BMRB - Biological Magnetic Resonance Bank

BMRB Query Grid

Select desired data type(s) and optionally limit polymer type(s). You can select multiple values by holding the "control" key (Windows, Linux) or "option" key (MacOS) while clicking. All data type selections are applied using a logical AND operator. Polymer selection join type can be selected. Click a column header to sort by that column.

Data type(s): Polymer type(s): Polymer join type:

Number of entries returned: 277

Download all matching entries in NMR-STAR as a compressed file or download the results displayed on this page in CSV format.

BMRB ID	Entry Title	IUPAC CS referencing	Protein	DNA	RNA
4103	1H, 13C and 15N Chemical Shift Assignments of the 14mer DNA Duplex BS2	X		X
4104	1H, 13C and 15N Chemical Shift Assignments of the 14mer DNA Duplex BS2 in the Complex with the Antennapedia Homeodomain	X	X	X
4141	vnd/NK-2 Homeodomain DNA Complex Protein 1H, 13C, and 15N Chemical Shifts and HNHA Coupling Constant	X	X	X
4165	1H, 13C, and 15N Chemical Shift Assignments for Tn916 N-terminal DNA Binding Domain complex with DNA	X	X	X
4170	2'-Deoxy-Isoguanosine Base Paired to Thymidine, NMR Minimized Average Structure	X		X
4248	LEF1 HMG Domain (From Mouse), Complexed with DNA (15bp), NMR, 12 Structures	X	X	X
4256	1H, 15N and 13C Assignments of the DNA Binding Domain of Transcription Factor Mbp1 from S. cerevisiae in Both Its Free and DNA Bound Forms, and 1H Assignments of the Free DNA	X	X	X
4368	Chemical Shift Assignments for A35T vnd/NK2 Mutant Homeodomain	X	X	X
4392	Binding of AR-1-144, a tri-imidazole DNA minor groove binder, to CCGG sequence analyzed by NMR spectroscopy	X		X
4400	Structure and Mechanism of Formation of the H-y5 ismomer of an Intramolecular DNA Triple Helix.	X		X
4576	Solution Structure of [d(CGC)r(aaa)d(TTTGCG)]2 Hybrid Junctions Flanked by DNA Duplexes	X		X
5339	NMR minimized average structure of d(CGTACG)2	X		X
5345	Assignment of lac repressor headpiece complexed of its natural operator	X	X	X
5349	PBX Homeodomain-DNA complex	X	X	X
5363	1H, 13C, and 15N Chemical shifts for hERR2 Protein, 1H chemical shifts for DNA	X	X	X
5517	NMR studies of the DNA-binding domain of B-Myb	X	X	X
5562	NMR conformational study of proposed quadruplex hexanucleotide d(CCGCGG)2 in solution	X		X
5634	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS1	X		X
5635	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS2	X		X
5636	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS3	X		X
5637	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS4	X		X
5638	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS5	X		X
5639	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS6	X		X
5640	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS7	X		X
5641	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS8	X		X
5642	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS9	X		X
5643	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS10	X		X
5644	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS11	X		X
5645	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS12	X		X
5646	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS13	X		X
5647	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS14	X		X
5648	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS15	X		X
5649	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS16	X		X
5714	1H Chemical shift assignments of the major conformation of a 11-mer DNA duplex containing an AG Mismatch	X		X
5716	CHEMICAL SHIFTS OF THE CK14 DNA DUPLEX: A PORTION OF THE KNOWN NF-kB SEQUENCE CK1	X		X
5717	NMR STRUCTURE OF THE CK14 DNA DUPLEX: A PORTION OF THE KNOWN NF-kB SEQUENCE CK1	X		X
5718	Chemical Shifts for the XBY2 DNA Duplex	X		X
5730	1H Chemical Shift Assignments for a DNA Duplex with N6-Deoxyadenosine Adduct of (9S,10R)-9,10-Epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene	X		X
5776	sPrODN1:RNA [5'-R(AAAGGAGGA)-3'/5'-D(CXXXXXX)-3']	X		X	X
5777	PODN:RNA [5'-R(AAAGGAGGA)-3'/5'-D(XXXXXXX)-3']	X		X	X
5781	The Solution Structure of a DNA.RNA Duplex Containing 5-Propynyl U and C Comparison with 5-Me Modifications	X		X	X
5993	1H shifts for the DNA duplex containing 5-hydroxy Uracil lesion	X		X
6186	Structure of DNA sequence d-TGATCA by two-dimensional nuclear magnetic resonance spec and restrained molecular dynamics	X		X
6276	1H, 13C and 15N resonance assignments for the six-zinc finger domain of the MTF-1 metalloregulatory protein in the DNA bound state	X	X	X
6353	1H, 15N and 13C resonance assignments of the BRCT Region of the large subunit of human Replication Factor C	X	X	X
6445	Backbone 1H, 13C, and 15N and 13CB Chemical Shift Assignments for Six C2H2 Zinc Fingers (F1-6) of MTF-1 in the DNA Bound State (22 bp)	X	X	X
6537	Small Molecule Ligand Induces Nucleotide Flipping in (CAG)n Trinucleotide Repeats	X		X
6605	E. Coli Ada in a complex with DNA	X	X	X
6877	NMR assignments of the Human Papillomavirus type 16 E2C DNA-bound form	X	X	X
6906	1H, 13C, and 15N Chemical Shift Assignments for the Bicoid Homedomain	X	X	X
6975	1H chemical shift assignments for Bcl2MidG4	X		X
7097	DNA recognition by the Brinker nuclear repressor - an extreme case of the coupling between binding and folding	X	X	X
7105	1H, 13C and 15N chemical shift assignments for SRY.B in complex with 16-mer DNA	X	X	X
7319	Polymerase Beta and Double gap double hairpin DNA	X	X	X
7377	Resonance assignments of the metal sensor CzrA in the apo-, Zn2- and DNA-bound (42 kDa) states	X	X	X
11045	Mhr1p-bound ssDNA	X	X	X
11046	hsRad51-bound ssDNA	X	X	X
11047	RecO-bound ssDNA	X	X	X
11048	RecT-bound ssDNA	X	X	X
11437	DNA oligmer containing propylene cross-linked cyclic 2' -deoxyuridylate dimer	X		X
11438	DNA oligomer containing ethylene cross-linked cyclic 2'-deoxyuridylate dimer	X		X
11528	STRUCTURE OF METALLO-DNA IN SOLUTION	X		X
11608	SOLUTION STRUCTURE OF DNA CONTAINING METALLO-BASE-PAIR	X		X
15213	Assignments of {lambda}-IntCB bound to a DNA half-site	X	X	X
15223	Duplex DNA containing an abasic site with an opposite G (alpha anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)	X		X
15224	Duplex DNA containing an abasic site with an opposite G (beta anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)	X		X
15228	Duplex DNA containing an abasic site with an opposite T (beta anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)	X		X
15238	Duplex DNA containing an abasic site with an opposite dC (alpha anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)	X		X
15239	Duplex DNA containing an abasic site with an opposite dC (beta anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)	X		X
15533	Structure of the Wilms' Tumor Suppressor Protein Zinc Finger Domain Bound to DNA	X	X	X
15860	NMR solution structure of modified DNA containing imidazole nucleosides at acidic, neutral and basic pH	X		X
16054	Dimeric solution structure of the DNA loop d(TGCTTCGT)	X		X
16055	Dimeric solution structure of the cyclic octamer d(pCGCTCCGT)	X		X
16138	NMR solution structure of metal-modified DNA	X		X
16212	Dimeric solution structure of the DNA loop d(TCGTTGCT)	X		X
16280	d(GAGCTC)2 assignments	X		X
16281	d(GAGCTC)2 plus dqdppn	X		X
16287	d(AGAGCTCT)2 plus dqdppn 1:2 assignments	X		X
16288	d(CGAGCTCG)2 plus dqdppn 1:2 assignments	X		X
16290	d(GCTATAGC)2 1:1 complex with dqdppn assignments	X		X
16291	d(AGAGCTCT)2 plus Ru ligand 1:2 assignments	X		X
16292	d(CGAGCTCG)2 plus Ru ligand 1:2 assignments	X		X
16356	Structure of a two-G-tetrad intramolecular G-quadruplex formed by a variant human telomeric sequence in K+ solution	X		X
16485	Solution structure of the THAP zinc finger of THAP1 in complex with its DNA target	X	X	X
16577	Backbone Chemical Shift Assignments of Mouse HOXA13 DNA Binding Domain in Complex with DNA Duplex	X	X	X
16812	data-driven model of MED1:DNA complex	X	X	X
16834	NMR structure of fully methylated GATC site	X		X
17094	NMR and molecular modeling studies of the interaction of berenil and pentamidine with d(CGCAAATTTGCG)2	X		X
17216	How the HIV-1 Nucleocapsid Protein Binds and Destabilises the (-)Primer Binding Site During Reverse Transcription	X	X	X
17217	Solution Structure of the C-terminal Dimerization Domain of SARS Coronavirus Nucleocapsid Protein Solved by the SAIL-NMR Method	X	X	X
17222	lac repressor-lac operator interaction: NMR observations	X	X	X
17225	The Solution Structure and DNA-binding Properties of the Cold-shock Domain of the Human Y-box Protein YB-1	X	X	X
17339	The Solution Structure of a Fungal AREA Protein-DNA Complex: An Alternative Binding Mode for a Basic Carboxyl Tail of GATA factors	X	X	X
17379	QUI/G-quadruplex complex	X		X
17422	Solution Structure of a DNA Duplex Containing the Potent Anti-Poxvirus Agent Cidofovir	X		X
17423	Solution Structure of a DNA Duplex Containing the Potent Anti-Poxvirus Agent Cidofovir	X		X
17452	Chemical Shifts of the Pitx2 Homeodomain in complex with a TAAGCT non-consensus DNA site	X	X	X
17580	Myc G-quadruplex formed at the 5'-end of NHEIII element	X		X
17592	Backbone assignments of Anabaena Sensory Rhodopsin Transducer with DNA	X	X	X
17655	Structure of Human Telomeric DNA in Crowded Solution	X		X
17697	Structure of a dimeric all-parallel-stranded G-quadruplex stacked via the 5'-to-5' interface	X		X
17708	Solution-state structures of monomeric and dimeric G-quadruplexes adopted by a sequence from N-myc	X		X
17709	Solution-state structures of monomeric and dimeric G-quadruplexes formed by a sequence from N-myc	X		X
17729	Structure of the DNA complex of the C-Terminal domain of Ler	X	X	X
17732	Complex of the C-terminal WRKY domain of AtWRKY4 and a W-box DNA	X	X	X
17980	Monomer-dimer equilibrium for 5 -5 stacking of propeller-type parallel-stranded G-quadruplexes: NMR structural study	X		X
18015	Chemical shift assignments for the homeodomain of Pitx2 in complex with a TAATCC DNA binding site	X	X	X
18209	Solution-state structure of an intramolecular G-quadruplex w th propeller, diagonal and edgewise loops	X		X
18427	Solution structure of 2'F-ANA and ANA self-complementary duplex	X		X
18452	Solution structure of a mini i-motif	X	X	X
18462	Solution NMR structure of Kaiso zinc finger DNA binding domain in complex with Kaiso binding site DNA	X	X	X
18496	Solution NMR Structure of YdbC:dT19G1 complex. Northeast Structural Genomics Consortium (NESG) Target KR150	X	X	X
18524	Solution structure of a parallel-stranded oligoisoguanine DNA pentaplex formed by d(T(iG)4T) in the presence of Cs ions	X		X
18638	Solution Structure of Duplex DNA Containing a b-Carba-Fapy-dG Lesion	X		X
18639	Solution Structure of Duplex DNA Containing a b-Carba-Fapy-dG Lesion	X		X
18640	Solution Structure of Duplex DNA Containing a b-Carba-Fapy-dG Lesion	X		X
18724	FUC_TBA	X		X
18762	NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing	X		X
18780	DNA duplex containing mispair-aligned O4U-heptylene-O4U interstrand cross-link	X		X
18781	DNA duplex containing mispair-aligned O6G-heptylene-O6G interstrand cross-link	X		X
18862	Parallel human telomeric quadruplex containing 2'F-ANA substitutions	X		X
18881	NMR solution structure of the d3'-hairpin from the Sc.ai5gamma group II intron including the EBS1:dIBS1 RNA:DNA hybrid	X		X	X
18907	Solution structure of Duplex DNA	X		X
18935	African Swine Fever Virus Pol X in the ternary complex with MgdGTP and DNA	X	X	X
19017	Solution structure of an intramolecular propeller-type G-quadruplex containing a single bulge	X		X
19035	G-rich VEGF aptamer with LNA modifications	X		X
19138	ERG DNA Complex	X	X	X
19276	Structure of d[CGCGAAGCATTCGCG] hairpin	X		X
19277	Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid	X		X
19278	Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid	X		X
19279	Structure of d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid	X		X
19280	Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybrid	X		X
19281	Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid	X		X
19381	Engineering G4: Towards effective incorporation of locked nucleic acid into G-quadruplexes	X		X
19386	parallel-stranded G-quadruplex in DNA poly-G stretches	X		X
19389	Solution structure of a stacked dimeric G-quadruplex formed by a segment of the human CEB1 minisatellite	X		X
19391	Solution structure of MBD3 methylcytosine binding domain while bound to hydroxymethylated DNA	X	X	X
19402	Structure of an antiparallel (2+2) G-quadruplex formed by human telomeric repeats in Na+ solution (with G22-to-BrG substitution)	X		X
19435	Structural studies on dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence	X		X
19448	Structural studies on dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence	X		X
19511	NMR Structure of the homeodomain transcription factor Gbx1 from Homo sapiens solved in the presence of the DNA sequence CGACTAATTAGTCG	X	X	X
19540	haddock model of MyT1 F4F5 - DNA complex	X	X	X
19571	Solution NMR structure of the d(GGGTTTTGGGTGGGTTTTGGG) quadruplex in sodium conditions.	X		X
19572	Solution NMR structure of quadruplex d(TGGGTTTGGGTTGGGTTTGGG) in sodium conditions.	X		X
19594	Solution structure of a G-quadruplex bound to the bisquinolinium compound Phen-DC3	X		X
19620	Solution structure of DNA duplex containing N3T-ethylene-N1I interstrand cross-link	X		X
19695	NMR studies of N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA: Impact of adduct stereochemistry, size, and local DNA structure on solution conformations	X		X
19696	Nuclear magnetic resonance studies of N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA: Impact of adduct stereochemistry, size, and local DNA structure on solution conformations	X		X
19745	Solution NMR structure of a mismatch DNA	X		X
19853	AFB1 FAPY modified AGA duplex	X		X
19861	AFB1 FAPY modified AGT duplex	X		X
19862	E isomer of AFB1 FAPY modified AGC duplex	X		X
19863	AFB1 FAPY modified AG(7-deaza)G duplex	X		X
25092	truncated EcMazE-DNA complex	X	X	X
25099	Dimeric structure of the Human A-box	X		X
25110	Solution structure of a left-handed G-quadruplex	X		X
25378	A structure of G-quadruplex	X		X
25582	structure of a protein	X	X	X
25596	Structure of DNA G-quadruplex adopted by ALS and FTD related GGGGCC repeat with G21 to Br-G21 substitution	X		X
25651	Isolation and structural characterization of an active G-quadruplex motif from AGRO100	X		X
25686	Structure of a G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome	X		X
25746	G-quadruplex structure	X		X
25759	Solution structure for quercetin complexed with c-myc G-quadruplex DNA	X		X
25840	Tetrameric i-motif structure of dT-dC-dC-CFL-CFL-dC at acidic pH	X		X
25903	Glucose as non natural nucleobase	X		X
25906	Glucose as a nuclease mimic in DNA	X		X
25915	Photoswitchable G-quadruplex	X		X
26620	Amide/Methyl/Aromatic chemical shift and order parameter of Barnase-dCGAC	X	X	X
26731	Structural and dynamics studies of Pax5 reveal asymmetry in stability and DNA binding by the Paired domain	X	X	X
26808	Egr-1 - DNA complex	X	X	X
26931	Backbone chemical shifts of the MBD2/3 methyl-cytosine binding domain from Ephydatia muelleri	X	X	X
26978	MeCP2 bound to methylated DNA	X	X	X
27053	NMR chemical shift assignments of a 22mer G-quadruplex formed within the KRAS proto-oncogene promoter region	X		X
27144	DNA with compounds	X		X
27364	Backbone 1H, 15N chemical shift assignments of Kaiso zinc finger DNA binding domain in complex with its double CpG-methylated DNA consensus binding site (MeCG2)	X	X	X
27366	Backbone 1H, 15N chemical shift assignments of Kaiso E535Q zinc finger DNA binding domain in complex with its double CpG-methylated DNA consensus binding site (MeCG2)	X	X	X
27367	Backbone 1H, 15N chemical shift assignments of Kaiso E535A zinc finger DNA binding domain in complex with its double CpG-methylated DNA consensus binding site	X	X	X
27368	Backbone 1H, 15N chemical shift assignments of Kaiso zinc finger DNA binding domain in complex with a double CpG-methylated DNA resembling the specific Kaiso binding site (KBS)	X	X	X
27369	Backbone 1H, 15N chemical shift assignments of Kaiso E535Q zinc finger DNA binding domain in complex with a double CpG-methylated DNA resembling the specific Kaiso binding site (KBS)	X	X	X
27370	Backbone 1H, 15N chemical shift assignments of Kaiso E535A zinc finger DNA binding domain in complex with a double CpG-methylated DNA resembling the specific Kaiso binding site (KBS)	X	X	X
27371	Backbone 1H, 15N chemical shift assignments of Kaiso zinc finger DNA binding domain in complex with a semi-CpG-methylated DNA resembling the specific Kaiso binding site (KBS)	X	X	X
27372	Backbone 1H, 15N chemical shift assignments of Kaiso zinc finger DNA binding domain in complex with a hemi-CpG-methylated DNA resembling the specific Kaiso binding site (KBS)	X	X	X
27404	1H, 15N, 13C backbone resonance assignments of the nuclease core residues 2-336 of K93A human flap endonuclease-1 in complex with dual-hairpin DNA substrate	X	X	X
27409	Ile and Met methyl 1H and 13C chemical shifts of DNA polymerase beta and 1-nucleotide gapped double hairpin DNA binary complex	X	X	X
27410	Ile and Met methyl 1H and 13C chemical shifts of DNA polymerase beta, 1-nucleotide gapped double hairpin DNA and dAMPCPP ternary complex	X	X	X
27560	protein-gapped DNA complex (Polymerase beta) ILV Methyl Assignments	X	X	X
27561	protein-gapped DNA-nucelotide complex (Polymerase beta) ILV Methyl Assignments	X	X	X
27652	NZ118	X		X
27958	Spin-labeled DNA duplex	X		X
28059	1H-15N backbone Heteronuclear NOE values for free and ssDNA complex forms of Human YB1 cold shock domain.	X	X	X
28081	Trimolecular G-quadruplex	X		X
30052	NMR solution structure of [Rp, Rp]-PT dsDNA	X		X
30053	Solution NMR structure of PT-free dsDNA from Streptomyces lividans	X		X
30054	NMR solution structure of [Sp, Sp]-PT dsDNA	X		X
30056	DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTGG) in sodium	X		X
30058	DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium	X		X
30907	Solution Structure of Berberine Bound to a dGMP Fill-in G-Quadruplex in the PDGFR-b Promoter	X		X
34034	A two-quartet G-quadruplex formed by human telomere in KCl solution at neutral pH	X		X
34035	A two-quartet G-quadruplex formed by human telomere in KCl solution at pH 5.0	X		X
34053	Structure of a stable G-hairpin	X		X
34071	2'F-ANA/DNA Chimeric TBA Quadruplex structure	X		X
34083	G-quadruplex formed within promoters of Plasmodium falciparum B var genes	X		X
34084	G-quadruplex formed within promoters of Plasmodium falciparum B var genes - form I	X		X
34086	Solution structure of a human G-Quadruplex hybrid-2 form in complex with a Gold-ligand	X		X
34118	An i-motif containing the neutral cytidine protonated analogue pseudoisocytidine	X		X
34135	M2 G-quadruplex dilute solution	X		X
34136	M2 G-quadruplex 20 wt% ethylene glycol	X		X
34137	M2 G-quadruplex 10 wt% PEG8000	X		X
34145	G-quadruplex of Human papillomavirus type 52	X		X
34162	Structure of minimal i-motif domain	X		X
34168	G-quadruplex structure of DNA oligonucleotide containing GGGGCC repeats linked to ALS and FTD	X		X
34221	The 1,8-bis(aminomethyl)anthracene and Quadruplex-duplex junction complex	X		X
34276	Tc-DNA/RNA duplex	X		X	X
34277	tc-DNA/tc-DNA duplex	X		X
34280	Tc-DNA/DNA duplex	X		X
34302	The major G-quadruplex form of HIV-1 LTR	X		X
34353	TINA-conjugated antiparallel DNA triplex	X		X
34386	SC14 G-hairpin	X		X
34467	Pre-folded structures govern folding pathways of human telomeric G-quadruplexes	X		X
34529	G-quadruplex with a G-A bulge	X		X
34587	deoxyxylose nucleic acid hairpin	X		X
34588	deoxyxylose nucleic acid hairpin	X		X
34594	Solution structure of DNA duplex containing a 2'-deoxy-2'2'-difluorodeoxycytidine (gemcitabine) modification	X		X
34595	Solution structure of DNA:RNA hybrid containing a 2'-deoxy-2'2'-difluorodeoxycytidine (gemcitabine) modification	X		X	X
34596	Solution structure of DNA duplex containing a 7,8-dihydro-8-oxo-1,N6-ethenoadenine base modification that induces exclusively A->T transversions in Escherichia coli	X		X
34599	Solution structure of DNA:RNA hybrid duplex	X		X	X
34611	Three-quartet c-kit2 G-quadruplex stabilized by a pyrene conjugate	X		X
34616	The structure of an i-motif/duplex junction at neutral pH	X		X
34623	A self-complementary DNA dodecamer duplex contaning 5-hydroxymethylcitosine	X		X
34624	A self-complementary DNA dodecamer duplex contaning 5-hydroxymethylcitosine	X		X
34625	A self-complementary DNA dodecamer duplex contaning 5-hydroxymethylcitosine	X		X
34626	A self-complementary DNA dodecamer duplex contaning 5-hydroxymethylcitosine	X		X
34679	10bp DNA/DNA duplex	X		X
34714	Phen-DC3 intercalation causes hybrid-to-antiparallel transformation of human telomeric DNA G-quadruplex	X		X
34735	Dimeric i-motif from 2'Farabinocytidine-modified TC5	X		X
34772	An i-motif domain able to undergo pH-dependent conformational transitions (acidic structure)	X		X
34774	An i-motif domain able to undergo pH-dependent conformational transitions (neutral structure)	X		X
34780	Tetra-stranded double-ion dependent DNA (diDNA) NMR structure of telomeric C.elegans fragment	X		X
34798	Structure of an i-motif domain with the cytosine analog 1,3-diaza-2-oxophenoxacione (tC) at neutral pH	X		X
34836	TINA-conjugated antiparallel DNA triplex	X		X
34845	d(ATTTC)3 dimeric structure	X		X
34895	Structure of a chair-type antiparallel quadruplex-duplex hybrid at pH 6	X		X
34900	Structure of a quadruplex-duplex hybrid with a (-pd+l) loop progression	X		X
36020	Structure of two CCTG repeats	X		X
36022	Structure of two TTTA repeats	X		X
36159	Solution structure for the 1:1 complex of a platinum(II)-based tripod bound to a hybrid-1 human telomeric G-quadruplex	X		X
36160	Solution structure for the unique dimeric 4:2 complex of a platinum(II)-based tripod bound to a hybrid-1 human telomeric G-quadruplex	X		X
36186	Solution Structure of the DNA complex of the C-terminal Domain of Rok	X	X	X
36326	NMR solution structure of a DNA minidumbbell containing an abasic bulge between two CCTG repeats	X		X
36378	NMR solution structures of the DNA minidumbbell formed by 5'-mCTTGXmCTTG-3'	X		X
36379	NMR solution structures of the DNA minidumbbell formed by two CmCTG repeats at pH 5	X		X
36380	NMR solution structures of the DNA minidumbbell formed by two CCTG repeats at pH 5	X		X
36411	Aptamer enhancing peroxidase activity of myoglobin	X		X
50278	Canonical and modified dsDNA 12mers	X		X
50378	M2, M2-L1, M2-L3, M2-L1L3 G-quadruplexes + Trisubstituted Naphtalene Diimide NDI-5	X		X
50625	A (3+1) hybrid G-quadruplex containing right loop progression	X		X
50986	Proton NMR chemical shifts of GGCCTG2	X		X
50987	Proton NMR chemical shifts of GGCCTG3	X		X
50988	Proton NMR chemical shifts of GGCCTG3-T2	X		X
50989	Proton NMR chemical shifts of GGCCTG4	X		X
51035	loxP spacer 12-mer	X		X
51037	loxP spacer 22-mer	X		X
51047	lox4 spacer 16-mer	X		X
51312	Assigned backbone amide and methyl chemical shifts for human Sox2 HMG domain bound to DNA containing the Fgf4 motif	X	X	X
51313	Assigned backbone amide and methyl chemical shifts for human Sox2 HMG domain Y72A mutant bound to DNA containing the Fgf4 motif	X	X	X
51337	5caC-containing dsDNA 12mers at three pH conditions	X		X
51612	Uracil-DNA glycosylase efficiency is modulated by substrate rigidity	X		X
51930	15N-Relaxation data for WT-H3-NCP	X	X	X
51931	15N-Relaxation data for R2Q-H3-NCP	X	X	X
51932	15N-Relaxation data for R8Q-H3-NCP	X	X	X
51933	15N-Relaxation data for R17Q-H3-NCP	X	X	X
51934	15N-Relaxation data for R26Q-H3-NCP	X	X	X
51935	15N-Relaxation data for R2/8/17/26Q-H3-NCP	X	X	X
52101	dGrU-RNA-DNA-Hybrid-R1rho	X		X	X
52102	dTrG-RNA-DNA-Hybrid-R1rho	X		X	X
52230	Human Znf706 complexed with cMyc DNA G4Quadruplex heteronuclear NOEs	X	X	X
52232	Znf706 complex with cMyc DNA G4 qudruplex T1 and T2 relaxation	X	X	X