BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

Instant search results.

These results are sorted by relevance. You can sort the results by clicking on the table headers.

Entry ID Data summary Entry Title Citation Title Authors
51692 Chemical Shifts: 1 set
Sidechain Ile, Leu, and Val methyl Chemical Shift Assignments for Penicillin Binding Protein 5 Molecular basis of b-lactam antibiotic resistance of ESKAPE bacterium E. faecium Penicillin Binding Protein PBP5 Download bibtex for citation iamge Andre Da Silva Santiago, Charlene Desbonnet, Everton D D'Andrea, Ganesan Senthil S Kumar, Louis B Rice, Marta V Schoenle, Meng S Choy, Michel Arthur, Rebecca Page, Wolfgang Peti, Yamanappa Hunashal
51690 Chemical Shifts: 1 set
Sequence Specific 1H, 13C, and 15N backbone resonance assignments of 70 kDa Penicillin Binding Protein PBP5 Molecular basis of b-lactam antibiotic resistance of ESKAPE bacterium E. faecium Penicillin Binding Protein PBP5 Download bibtex for citation iamge Andre Da Silva Santiago, Charlene Desbonnet, Everton D D'Andrea, Ganesan Senthil S Kumar, Louis B Rice, Marta V Schoenle, Meng S Choy, Michel Arthur, Rebecca Page, Wolfgang Peti, Yamanappa Hunashal
51654 Chemical Shifts: 1 set
Backbone N and HN Chemical Shift Assignments for RBPMS-A (1-122) Phosphorylation of the smooth muscle master splicing regulator RBPMS regulates its splicing activity Download bibtex for citation iamge Christopher Smith, Clare Gooding, Erick E Nakagaki-Silva, Katherine Stott, Mariavittoria Pizzinga, Michael D Barnhart, Thomas H Hammond, Yi Yang
50938 Chemical Shifts: 2 sets
Natural Teixobactin - Lipid II complex Teixobactin kills bacteria by a two-pronged attack on the cell envelope Download bibtex for citation iamge Aaron J Peoples, Adela Melcrova, Alexandre Bonvin, Amy L Spoering, Bram Vermeulen, Chelsea R Jones, Dallas E Hughes, Eefjan Breukink, Francesca Lavore, Harold D MacGillavry, James S Nowick, Joao Medeiros-Silva, Joseph H Lorent, Kim Lewis, Lea Marie M Becker, Losee L Ling, Maik Derks, Markus Weingarth, Michael A Morris, Moreno Lelli, Raj Kumar, Rhythm Shukla, Roy van Beekveld, Sourav Maity, Wouter H Roos, Xiaoqi Wang
30717 Chemical Shifts: 1 set
Spectral_peak_list: 1 set
Hs05 - Intragenic antimicrobial peptide Characterization of novel human intragenic antimicrobial peptides, incorporation and release studies from ureasil-polyether hybrid matrix Download bibtex for citation iamge A L Oliveira, A R Araujo, B Lira, C Bloch, E A Barbosa, E M Carmo da Silva, G D Brand, G H Mariano, J A Chaker, J L Cardozo Fh, J Leite, L G Gomes de Sa, M A Santos, M Ramada
30716 Chemical Shifts: 1 set
Stigmurin NMR three-dimensional structure of the cationic peptide Stigmurin from Tityus stigmurus scorpion venom: In vitro antioxidant and in vivo antibacterial and healing activity Download bibtex for citation iamge A D Silva, A D Silva-Junior, E CG Santos, H Rocha, J M Resende, M FF Pedrosa, M FQ Neto, R M Araujo, S CS Rodrigues
30587 Chemical Shifts: 1 set
Syn-safencin 24 Synthetic Antimicrobial Peptide Tuning Permits Membrane Disruption and Interpeptide Synergy Download bibtex for citation iamge A James J Mason, Albert Siryaporn, Alejandro J Gonzalez, Charlotte K Hind, Francisco R Fields, Francis J Castellino, Giorgia Manzo, Henry M Vu, Ilona P Foik, Jeshina Janardhanan, Jessica N Ross, J Mark M Sutton, Mayland Chang, Melanie Clifford, Phoebe Do D Carmo Silva, Rashna D Balsara, Shaun Lee, Tam T Bui, Veronica R Kalwajtys, Victoria A Ploplis
30586 Chemical Shifts: 1 set
Syn-safencin Synthetic Antimicrobial Peptide Tuning Permits Membrane Disruption and Interpeptide Synergy Download bibtex for citation iamge A James J Mason, Albert Siryaporn, Alejandro J Gonzalez, Charlotte K Hind, Francisco R Fields, Francis J Castellino, Giorgia Manzo, Henry M Vu, Ilona P Foik, Jeshina Janardhanan, Jessica N Ross, J Mark M Sutton, Mayland Chang, Melanie Clifford, Phoebe Do D Carmo Silva, Rashna D Balsara, Shaun Lee, Tam T Bui, Veronica R Kalwajtys, Victoria A Ploplis
30588 Chemical Shifts: 1 set
Syn-safencin 56 Synthetic Antimicrobial Peptide Tuning Permits Membrane Disruption and Interpeptide Synergy Download bibtex for citation iamge A James J Mason, Albert Siryaporn, Alejandro J Gonzalez, Charlotte K Hind, Francisco R Fields, Francis J Castellino, Giorgia Manzo, Henry M Vu, Ilona P Foik, Jeshina Janardhanan, Jessica N Ross, J Mark M Sutton, Mayland Chang, Melanie Clifford, Phoebe Do D Carmo Silva, Rashna D Balsara, Shaun Lee, Tam T Bui, Veronica R Kalwajtys, Victoria A Ploplis
34346 Chemical Shifts: 1 set
NMR Structure of Big-defensin 1 from oyster Crassostrea gigas The Ancestral N-Terminal Domain of Big Defensins Drives Bacterially Triggered Assembly into Antimicrobial Nanonets. Download bibtex for citation iamge A Bressan, A F Delmas, A Vergnes, C Barreto, C Cazevielle, D Destoumieux-Garzon, E Bachere, H Marchandin, H Meudal, J Da Silva, K Loth, L Touqui, N Belmadi, P Bulet, R D Rosa, S N Voisin, V Aucagne
34345 Chemical Shifts: 1 set
NMR Structure of Big-defensin 1 [44-93] from oyster Crassostrea gigas The Ancestral N-Terminal Domain of Big Defensins Drives Bacterially Triggered Assembly into Antimicrobial Nanonets. Download bibtex for citation iamge A Bressan, A F Delmas, A Vergnes, C Barreto, C Cazevielle, D Destoumieux-Garzon, E Bachere, H Marchandin, H Meudal, J Da Silva, K Loth, L Touqui, N Belmadi, P Bulet, R D Rosa, S N Voisin, V Aucagne
27690 Chemical Shifts: 1 set
MtFKBP Backbone and side chain 1H, 15N and 13C assignments of a putative peptidyl prolyl cis-trans isomerase FKBP12 from Mycobacterium tuberculosis Download bibtex for citation iamge Cristiane D Anobom, Danielle MP Oliveira, Fabio CL Almeida, Guilherme C Andrade, Jose RM Pires, Luis FC Silva
30527 Chemical Shifts: 1 set
De novo Designed Protein Foldit3 De novo protein design by citizen scientists. Download bibtex for citation iamge Aaron Bauer, Alexander Boykov, Alex Ford, Brian Koepnick, Daniel-Adriano A Silva, David Baker, Firas Khatib, Foldit Players, Frank DiMaio, Gaetano T Montelione, Gaohua Liu, Jeff Flatten, Linda Wei, Matthew J Bick, Roger D Estep, Seth Cooper, Susan Kleinfelter, Tamir Husain, Toke Norgard-Solano, Yojiro Ishida, Zoran Popovic
30448 Chemical Shifts: 1 set
HRFLRH peptide NMR structure in the presence of CO2 A Previously Undescribed Hexapeptide His-Arg-Phe-Leu-Arg-His-NH2 From Amphibian Skin Secretion shows CO2 and Metal Biding Affinities Download bibtex for citation iamge A Lopez-Castillo, C Bloch Jr, C J Nascimento, D AT Pires, L MR Arake, L P Silva, M V Prates
30449 Chemical Shifts: 1 set
HRFLRH peptide NMR structure in the presence of Zn(II) A Previously Undescribed Hexapeptide His-Arg-Phe-Leu-Arg-His-NH2 From Amphibian Skin Secretion shows CO2 and Metal Biding Affinities Download bibtex for citation iamge A Lopez-Castillo, C Bloch Jr, C J Nascimento, D AT Pires, L MR Arake, L P Silva, M V Prates
30447 Chemical Shifts: 1 set
HRFLRH peptide NMR structure in the presence of Cd(II) A Previously Undescribed Hexapeptide His-Arg-Phe-Leu-Arg-His-NH2 From Amphibian Skin Secretion shows CO2 and Metal Biding Affinities Download bibtex for citation iamge A Lopez-Castillo, C Bloch Jr, C J Nascimento, D AT Pires, L MR Arake, L P Silva, M V Prates
30446 Chemical Shifts: 1 set
HRFLRH peptide NMR structure A Previously Undescribed Hexapeptide His-Arg-Phe-Leu-Arg-His-NH2 From Amphibian Skin Secretion shows CO2 and Metal Biding Affinities Download bibtex for citation iamge A Lopez-Castillo, C Bloch Jr, C J Nascimento, D AT Pires, L MR Arake, L P Silva, M V Prates
30396 Chemical Shifts: 1 set
Spectral_peak_list: 4 sets
The clavanin peptide in the presence of TFE (2,2,2-trifluoroethanol), presented a amphipathic alpha-helices from Phe-2 to Val-22 residues Structural Studies of a Lipid-Binding Peptide from Tunicate Hemocytes with Anti-Biofilm Activity. Download bibtex for citation iamge A L Oliveira, A S Veiga, C A Andrade, C de la Fuente-Nunez, D Gaspar, E S Alves, I C Fensterseifer, J M Nascimento, J R Correa, L M Liao, M A Castanho, O L Franco, O N Silva, R E Hancock, S Korpole, S M Mandal, S M Ribeiro, W F Porto
30368 Chemical Shifts: 1 set
Solution NMR structure of Brd3 ET domain bound to Brg1 peptide The BRD3 ET domain recognizes a short peptide motif through a mechanism that is conserved across chromatin remodelers and transcriptional regulators Download bibtex for citation iamge Amy E Campbell, Ana Silva, Ann H Kwan, Bin Lu, Cherry Kwong, Christopher R Vakoc, Dorothy Wai, Gerd A Blobel, James D Chalmers, Jason Low, Joel P Mackay, Lorna E Wilkinson-White, Roland Gamsjaeger, Taylor N Szyszka, Wayne M Patrick
30367 Chemical Shifts: 1 set
Spectral_peak_list: 3 sets
Solution NMR structures of the BRD3 ET domain in complex with a CHD4 peptide The BRD3 ET domain recognizes a short peptide motif through a mechanism that is conserved across chromatin remodelers and transcriptional regulators Download bibtex for citation iamge Amy E Campbell, Ana Silva, Ann H Kwan, Bin Lu, Cherry Kwong, Christopher R Vakoc, Dorothy Wai, Gerd A Blobel, James D Chalmers, Jason Low, Joel P Mackay, Lorna E Wilkinson-White, Roland Gamsjaeger, Taylor N Szyszka, Wayne M Patrick
30364 Chemical Shifts: 1 set
Solution structure of de novo macrocycle design7.2 Comprehensive computational design of ordered peptide macrocycles. Download bibtex for citation iamge D A Silva, D Baker, D E Kim, F Pardo-Avila, G Bhardwaj, G Varani, I K Webb, J N Adkins, J R Cort, M D Shortridge, P Hosseinzadeh, S A Rettie, T W Craven, V K Mulligan, Y M Ibrahim
30365 Chemical Shifts: 1 set
Solution structure of de novo macrocycle design7.3a Comprehensive computational design of ordered peptide macrocycles. Download bibtex for citation iamge D A Silva, D Baker, D E Kim, F Pardo-Avila, G Bhardwaj, G Varani, I K Webb, J N Adkins, J R Cort, M D Shortridge, P Hosseinzadeh, S A Rettie, T W Craven, V K Mulligan, Y M Ibrahim
30366 Chemical Shifts: 1 set
Solution structure of de novo macrocycle design7.3a Comprehensive computational design of ordered peptide macrocycles. Download bibtex for citation iamge D A Silva, D Baker, D E Kim, F Pardo-Avila, G Bhardwaj, G Varani, I K Webb, J N Adkins, J R Cort, M D Shortridge, P Hosseinzadeh, S A Rettie, T W Craven, V K Mulligan, Y M Ibrahim
30362 Chemical Shifts: 1 set
Solution structure of de novo macrocycle design12_ss Comprehensive computational design of ordered peptide macrocycles. Download bibtex for citation iamge D A Silva, D Baker, D E Kim, F Pardo-Avila, G Bhardwaj, G Varani, I K Webb, J N Adkins, J R Cort, M D Shortridge, P Hosseinzadeh, S A Rettie, T W Craven, V K Mulligan, Y M Ibrahim
30361 Chemical Shifts: 1 set
Solution structure of de novo macrocycle design11_ss Comprehensive computational design of ordered peptide macrocycles. Download bibtex for citation iamge D A Silva, D Baker, D E Kim, F Pardo-Avila, G Bhardwaj, G Varani, I K Webb, J N Adkins, J R Cort, M D Shortridge, P Hosseinzadeh, S A Rettie, T W Craven, V K Mulligan, Y M Ibrahim
30360 Chemical Shifts: 1 set
Solution structure of de novo macrocycle design10.2 Comprehensive computational design of ordered peptide macrocycles. Download bibtex for citation iamge D A Silva, D Baker, D E Kim, F Pardo-Avila, G Bhardwaj, G Varani, I K Webb, J N Adkins, J R Cort, M D Shortridge, P Hosseinzadeh, S A Rettie, T W Craven, V K Mulligan, Y M Ibrahim
30359 Chemical Shifts: 1 set
Solution structure of de novo macrocycle design10.1 Comprehensive computational design of ordered peptide macrocycles. Download bibtex for citation iamge D A Silva, D Baker, D E Kim, F Pardo-Avila, G Bhardwaj, G Varani, I K Webb, J N Adkins, J R Cort, M D Shortridge, P Hosseinzadeh, S A Rettie, T W Craven, V K Mulligan, Y M Ibrahim
30358 Chemical Shifts: 1 set
Solution structure of de novo macrocycle design9.1 Comprehensive computational design of ordered peptide macrocycles. Download bibtex for citation iamge D A Silva, D Baker, D E Kim, F Pardo-Avila, G Bhardwaj, G Varani, I K Webb, J N Adkins, J R Cort, M D Shortridge, P Hosseinzadeh, S A Rettie, T W Craven, V K Mulligan, Y M Ibrahim
30357 Chemical Shifts: 1 set
Solution structure of de novo macrocycle design8.2 Comprehensive computational design of ordered peptide macrocycles. Download bibtex for citation iamge D A Silva, D Baker, D E Kim, F Pardo-Avila, G Bhardwaj, G Varani, I K Webb, J N Adkins, J R Cort, M D Shortridge, P Hosseinzadeh, S A Rettie, T W Craven, V K Mulligan, Y M Ibrahim
30363 Chemical Shifts: 1 set
Solution structure of de novo macrocycle design14_ss Comprehensive computational design of ordered peptide macrocycles. Download bibtex for citation iamge D A Silva, D Baker, D E Kim, F Pardo-Avila, G Bhardwaj, G Varani, I K Webb, J N Adkins, J R Cort, M D Shortridge, P Hosseinzadeh, S A Rettie, T W Craven, V K Mulligan, Y M Ibrahim
30355 Chemical Shifts: 1 set
Solution structure of de novo macrocycle Design8.1 Comprehensive computational design of ordered peptide macrocycles. Download bibtex for citation iamge D A Silva, D Baker, D E Kim, F Pardo-Avila, G Bhardwaj, G Varani, I K Webb, J N Adkins, J R Cort, M D Shortridge, P Hosseinzadeh, S A Rettie, T W Craven, V K Mulligan, Y M Ibrahim
30356 Chemical Shifts: 1 set
Solution structure of de novo macrocycle design7.1 Comprehensive computational design of ordered peptide macrocycles. Download bibtex for citation iamge D A Silva, D Baker, D E Kim, F Pardo-Avila, G Bhardwaj, G Varani, I K Webb, J N Adkins, J R Cort, M D Shortridge, P Hosseinzadeh, S A Rettie, T W Craven, V K Mulligan, Y M Ibrahim
30058 Chemical Shifts: 1 set
DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium Encoding canonical DNA quadruplex structure. Download bibtex for citation iamge Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin
30056 Chemical Shifts: 1 set
DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTGG) in sodium Encoding canonical DNA quadruplex structure. Download bibtex for citation iamge Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin
30055 Chemical Shifts: 1 set
DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTTGG) in sodium Encoding canonical DNA quadruplex structure. Download bibtex for citation iamge Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin
30045 Chemical Shifts: 1 set
DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium Encoding canonical DNA quadruplex structure. Download bibtex for citation iamge Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin
19572 Chemical Shifts: 1 set
Solution NMR structure of quadruplex d(TGGGTTTGGGTTGGGTTTGGG) in sodium conditions. In preparation Download bibtex for citation iamge Andreas Ioannis Karsisiotis, Mateus Webba da Silva, Paul Dillon
19571 Chemical Shifts: 2 sets
Solution NMR structure of the d(GGGTTTTGGGTGGGTTTTGGG) quadruplex in sodium conditions. Encoding canonical DNA quadruplex structure. Download bibtex for citation iamge Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin
19158 Chemical Shifts: 2 sets
Solution NMR structure of the d(GGGTTGGGTTTTGGGTGGG) quadruplex in sodium conditions DNA quadruplex folding formalism--a tutorial on quadruplex topologies. Download bibtex for citation iamge Andreas Ioannis Karsisiotis, Christopher Webba da Silva
19159 Chemical Shifts: 2 sets
Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions DNA quadruplex folding formalism--a tutorial on quadruplex topologies. Download bibtex for citation iamge Andreas Ioannis Karsisiotis, Christopher Webba da Silva
16261 Chemical Shifts: 1 set
1H, 15N, 13C assignments of the Riphicephalus (Boophilus) microplus antimicrobial protein microplusin (1)H, (15)N and (13)C assignments of the Rhipicephalus (Boophilus) microplus anti-microbial peptide microplusin. Download bibtex for citation iamge Carlos A Rezende, Fernanda D Silva, Jose R Pires, Sirlei Daffre
16198 Chemical Shifts: 1 set
1H, 13C and 15N backbone and side chain chemical shift assignments of N-terminal domain of Tim23. 1H.13C and 15N backbone and side-chain resonance assignments of N-terminal domain of a mitochondrial inner membrane translocase (TIM23) from S. cerevisiae Download bibtex for citation iamge Anushikha Thakur, Chittoor Balasubramanyam, Hanudatta S Atreya, Patrick D Silva
6412 Chemical Shifts: 1 set
Coupling Constants: 1 set
FRAGMENT 33-61 OF BOVINE alpha-HEMOGLBIN: THE EFFECT OF C-TERMINAL AMIDATION AND IDENTIFICATION OF THE MINIMAL PORTION WITH ANTIFUNGAL ACTIVITY The micelle-bound structure of an antimicrobial peptide derived from the alpha-chain of bovine hemoglobin isolated from the tick Boophilus microplus. Download bibtex for citation iamge Alberto Spisni, Alessandra Machado, Antonio Miranda, Fernanda D Silva, Mauricio L Sforca, M Teresa Miranda, Rita C Figueredo, Sergio Oyama, Sirlei Daffre, Thelma A Pertinhez
6414 Chemical Shifts: 1 set
FRAGMENT 33-61 OF BOVINE alpha-HEMOGLBIN: THE EFFECT OF C-TERMINAL AMIDATION AND IDENTIFICATION OF THE MINIMAL PORTION WITH ANTIFUNGAL ACTIVITY The micelle-bound structure of an antimicrobial peptide derived from the alpha-chain of bovine hemoglobin isolated from the tick Boophilus microplus. Download bibtex for citation iamge Alberto Spisni, Alessandra Machado, Antonio Miranda, Fernanda D Silva, Mauricio L Sforca, M Teresa Miranda, Rita C Figueredo, Sergio Oyama, Sirlei Daffre, Thelma A Pertinhez
6411 Chemical Shifts: 1 set
FRAGMENT 33-61 OF BOVINE alpha-HEMOGLBIN: THE EFFECT OF C-TERMINAL AMIDATION AND IDENTIFICATION OF THE MINIMAL PORTION WITH ANTIFUNGAL ACTIVITY The micelle-bound structure of an antimicrobial peptide derived from the alpha-chain of bovine hemoglobin isolated from the tick Boophilus microplus. Download bibtex for citation iamge Alberto Spisni, Alessandra Machado, Antonio Miranda, Fernanda D Silva, Mauricio L Sforca, M Teresa Miranda, Rita C Figueredo, Sergio Oyama, Sirlei Daffre, Thelma A Pertinhez
6413 Chemical Shifts: 1 set
Coupling Constants: 1 set
FRAGMENT 33-61 OF BOVINE alpha-HEMOGLBIN: THE EFFECT OF C-TERMINAL AMIDATION AND IDENTIFICATION OF THE MINIMAL PORTION WITH ANTIFUNGAL ACTIVITY The micelle-bound structure of an antimicrobial peptide derived from the alpha-chain of bovine hemoglobin isolated from the tick Boophilus microplus. Download bibtex for citation iamge Alberto Spisni, Alessandra Machado, Antonio Miranda, Fernanda D Silva, Mauricio L Sforca, M Teresa Miranda, Rita C Figueredo, Sergio Oyama, Sirlei Daffre, Thelma A Pertinhez
6360 Chemical Shifts: 1 set
IDENTIFICATION OF MINIMAL PEPTIDE SEQUENCE IN THE AMIDATED FRAGMENT 33-61 OF BOVINE a-HEMOGLBIN The micelle-bound structure of an antimicrobial peptide derived from the alpha-chain of bovine hemoglobin isolated from the tick Boophilus microplus. Download bibtex for citation iamge Alberto Spisni, Alessandra Machado, Antonio Miranda, Fernanda D Silva, Mauricio L Sforca, M Teresa Miranda, Rita C Figueredo, Sergio Oyama, Sirlei Daffre, Thelma A Pertinhez
6048 Chemical Shifts: 1 set
Coupling Constants: 1 set
NEW STRUCTURAL FAMILY OF AN ANTIMICROBIAL PEPTIDE DERIVED FROM BOVINE HEMOGLOBIN The Micelle-Bound Structure of an Antimicrobial Peptide Derived from the alpha-Chain of Bovine Hemoglobin Isolated from the Tick Boophilus microplus. Download bibtex for citation iamge Alberto Spisni, Alessandra Machado, Antonio Miranda, F D Silva, Maria TM Miranda, Mauricio L Sforca, Rita CR Figueredo, Sergio Oyama, Sirlei Daffre, Thelma A Pertinhez