BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

Instant search results.

These results are sorted by relevance. You can sort the results by clicking on the table headers.

Entry ID Data summary Entry Title Citation Title Authors
34837 Chemical Shifts: 1 set
Solution structure of the peptide U11-MYRTX-Tb1a from the venom of the ant Tetramorium bicarinatum Discovery of an Insect Neuroactive Helix Ring Peptide from Ant Venom. Download bibtex for citation iamge A Billet, A Dejean, A Touchard, B Lefranc, C Sivignon, E Bonnafe, F Calevro, F Paquet, G Boy, I Rahioui, J Leprince, K Gaget, K Loth, L Jouvensal, M Ribeiro Lopes, M Treilhou, P Da Silva, S Ascoet, V Barasse, V Lacotte
51692 Chemical Shifts: 1 set
Sidechain Ile, Leu, and Val methyl Chemical Shift Assignments for Penicillin Binding Protein 5 Molecular basis of b-lactam antibiotic resistance of ESKAPE bacterium E. faecium Penicillin Binding Protein PBP5 Download bibtex for citation iamge Andre Da Silva Santiago, Charlene Desbonnet, Everton D D'Andrea, Ganesan Senthil S Kumar, Louis B Rice, Marta V Schoenle, Meng S Choy, Michel Arthur, Rebecca Page, Wolfgang Peti, Yamanappa Hunashal
51690 Chemical Shifts: 1 set
Sequence Specific 1H, 13C, and 15N backbone resonance assignments of 70 kDa Penicillin Binding Protein PBP5 Molecular basis of b-lactam antibiotic resistance of ESKAPE bacterium E. faecium Penicillin Binding Protein PBP5 Download bibtex for citation iamge Andre Da Silva Santiago, Charlene Desbonnet, Everton D D'Andrea, Ganesan Senthil S Kumar, Louis B Rice, Marta V Schoenle, Meng S Choy, Michel Arthur, Rebecca Page, Wolfgang Peti, Yamanappa Hunashal
34742 Chemical Shifts: 1 set
Solution NMR structure of AG41, a 41-amino acid insecticidal protein extracted from Medicago truncatula Residues of Legume AG41 Peptide Crucial to Its Bio-Insecticidal Activity Download bibtex for citation iamge Catherine Sivignon, Fatima Diya, Francine Rizk, Isabelle Rahioui, Karine Loth, Lamis Karaki, Laurence Jouvensal, Linda Kfoury, Pedro Da Silva
34667 Chemical Shifts: 1 set
NMR solution structure of BCR4 Aphid BCR4 Structure and Activity Uncover a New Defensin Peptide Superfamily Download bibtex for citation iamge Abdelaziz Heddi, Agnes F Delmas, Catherine Sivignon, Federica Calevro, Francoise Paquet, Gabrielle Duport, Hugo Terrasson, Isabelle Rahioui, Karen Gaget, Karine Loth, Melanie Ribeiro Lopes, Nicolas Parisot, Pedro da Silva, Vincent Aucagne
50741 Chemical Shifts: 1 set
Backbone 1H, 15N and 13C chemical shift assignments for HEV ORF1 peptide [1622-1647] (isolate G3-HEV83-2-27) in 20% TFE-d2 Hepatitis E virus RNA-dependent RNA polymerase is involved in RNA replication and infectious particle production Download bibtex for citation iamge Dagmara Szkolnicka, Darius Moradpour, Francois-Xavier X Cantrelle, Jerome Gouttenoire, Nathalie Da Silva, Noemie Oechslin, Xavier Hanoulle
30717 Chemical Shifts: 1 set
Spectral_peak_list: 1 set
Hs05 - Intragenic antimicrobial peptide Characterization of novel human intragenic antimicrobial peptides, incorporation and release studies from ureasil-polyether hybrid matrix Download bibtex for citation iamge A L Oliveira, A R Araujo, B Lira, C Bloch, E A Barbosa, E M Carmo da Silva, G D Brand, G H Mariano, J A Chaker, J L Cardozo Fh, J Leite, L G Gomes de Sa, M A Santos, M Ramada
34346 Chemical Shifts: 1 set
NMR Structure of Big-defensin 1 from oyster Crassostrea gigas The Ancestral N-Terminal Domain of Big Defensins Drives Bacterially Triggered Assembly into Antimicrobial Nanonets. Download bibtex for citation iamge A Bressan, A F Delmas, A Vergnes, C Barreto, C Cazevielle, D Destoumieux-Garzon, E Bachere, H Marchandin, H Meudal, J Da Silva, K Loth, L Touqui, N Belmadi, P Bulet, R D Rosa, S N Voisin, V Aucagne
34345 Chemical Shifts: 1 set
NMR Structure of Big-defensin 1 [44-93] from oyster Crassostrea gigas The Ancestral N-Terminal Domain of Big Defensins Drives Bacterially Triggered Assembly into Antimicrobial Nanonets. Download bibtex for citation iamge A Bressan, A F Delmas, A Vergnes, C Barreto, C Cazevielle, D Destoumieux-Garzon, E Bachere, H Marchandin, H Meudal, J Da Silva, K Loth, L Touqui, N Belmadi, P Bulet, R D Rosa, S N Voisin, V Aucagne
30058 Chemical Shifts: 1 set
DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium Encoding canonical DNA quadruplex structure. Download bibtex for citation iamge Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin
30055 Chemical Shifts: 1 set
DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTTGG) in sodium Encoding canonical DNA quadruplex structure. Download bibtex for citation iamge Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin
30056 Chemical Shifts: 1 set
DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTGG) in sodium Encoding canonical DNA quadruplex structure. Download bibtex for citation iamge Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin
30045 Chemical Shifts: 1 set
DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium Encoding canonical DNA quadruplex structure. Download bibtex for citation iamge Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin
25512 Chemical Shifts: 1 set
NMR structure of VirB9 C-terminal domain in complex with VirB7 N-terminal domain from Xanthomonas citri's T4SS. VirB7 and VirB9 Interactions Are Required for the Assembly and Antibacterial Activity of a Type IV Secretion System Download bibtex for citation iamge Chuck Shaker S Farah, Denize Cristina C Favaro, Diorge Paulo P Souza, Filipe da Silva Lima, Gabriel Umaji U Oka, Hans Wienk, Luciana Coutinho C Oliveira, Roberto Kopke K Salinas, Rolf Boelens, Ronaldo Junio J Oliveira
19834 Chemical Shifts: 1 set
New Cyt-like delta-endotoxins from Dickeya dadantii - CytC protein New Cyt-like delta-endotoxins from Dickeya dadantii : structure and aphicidal activity Download bibtex for citation iamge Celine Landon, Denis Costechareyre, Geraldine Effantin, Guy Contdemine, Karine Loth, Pedro Da Silva, Yvan Rahbe
19572 Chemical Shifts: 1 set
Solution NMR structure of quadruplex d(TGGGTTTGGGTTGGGTTTGGG) in sodium conditions. In preparation Download bibtex for citation iamge Andreas Ioannis Karsisiotis, Mateus Webba da Silva, Paul Dillon
19571 Chemical Shifts: 2 sets
Solution NMR structure of the d(GGGTTTTGGGTGGGTTTTGGG) quadruplex in sodium conditions. Encoding canonical DNA quadruplex structure. Download bibtex for citation iamge Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin
19158 Chemical Shifts: 2 sets
Solution NMR structure of the d(GGGTTGGGTTTTGGGTGGG) quadruplex in sodium conditions DNA quadruplex folding formalism--a tutorial on quadruplex topologies. Download bibtex for citation iamge Andreas Ioannis Karsisiotis, Christopher Webba da Silva
19159 Chemical Shifts: 2 sets
Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions DNA quadruplex folding formalism--a tutorial on quadruplex topologies. Download bibtex for citation iamge Andreas Ioannis Karsisiotis, Christopher Webba da Silva
17709 Chemical Shifts: 1 set
Solution-state structures of monomeric and dimeric G-quadruplexes formed by a sequence from N-myc Unique Structural Features of Interconverting Monomeric and Dimeric G-Quadruplexes Adopted by a Sequence from the Intron of the N-myc Gene. Download bibtex for citation iamge Janez Plavec, Marko Trajkovski, Mateus Webba da Silva
17708 Chemical Shifts: 1 set
Solution-state structures of monomeric and dimeric G-quadruplexes adopted by a sequence from N-myc Unique Structural Features of Interconverting Monomeric and Dimeric G-Quadruplexes Adopted by a Sequence from the Intron of the N-myc Gene. Download bibtex for citation iamge Janez Plavec, Marko Trajkovski, Mateus Webba da Silva
5494 Chemical Shifts: 3 sets
NMR Structure of PW2 Bound to SDS Micelles: A Tryptophan-rich Anticocidial Peptide Selected from Phage Display Libraries NMR Structure of PW2 bound to SDS Micelles. A Tryptophan-rich Anticocidial Peptide selected from Phage Display Libraries Download bibtex for citation iamge A da Silva, A Leite, A P Valente, F C Almeida, L W Tinoco