Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid |
Structural basis of DNA quadruplex-duplex junction formation.
|
Anh Tuan Phan, Kah Wai Lim |
19276 |
Chemical Shifts: 1 set |
Structure of d[CGCGAAGCATTCGCG] hairpin |
Structural basis of DNA quadruplex-duplex junction formation.
|
Anh Tuan Phan, Kah Wai Lim |
19017 |
Chemical Shifts: 1 set |
Solution structure of an intramolecular propeller-type G-quadruplex containing a single bulge |
Bulges in g-quadruplexes: broadening the definition of g-quadruplex-forming sequences.
|
Anh Tuan Phan, Vineeth Thachappilly Mukundan |
18847 |
Chemical Shifts: 1 set |
Structure of stacked G-quadruplex formed by human TERRA sequence in potassium solution |
Structure of Human Telomeric RNA (TERRA): Stacking of Two G-Quadruplex Blocks in K(+) Solution.
|
Anh Tuan Phan, Herry Martadinata |
18279 |
Chemical Shifts: 1 set |
human CEB25 minisatellite G-quadruplex |
Formation of pearl-necklace monomorphic G-quadruplexes in the human CEB25 minisatellite.
|
Alain Nicolas, Alexandre Serero, Anh Tuan Phan, Brahim Heddi, Jean-Louis Mergny, Michael Adrian, Samir Amrane |
17980 |
Chemical Shifts: 1 set |
Monomer-dimer equilibrium for 5 -5 stacking of propeller-type parallel-stranded G-quadruplexes: NMR structural study |
Monomer-dimer equilibrium for the 5'-5' stacking of propeller-type parallel-stranded G-quadruplexes: NMR structural study.
|
Anh Tuan Phan, Ngoc Quang Do |
17697 |
Chemical Shifts: 1 set |
Structure of a dimeric all-parallel-stranded G-quadruplex stacked via the 5'-to-5' interface |
Stacking of G-quadruplexes: NMR structure of a G-rich oligonucleotide with potential anti-HIV and anticancer activity.
|
Anh Tuan Phan, Brahim Heddi, Kah Wai Lim, Ming Hoon Teo, Ngoc Quang Do |
17655 |
Chemical Shifts: 1 set |
Structure of Human Telomeric DNA in Crowded Solution |
Structure of Human Telomeric DNA in Crowded Solution
|
Anh Tuan Phan, Brahim Heddi |
17504 |
Chemical Shifts: 1 set |
RNA Duplex-Quadruplex Junction Complex with FMRP RGG peptide |
Structure-function studies of FMRP RGG peptide recognition of an RNA duplex-quadruplex junction.
|
Alexander Serganov, Ananya Majumdar, Anh Tuan Phan, Anna Polonskaia, Cynthia Chen, David Clain, Dinshaw J Patel, Jennifer C Darnell, Robert B Darnell, Serge Ilin, Tanya Raslin, Vitaly Kuryavyi |
6430 |
Chemical Shifts: 1 set |
1H and 31P chemical shift assignments for HIV-1 integrase inhibitor 93del |
An interlocked dimeric parallel-stranded DNA quadruplex: a potent inhibitor of HIV-1 integrase
|
Anh Tuan Phan, Aurelie Faure, Dinshaw J Patel, Jin-Biao Ma, Marie-Line Andreola, Vitaly Kuryavyi |