BMRB Instant Search Results

Instant search results.

These results are sorted by relevance. You can sort the results by clicking on the table headers.

Entry ID	Data summary	Entry Title	Citation Title(s)	Authors
26973	Chemical Shifts: 1 set	Near-complete backbone resonance assignments of acid-denatured human cytochrome c in DMSO: a prelude to studying interactions with phospholipids	Near-complete backbone resonance assignments of acid-denatured human cytochrome c in dimethylsulfoxide: a prelude to studying interactions with phospholipids	Andreas Ioannis Karsisiotis, Colin Macdonald, Geoffrey R Moore, Jonathan AR Worrall, Oliver M Deacon, Tharin MA Blumenschein
30058	Chemical Shifts: 1 set	DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium	Encoding canonical DNA quadruplex structure.	Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin
30055	Chemical Shifts: 1 set	DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTTGG) in sodium	Encoding canonical DNA quadruplex structure.	Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin
30056	Chemical Shifts: 1 set	DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTGG) in sodium	Encoding canonical DNA quadruplex structure.	Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin
30045	Chemical Shifts: 1 set	DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium	Encoding canonical DNA quadruplex structure.	Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin
25422	Chemical Shifts: 1 set	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the ferric form of the G41S mutant of Human Cytochrome c	Backbone resonance assignments of ferric human cytochrome c and the pro-apoptotic G41S mutant in the ferric and ferrous states	Andreas Ioannis Karsisiotis, Badri S Rajagopal, Colin Macdonald, Geoffrey R Moore, Jonathan AR Worrall, Oliver M Deacon, Tharin MA Blumenschein
25420	Chemical Shifts: 1 set	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the ferrous form of the G41S mutant of Human Cytochrome c	Backbone resonance assignments of ferric human cytochrome c and the pro-apoptotic G41S mutant in the ferric and ferrous states	Andreas Ioannis Karsisiotis, Badri S Rajagopal, Colin Macdonald, Geoffrey R Moore, Jonathan AR Worrall, Oliver M Deacon, Tharin MA Blumenschein
25418	Chemical Shifts: 1 set	Human Cytochrome c WT ferric form (oxidized)	Backbone resonance assignments of ferric human cytochrome c and the pro-apoptotic G41S mutant in the ferric and ferrous states	Andreas Ioannis Karsisiotis, Badri S Rajagopal, Colin Macdonald, Geoffrey R Moore, Jonathan AR Worrall, Oliver M Deacon, Tharin MA Blumenschein
19572	Chemical Shifts: 1 set	Solution NMR structure of quadruplex d(TGGGTTTGGGTTGGGTTTGGG) in sodium conditions.	In preparation	Andreas Ioannis Karsisiotis, Mateus Webba da Silva, Paul Dillon
19571	Chemical Shifts: 2 sets	Solution NMR structure of the d(GGGTTTTGGGTGGGTTTTGGG) quadruplex in sodium conditions.	Encoding canonical DNA quadruplex structure.	Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin
19158	Chemical Shifts: 2 sets	Solution NMR structure of the d(GGGTTGGGTTTTGGGTGGG) quadruplex in sodium conditions	DNA quadruplex folding formalism--a tutorial on quadruplex topologies.	Andreas Ioannis Karsisiotis, Christopher Webba da Silva
19159	Chemical Shifts: 2 sets	Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions	DNA quadruplex folding formalism--a tutorial on quadruplex topologies.	Andreas Ioannis Karsisiotis, Christopher Webba da Silva
19048	Chemical Shifts: 2 sets	Solution Structure of the Bacillus cereus Metallo-Beta-Lactamase BcII in Complex with R-Thiomandelic Acid	Complete 1H, 15N and 13C resonance assignments of Bacillus cereus metallo-beta-lactamase and its complex with the inhibitor R-thiomandelic acid	Andreas Ioannis Karsisiotis, Christian F Damblon, Gordon CK Roberts
19047	Chemical Shifts: 2 sets	Solution Structure of the Bacillus cereus Metallo-Beta-Lactamase BcII	1: Complete 1H, 15N and 13C resonance assignments of Bacillus cereus metallo-beta-lactamase and its complex with the inhibitor R-thiomandelic acid 2: Complete 1H, 15N and 13C Resonance Assignments of the 25 kDa Bacillus cereus Metallo-Beta-Lactamase BcII and its Complex with the Broad Spectrum Inhibitor R-Thiomandelic Acid	Andreas Ioannis Karsisiotis, Christian F Damblon, Gordon C Roberts
18204	Chemical Shifts: 1 set	Backbone 1H, 13C, and 15N Chemical Shift Assignments for human PEBP1	Ligand binding study of human PEBP1/RKIP: interaction with nucleotides and Raf-1 peptides evidenced by NMR and mass spectrometry.	Agnes F Delmas, Alain Brans, Andreas I Karsisiotis, Christian Damblon, Fabienne Saab, Francoise Schoentgen, Laurence Jouvensal, Laurette Tavel, Lucie Jaquillard, Martine Cadene