Biological Magnetic Resonance Data BankA Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules |
Member of |
Entry ID | Data summary | Entry Title | Citation Title(s) | Authors |
---|---|---|---|---|
26973 | Chemical Shifts: 1 set |
Near-complete backbone resonance assignments of acid-denatured human cytochrome c in DMSO: a prelude to studying interactions with phospholipids | Near-complete backbone resonance assignments of acid-denatured human cytochrome c in dimethylsulfoxide: a prelude to studying interactions with phospholipids | Andreas Ioannis Karsisiotis, Colin Macdonald, Geoffrey R Moore, Jonathan AR Worrall, Oliver M Deacon, Tharin MA Blumenschein |
30058 | Chemical Shifts: 1 set |
DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium | Encoding canonical DNA quadruplex structure. | Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin |
30055 | Chemical Shifts: 1 set |
DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTTGG) in sodium | Encoding canonical DNA quadruplex structure. | Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin |
30056 | Chemical Shifts: 1 set |
DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTGG) in sodium | Encoding canonical DNA quadruplex structure. | Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin |
30045 | Chemical Shifts: 1 set |
DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium | Encoding canonical DNA quadruplex structure. | Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin |
25422 | Chemical Shifts: 1 set |
Backbone 1H, 13C, and 15N Chemical Shift Assignments for the ferric form of the G41S mutant of Human Cytochrome c | Backbone resonance assignments of ferric human cytochrome c and the pro-apoptotic G41S mutant in the ferric and ferrous states | Andreas Ioannis Karsisiotis, Badri S Rajagopal, Colin Macdonald, Geoffrey R Moore, Jonathan AR Worrall, Oliver M Deacon, Tharin MA Blumenschein |
25420 | Chemical Shifts: 1 set |
Backbone 1H, 13C, and 15N Chemical Shift Assignments for the ferrous form of the G41S mutant of Human Cytochrome c | Backbone resonance assignments of ferric human cytochrome c and the pro-apoptotic G41S mutant in the ferric and ferrous states | Andreas Ioannis Karsisiotis, Badri S Rajagopal, Colin Macdonald, Geoffrey R Moore, Jonathan AR Worrall, Oliver M Deacon, Tharin MA Blumenschein |
25418 | Chemical Shifts: 1 set |
Human Cytochrome c WT ferric form (oxidized) | Backbone resonance assignments of ferric human cytochrome c and the pro-apoptotic G41S mutant in the ferric and ferrous states | Andreas Ioannis Karsisiotis, Badri S Rajagopal, Colin Macdonald, Geoffrey R Moore, Jonathan AR Worrall, Oliver M Deacon, Tharin MA Blumenschein |
19572 | Chemical Shifts: 1 set |
Solution NMR structure of quadruplex d(TGGGTTTGGGTTGGGTTTGGG) in sodium conditions. | In preparation | Andreas Ioannis Karsisiotis, Mateus Webba da Silva, Paul Dillon |
19571 | Chemical Shifts: 2 sets |
Solution NMR structure of the d(GGGTTTTGGGTGGGTTTTGGG) quadruplex in sodium conditions. | Encoding canonical DNA quadruplex structure. | Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin |
19158 | Chemical Shifts: 2 sets |
Solution NMR structure of the d(GGGTTGGGTTTTGGGTGGG) quadruplex in sodium conditions | DNA quadruplex folding formalism--a tutorial on quadruplex topologies. | Andreas Ioannis Karsisiotis, Christopher Webba da Silva |
19159 | Chemical Shifts: 2 sets |
Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions | DNA quadruplex folding formalism--a tutorial on quadruplex topologies. | Andreas Ioannis Karsisiotis, Christopher Webba da Silva |
19048 | Chemical Shifts: 2 sets |
Solution Structure of the Bacillus cereus Metallo-Beta-Lactamase BcII in Complex with R-Thiomandelic Acid | Complete 1H, 15N and 13C resonance assignments of Bacillus cereus metallo-beta-lactamase and its complex with the inhibitor R-thiomandelic acid | Andreas Ioannis Karsisiotis, Christian F Damblon, Gordon CK Roberts |
19047 | Chemical Shifts: 2 sets |
Solution Structure of the Bacillus cereus Metallo-Beta-Lactamase BcII |
1: Complete 1H, 15N and 13C resonance assignments of Bacillus cereus metallo-beta-lactamase and its complex with the inhibitor R-thiomandelic acid 2: Complete 1H, 15N and 13C Resonance Assignments of the 25 kDa Bacillus cereus Metallo-Beta-Lactamase BcII and its Complex with the Broad Spectrum Inhibitor R-Thiomandelic Acid |
Andreas Ioannis Karsisiotis, Christian F Damblon, Gordon C Roberts |
18204 | Chemical Shifts: 1 set |
Backbone 1H, 13C, and 15N Chemical Shift Assignments for human PEBP1 | Ligand binding study of human PEBP1/RKIP: interaction with nucleotides and Raf-1 peptides evidenced by NMR and mass spectrometry. | Agnes F Delmas, Alain Brans, Andreas I Karsisiotis, Christian Damblon, Fabienne Saab, Francoise Schoentgen, Laurence Jouvensal, Laurette Tavel, Lucie Jaquillard, Martine Cadene |