BMRB Instant Search Results

Instant search results.

These results are sorted by relevance. You can sort the results by clicking on the table headers.

Entry ID	Data summary	Entry Title	Citation Title	Authors
51512	Chemical Shifts: 1 set	Backbone 1H, 13C, and 15N chemical shift assignments for the chromoshadow domain (residue 112-176) of human heterochromatin protein 1a (HP1a).	Molecular interactions underlying the phase separation of HP1a: role of phosphorylation, ligand and nucleic acid binding	Azamat Rizuan, Bryce E Ackermann, Cheenou Her, Galia T Debelouchina, Jeetain Mittal, Nina Jovic, Tien M Phan, Utkarsh Kapoor, Young Kim
30933	Chemical Shifts: 1 set	Solution NMR Structure of [Ala19]Crp4	A conserved beta-bulge glycine residue facilitates folding and increases stability of the mouse alpha-defensin cryptdin-4	A C Conibear, A J Ouellette, A Song, K J Rosengren, R J Clark, T H Phan
30934	Chemical Shifts: 1 set	Solution NMR Structure of [D-Ala19]Crp4	A conserved beta-bulge glycine residue facilitates folding and increases stability of the mouse alpha-defensin cryptdin-4	A C Conibear, A J Ouellette, A Song, K J Rosengren, R J Clark, T H Phan
50381	Chemical Shifts: 1 set Molecule Interaction Chemical Shift Values: 2 sets	The Structural Basis of PTEN Regulation by Multi-Site Phosphorylation	The Structural Basis of PTEN Regulation by Multi-Site Phosphorylation	Brad A Palanski, Daniel R Dempsey, Eunyoung Park, Haribabu Arthanari, Jeffrey J Gray, Jeliazko R Jeliazkov, Kim L Phan, Michael J Eck, Paul Coote, Philip A Cole, Reina Iwase, Sandra B Gabelli, Stephanie Henriquez, Thibault Viennet, Zan Chen
27989	Chemical Shifts: 1 set	Backbone and side-chain chemical shift assignments of the ribosome-inactivating protein trichobakin (TBK) in solution	Backbone and side-chain chemical shift assignments for the ribosome-inactivating protein trichobakin (TBK)	Alexander S Arseniev, Anatoly S Urban, Chi Van Phan, Dmitry M Lesovoy, Eduard V Bocharov, Elena V Britikova, Sergey A Usanov, Thi Bich Thao Le, Vladimir V Britikov
34302	Chemical Shifts: 1 set	The major G-quadruplex form of HIV-1 LTR	Major G-Quadruplex Form of HIV-1 LTR Reveals a (3 + 1) Folding Topology Containing a Stem-Loop	A T Phan, B Bakalar, B Heddi, E Butovskaya, S N Richter
30475	Chemical Shifts: 1 set	Solution structure of ZmD32	Salt-Tolerant Antifungal and Antibacterial Activities of the Corn Defensin ZmD32.	Bomai K Kerenga, David J Craik, Donovan Garcia-Ceron, Fung T Lay, James A McKenna, Kathy Parisi, Marilyn A Anderson, Mark D Hulett, Mark R Bleackley, Nicole L van der Weerden, Pedro Quimbar, Peta J Harvey, Prem K Veneer, Shaily Vasa, Thanh Kha K Phan, Thomas Shafee
25746	Chemical Shifts: 1 set	G-quadruplex structure	G-quadruplexes with (4n - 1) guanines in the G-tetrad core: formation of a G-triadwater complex and implication for small-molecule binding	Anh Tuan Phan, Brahim Heddi, Nerea Martin-Pintado, Teuku Kari, Zhalgas Serimbetov
25582	Chemical Shifts: 1 set	structure of a protein	Insights into G-quadruplex specific recognition by the DEAH-box helicase RHAU: Solution structure of a peptide-quadruplex complex	Anh Tuan AT Phan, Brahim Heddi, Herry Martadinata, Vee Vee VV Cheong
25686	Chemical Shifts: 1 set	Structure of a G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome	Structure of a G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome	Anh Tuan Phan, Beatrice de Nicola, Brahim Heddi, Christopher Jacques Lech, Sagar Regmi, Sara Richter
25651	Chemical Shifts: 1 set	Isolation and structural characterization of an active G-quadruplex motif from AGRO100	Isolation and structural characterization of an active G-quadruplex motif from AGRO100	Anh Tuan Phan, Brahim Heddi, Wan Jun Chung
25548	Chemical Shifts: 1 set	structure of a peptide	Insights into G-quadruplex specific recognition by the DEAH-box helicase RHAU: Solution structure of a peptide-quadruplex complex	Anh Tuan AT Phan, Brahim Heddi, Herry Martadinata, Vee Vee VV Cheong
25378	Chemical Shifts: 1 set	A structure of G-quadruplex	Xanthine and 8-oxoguanine in G-quadruplexes: formation of a GGXO tetrad	Anh Tuan AT Phan, Brahim Heddi, Christopher CJ Lech, Vee Vee VV Cheong
25278	Chemical Shifts: 1 set	Backbone chemical shift assignments for the sensor domain of the Burkholderia pseudomallei histidine kinase RisS. Seattle Structural Genomics Center for Infectious Disease target BupsA.00863.i.	Backbone chemical shift assignments for the sensor domain of the Burkholderia pseudomallei histidine kinase RisS - An "invisible" dimer interface.	Garry W Buchko, Isabelle Phan, Peter J Myler, Samuel I Miller, Stephen N Hewitt, Thomas E Edwards, Wesley C Van Voorhis
25110	Chemical Shifts: 1 set	Solution structure of a left-handed G-quadruplex	Structure of a left-handed DNA G-quadruplex	Anh Tuan Phan, Brahim Heddi, Emmanuelle Schmitt, Kah Wai Lim, Wan Jun Chung, Yves Mechulam
19594	Chemical Shifts: 1 set	Solution structure of a G-quadruplex bound to the bisquinolinium compound Phen-DC3	Solution Structure of a G-quadruplex Bound to the Bisquinolinium Compound Phen-DC3.	Anh Tuan Phan, Brahim Heddi, Florian Hamon, Marie-Paule Teulade-Fichou, Wan Jun Chung
19402	Chemical Shifts: 1 set	Structure of an antiparallel (2+2) G-quadruplex formed by human telomeric repeats in Na+ solution (with G22-to-BrG substitution)	Structure of the human telomere in Na+ solution: an antiparallel (2+2) G-quadruplex scaffold reveals additional diversity.	Anh Tuan Phan, Brahim Heddi, Kah Wai Lim, Nerea Martin-Pintado, Veronica Chinn Min Ng
19389	Chemical Shifts: 1 set	Solution structure of a stacked dimeric G-quadruplex formed by a segment of the human CEB1 minisatellite	Structure and Conformational Dynamics of a Stacked Dimeric G-Quadruplex Formed by the Human CEB1 Minisatellite	Alain Nicolas, Anh Tuan Phan, Brahim Heddi, Christopher J Lech, Ding Jie Ang, Michael Adrian
19386	Chemical Shifts: 1 set	parallel-stranded G-quadruplex in DNA poly-G stretches	Formation of G-quadruplexes in poly-G sequences: Structure of a propeller-type parallel-stranded G-quadruplex formed by a G15 stretch	Anh Tuan Phan, Anjali Sengar, Brahim Heddi
19387	Chemical Shifts: 1 set	Solution structure of an intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative	Solution structure of an intramolecular (3 + 1) human telomeric g-quadruplex bound to a telomestatin derivative.	Anh Tuan Phan, Brahim Heddi, Kazuo Nagasawa, Keisuke Iida, Masayuki Tera, Wan Jun Chung
19381	Chemical Shifts: 1 set	Engineering G4: Towards effective incorporation of locked nucleic acid into G-quadruplexes	Engineering G4: Towards effective incorporation of locked nucleic acid into G-quadruplexes	Anh Tuan Phan, Brahim Heddi, Christopher Lech, Michael Adrian, Zhe Li
19280	Chemical Shifts: 1 set	Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybrid	Structural basis of DNA quadruplex-duplex junction formation.	Anh Tuan Phan, Kah Wai Lim
19277	Chemical Shifts: 1 set	Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid	Structural basis of DNA quadruplex-duplex junction formation.	Anh Tuan Phan, Kah Wai Lim
19278	Chemical Shifts: 1 set	Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid	Structural basis of DNA quadruplex-duplex junction formation.	Anh Tuan Phan, Kah Wai Lim
19276	Chemical Shifts: 1 set	Structure of d[CGCGAAGCATTCGCG] hairpin	Structural basis of DNA quadruplex-duplex junction formation.	Anh Tuan Phan, Kah Wai Lim
19281	Chemical Shifts: 1 set	Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid	Structural basis of DNA quadruplex-duplex junction formation.	Anh Tuan Phan, Kah Wai Lim
19279	Chemical Shifts: 1 set	Structure of d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid	Structural basis of DNA quadruplex-duplex junction formation.	Anh Tuan Phan, Kah Wai Lim
19017	Chemical Shifts: 1 set	Solution structure of an intramolecular propeller-type G-quadruplex containing a single bulge	Bulges in g-quadruplexes: broadening the definition of g-quadruplex-forming sequences.	Anh Tuan Phan, Vineeth Thachappilly Mukundan
18847	Chemical Shifts: 1 set	Structure of stacked G-quadruplex formed by human TERRA sequence in potassium solution	Structure of Human Telomeric RNA (TERRA): Stacking of Two G-Quadruplex Blocks in K(+) Solution.	Anh Tuan Phan, Herry Martadinata
18707	Chemical Shifts: 1 set	Solution structure of TamA POTRA domain I	The C-terminal beta-signal-like motif of TamB facilitates efficient autotransporter secretion.	Joel Selkrig, Mark Schembri, Martin Scanlon, Matthew Belousoff, Minh-Duy Phan, Nermin Celik, Stephen Headey, Trevor Lithgow
18279	Chemical Shifts: 1 set	human CEB25 minisatellite G-quadruplex	Formation of pearl-necklace monomorphic G-quadruplexes in the human CEB25 minisatellite.	Alain Nicolas, Alexandre Serero, Anh Tuan Phan, Brahim Heddi, Jean-Louis Mergny, Michael Adrian, Samir Amrane
18016	Chemical Shifts: 1 set	Solution structure of MSMEG_1053, the second DUF3349 annotated protein in the genome of Mycobacterium smegmatis. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target MysmA.17112.b	Different structures for two DUF3349 annotated proteins in the genome of Mycobacterium smegmatis suggest a structural diversity within the DUF3349 superfamily.	Alberto J Napuli, Chang-Yub Kim, Garry W Buchko, Isabelle Phan, Jan Abendroth, Peter J Myler, Stephen N Hewitt, Thomas E Edwards, Wesley C Van Voorhis
17980	Chemical Shifts: 1 set	Monomer-dimer equilibrium for 5 -5 stacking of propeller-type parallel-stranded G-quadruplexes: NMR structural study	Monomer-dimer equilibrium for the 5'-5' stacking of propeller-type parallel-stranded G-quadruplexes: NMR structural study.	Anh Tuan Phan, Ngoc Quang Do
17697	Chemical Shifts: 1 set	Structure of a dimeric all-parallel-stranded G-quadruplex stacked via the 5'-to-5' interface	Stacking of G-quadruplexes: NMR structure of a G-rich oligonucleotide with potential anti-HIV and anticancer activity.	Anh Tuan Phan, Brahim Heddi, Kah Wai Lim, Ming Hoon Teo, Ngoc Quang Do
17655	Chemical Shifts: 1 set	Structure of Human Telomeric DNA in Crowded Solution	Structure of Human Telomeric DNA in Crowded Solution	Anh Tuan Phan, Brahim Heddi
17504	Chemical Shifts: 1 set	RNA Duplex-Quadruplex Junction Complex with FMRP RGG peptide	Structure-function studies of FMRP RGG peptide recognition of an RNA duplex-quadruplex junction.	Alexander Serganov, Ananya Majumdar, Anh Tuan Phan, Anna Polonskaia, Cynthia Chen, David Clain, Dinshaw J Patel, Jennifer C Darnell, Robert B Darnell, Serge Ilin, Tanya Raslin, Vitaly Kuryavyi
16774	Chemical Shifts: 1 set	Solution structure of the Mycobacterium tuberculosis protein Rv0543c, a member of the DUF3349 superfamily. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target MytuD.17112.a	Inaugural structure from the DUF3349 superfamily of proteins, Mycobacterium tuberculosis Rv0543c.	Chang-Yub Kim, Garry W Buchko, Isabelle Phan, Peter J Myler, Thomas C Terwilliger
6430	Chemical Shifts: 1 set	1H and 31P chemical shift assignments for HIV-1 integrase inhibitor 93del	An interlocked dimeric parallel-stranded DNA quadruplex: a potent inhibitor of HIV-1 integrase	Anh Tuan Phan, Aurelie Faure, Dinshaw J Patel, Jin-Biao Ma, Marie-Line Andreola, Vitaly Kuryavyi
4692	Chemical Shifts: 3 sets	SOLUTION STRUCTURE OF A HUMAN TELOMERE FRAGMENT	The solution structure and internal motions of a fragment of the cytidine-rich strand of the human telomere	A T Phan, J L Leroy, M Gueron
4213	Chemical Shifts: 1 set	Retro-inverso analogue of G-H loop of VP1 in FMD virus	Solution structure of a retro-inverso peptide analogue mimicking the foot-and-mouth disease virus major antigenic site. Structural basis for its antigenic cross-reactivity with the parent peptide.	A Phan Chan Du, G Guichard, J P Briand, M C Petit, M T Cung, N Benkirane, S Muller
4212	Chemical Shifts: 1 set	Synthetic peptide corresponding to the major immunogen site of FMD virus	Solution structure of a retro-inverso peptide analogue mimicking the foot-and-mouth disease virus major antigenic site : structural basis for its antigenic crossreactivity with the parent peptide	A Phan Chan Du, G Guichard, J P Briand, M C Petit, M Marraud, M T Cung, N Benkirane, S Muller