BMRB - Biological Magnetic Resonance Bank

BMRB Query Grid

Select desired data type(s) and optionally limit polymer type(s). You can select multiple values by holding the "control" key (Windows, Linux) or "option" key (MacOS) while clicking. All data type selections are applied using a logical AND operator. Polymer selection join type can be selected. Click a column header to sort by that column.

Data type(s): Polymer type(s): Polymer join type:

Number of entries returned: 16289

Download all matching entries in NMR-STAR as a compressed file or download the results displayed on this page in CSV format.

BMRB ID	Entry Title	Any chemical shifts	Protein	DNA	RNA	Other
3	Secondary Structure of Acyl Carrier Protein as Derived from Two-Dimensional 1H NMR Spectroscopy	439	X
5	Specific assignment of resonances in the 1H nuclear magnetic resonance spectrum of the polypeptide cardiac stimulant anthopleurin-A	199	X
6	Structure of Apamin in Solution: A Two-Dimensional Nuclear Magnetic Resonance Study	120	X
7	The conformation of bombesin in solution as determined by two-dimensional 1H-NMR techniques	98	X
8	Structural Studies of alpha-Bungarotoxin. 1. Sequence-Specific 1H NMR Resonance Assignments	466	X
9	Three-Dimensional Structure of Potato Carboxypeptidase Inhibitor in Solution. A Study Using Nuclear Magnetic Resonance, Distance Geometry, and Restrained Molecular Dynamics	221	X
18	Stereospecific assignments of side-chain protons and characterization of torsion angles in Eglin c	267	X
19	Secondary Structure Determination of Human Beta-Endorphin by 1H NMR Spectroscopy	200	X
21	Structural and dynamical comparison of alpha, beta, and gamma forms of murine epidermal growth factor	35	X
23	Sequential Resonance Assignments in Protein 1H Nuclear Magnetic Resonance Spectra (Glucagon Bound to Perdeuterated Dodecylphosphocholine Micelles)	186	X
24	Solution Structure of Human Growth Hormone Releasing Factor (Combined Use of Circular Dichroism and Nuclear Magnetic Resonance Spectroscopy)	206	X
25	Assignment of Resonances in the 1H Nuclear Magnetic Resonance Spectrum of the Carbon Monoxide Complex of Human Hemoglobin alpha-Chains	70	X
26	1H-NMR assignment and secondary structure of a Herpes simplex virus glycoprotein D-1 antigenic domain	151	X
27	Proton Nuclear Magnetic Resonance Study of Hirudin: Resonance Assignment and Secondary Structure	403	X
29	Two-Dimensional 1H NMR studies of Histidine-Containing Protein from Escherichia coli. 1. Sequential Resonance Assignments	318	X
30	Nuclear magnetic resonance study of the globular domain of chicken histone H5: Resonance assignment and secondary structure	440	X
32	Sequence-specific resonance assignments in the 1H nuclear-magnetic-resonance spectrum of the Lac repressor DNA-binding domain 1-51 from Escherichia coli by two-dimensional spectroscopy	256	X
36	High Resolution Nuclear Magnetic Resonance Studies of the Conformation and Orientation of Melittin Bound to a Lipid-Water Interface	24	X
39	Sequence-specific 1H-NMR assignments in rat-liver metallothionein-2	244	X
40	Assignment of Resonances in the 1H Nuclear Magnetic Resonance Spectrum of the Carbon Monoxide Complex of the Sperm Whale Myoglobin by Phase-sensitive Two-dimensional Techniques	144	X
41	Two-Dimensional NMR Studies of the Antimicrobial Peptide NP-5	194	X
42	Two-Dimensional NMR Studies of Kazal Proteinase Inhibitors. 1. Sequence-Specific Assignments and Secondary Structure of Turkey Ovomucoid Third Domain	361	X
44	Two-Dimensional NMR Studies of Kazal Proteinase Inhibitors. 2. Sequence-Specific Assignments and Secondary Structure of Reactive Site Modified Turkey Ovomucoid Third Domain	118	X
45	Sequential Resonance Assignments in Protein 1H Nuclear Magnetic Resonance Spectra (Basic Pancreatic Trypsin Inhibitor)	329	X
46	Toward the Complete Assignment of the Carbon Nuclear Magnetic Resonance Spectrum of the Basic Pancreatic Trypsin Inhibitor	120	X
48	Protein Structures in Solution by Nuclear Magnetic Resonance and Distance Geometry (The Polypeptide Fold of the Basic Pancreatic Trypsin Inhibitor Determined using Two Different Algorithms, DISGEO and DISMAN)	368	X
49	Comparative studies of conformation and internal mobility in native and circular basic pancreatic trypsin inhibitor by 1H nuclear magnetic resonance in solution	354	X
50	Proton magnetic resonance characterization of phoratoxins and homologous proteins related to crambin	24	X
53	Assignment of the 1H Nuclear Magnetic Resonance Spectrum of the Proteinase Inhibitor IIA from Bull Seminal Plasma by Two-dimensional Nuclear Magnetic Resonance at 500 MHz	290	X
55	Nuclear Magnetic Resonance Study of the Solution Structure of alpha 1-Purothionin (Sequential Resonance Assignment, Secondary Structure and Low Resolution Tertiary Structure)	307	X
58	Residue-specific Assignments of Resonances in the 1H Nuclear Magnetic Resonance Spectrum of Ribosomal Protein E-L30 by Systematic Application of Two-dimensional Fourier Transform Nuclear Magnetic Resonance Methods	271	X
60	Complete Sequence-specific 1H Nuclear Magnetic Resonance Assignments for the alpha-Amylase Polypeptide Inhibitor Tendamistat from Streptomyces tendae	477	X
62	NMR Sequential Assignment of Escherichia coli Thioredoxin Utilizing Random Fractional Deuteriation	357	X
63	NMR Analysis and Sequence of Toxin II from the Sea Anemone Radianthus paumotensis	258	X
64	Conformational Studies by 1H Nuclear Magnetic Resonance of the Trypsin-Chymotrypsin Inhibitor B-III from Peanuts and Its Enzymatically Modified Derivative	9	X
65	Assignment of the 1H Nuclear Magnetic Resonance Spectrum of the Trypsin Inhibitor E from Dendroaspis polylepis polylepis Two-dimensional Nuclear Magnetic Resonance at 500MHz	324	X
66	Assignment of the 1H Nuclear Magnetic Resonance Spectrum of the Trypsin Inhibitor Homologue K from Dendroaspis polylepis polylepis. Two-dimensional Nuclear Magnetic Resonance at 360 and 500 MHz.	309	X
68	Sequential 1H NMR Assignments and Secondary Structure Identification of Human Ubiquitin	556	X
76	Assignment of resonances in the 1H NMR spectrum of human lysozyme	183	X
79	1H-NMR sequential assignments and cation-binding studies of spinach plastocyanin	547	X
80	The Secondary Structure of the Toxin ATX Ia from Anemonia sulcata in Aqueous Solution Determined on the Basis of Complete Sequence-specific 1H NMR Assignments	282	X
81	NMR of a Peptic Peptide Spanning the Triprolyl Sequence in Myelin Basic Protein	123	X
86	High-Resolution 1H NMR Study of the Solution Structure of Alamethicin	131	X
87	The conformation of bombesin in solution as determined by two-dimensional 1H-NMR techniques	77	X
88	Sequence-specific 1H-NMR assignments and determination of the secondary structure in aqueous solution of the cardiotoxins CTXIIa and CTXIIb from Naja mossambica mossambica	434	X
90	Analysis of the Methyl 1H-NMR Spectrum of Crambin, a Hydrophobic Protein	15	X
94	Structural and dynamical comparison of alpha, beta, and gamma forms of murine epidermal growth factor	35	X
95	Structural and dynamical comparison of alpha, beta, and gamma forms of murine epidermal growth factor	35	X
96	Sequence-specific resonance assignments in the 1H nuclear-magnetic-resonance spectrum of the Lac repressor DNA-binding domain 1-51 from Escherichia coli by two-dimensional spectroscopy	258	X
97	Sequence-specific 1H-NMR assignments in rat-liver metallothionein-2	57	X
102	Conformational Studies by 1H Nuclear Magnetic Resonance of the Trypsin-Chymotrypsin Inhibitor B-III from Peanuts and Its Enzymatically Modified Derivative	9	X
103	Conformational Studies by 1H Nuclear Magnetic Resonance of the Trypsin-Chymotrypsin Inhibitor B-III from Peanuts and Its Enzymatically Modified Derivative	9	X
104	Conformational Studies by 1H Nuclear Magnetic Resonance of the Trypsin-Chymotrypsin Inhibitor B-III from Peanuts and Its Enzymatically Modified Derivative	9	X
105	Conformational Studies by 1H Nuclear Magnetic Resonance of the Trypsin-Chymotrypsin Inhibitor B-III from Peanuts and Its Enzymatically Modified Derivative	9	X
106	Conformational Studies by 1H Nuclear Magnetic Resonance of the Trypsin-Chymotrypsin Inhibitor B-III from Peanuts and Its Enzymatically Modified Derivative	9	X
107	Conformational Studies by 1H Nuclear Magnetic Resonance of the Trypsin-Chymotrypsin Inhibitor B-III from Peanuts and Its Enzymatically Modified Derivative	9	X
108	Conformational Studies by 1H Nuclear Magnetic Resonance of the Trypsin-Chymotrypsin Inhibitor B-III from Peanuts and Its Enzymatically Modified Derivative	9	X
109	Conformational Studies by 1H Nuclear Magnetic Resonance of the Trypsin-Chymotrypsin Inhibitor B-III from Peanuts and Its Enzymatically Modified Derivative	12	X
112	Conformational Studies by 1H Nuclear Magnetic Resonance of the Trypsin-Chymotrypsin Inhibitor B-III from Peanuts and Its Enzymatically Modified Derivative	3	X
114	Three-dimensional structure of natural charybdotoxin in aqueous solution by 1H-NMR Charybdotoxin possesses a structural motif found in other scorpion toxins	245	X
115	Assignment of the 1H Nuclear Magnetic Resonance Spectrum of the Trypsin Inhibitor E from Dendroaspis polylepis polylepis Two-dimensional Nuclear Magnetic Resonance at 500MHz	3	X
116	Assignment of the 1H Nuclear Magnetic Resonance Spectrum of the Trypsin Inhibitor E from Dendroaspis polylepis polylepis Two-dimensional Nuclear Magnetic Resonance at 500MHz	3	X
117	Assignment of the 1H Nuclear Magnetic Resonance Spectrum of the Trypsin Inhibitor Homologue K from Dendroaspis polylepis polylepis. Two-dimensional Nuclear Magnetic Resonance at 360 and 500 MHz.	4	X
120	1H-NMR sequential assignments and cation-binding studies of spinach plastocyanin	3	X
121	1H-NMR sequential assignments and cation-binding studies of spinach plastocyanin	1	X
122	1H-NMR sequential assignments and cation-binding studies of spinach plastocyanin	1	X
123	The Secondary Structure of the Toxin ATX Ia from Anemonia sulcata in Aqueous Solution Determined on the Basis of Complete Sequence-specific 1H NMR Assignments	1	X
126	Some structural features of the iron-uptake regulation protein	271	X
127	Sequence-specific resonance assignments in the 1H nuclear-magnetic-resonance spectrum of the Lac repressor DNA-binding domain 1-51 from Escherichia coli by two-dimensional spectroscopy	53	X
131	Proton-NMR studies show that the Thr-102 mutant of yeast iso-1-cytochrome is a typical member of the eukaryotic cytochrome c family	268	X
132	Secondary structure determination for alpha-neurotoxin from Dendroaspis polylepis polylepis based on sequence-specific 1H-nuclear-magnetic-resonance assignments	325	X
133	Two-dimensional 1H-NMR investigation of ribonuclease T1 (Resonance assignments, secondary and low-resolution tertiary structures of ribonuclease T1)	539	X
136	NMR Signal Assignments of Amide Protons in the alpha-Helical Domains of Staphylococcal Nuclease	59	X
139	Structure of the Toxic Domain of the Escherichia coli Heat-Stable Enterotoxin ST I	58	X
140	A 1H-NMR study of the solution conformation of secretin Resonance assignment and secondary structure	181	X
141	The Solution Conformation of the Antibacterial Peptide Cecropin A: A Nuclear Magnetic Resonance and Dynamical Simulated Annealing Study	279	X
142	NMR Study of the Solution Conformation of Rat Atrial Natriuretic Factor 7-23 in Sodium Dodecyl Sulfate Micelles	96	X
144	Two-dimensional 1H Nuclear Magnetic Resonance Study of Pike pI 5.0 Parvalbumin (Esox lucius) Sequential Resonance Assignments and Folding of the Polypeptide Chain	681	X
146	Assignment of the 1H Nuclear Magnetic Resonance Spectrum of the Proteinase Inhibitor IIA from Bull Seminal Plasma by Two-dimensional Nuclear Magnetic Resonance at 500 MHz	292	X
148	Specific assignment of resonances in the 1H nuclear magnetic resonance spectrum of the polypeptide cardiac stimulant anthopleurin-A	3	X
149	Specific assignment of resonances in the 1H nuclear magnetic resonance spectrum of the polypeptide cardiac stimulant anthopleurin-A	6	X
150	Specific assignment of resonances in the 1H nuclear magnetic resonance spectrum of the polypeptide cardiac stimulant anthopleurin-A	20	X
151	Specific assignment of resonances in the 1H nuclear magnetic resonance spectrum of the polypeptide cardiac stimulant anthopleurin-A	9	X
161	NMR studies of the conformations of leghemoglobins from soybean and lupin	161	X
162	1H NMR Assignment and Secondary Structural Elements of Human Transforming Growth Factor alpha	320	X
169	Proton NMR Studies of Plastocyanin: Assignment of Aromatic and Methyl Group Resonances from Two-Dimensional Spectra	194	X
171	The assignment of the 1H nuclear magnetic resonance spectrum of azurin (An investigation of the 1H NMR spectrum of the blue copper protein, azurin, from Pseudomonas aeruginosa, with reference to the previously determined crystal structure)	101	X
180	NMR studies of the conformations of leghemoglobins from soybean and lupin	143	X
181	NMR studies of the conformations of leghemoglobins from soybean and lupin	115	X
182	NMR studies of the conformations of leghemoglobins from soybean and lupin	176	X
183	1H NMR Assignment and Secondary Structural Elements of Human Transforming Growth Factor alpha	3	X
185	Proton NMR Studies of Plastocyanin: Assignment of Aromatic and Methyl Group Resonances from Two-Dimensional Spectra	109	X
186	Proton NMR Studies of Plastocyanin: Assignment of Aromatic and Methyl Group Resonances from Two-Dimensional Spectra	124	X
187	Proton NMR Studies of Plastocyanin: Assignment of Aromatic and Methyl Group Resonances from Two-Dimensional Spectra	9	X
188	NMR Signal Assignments of Amide Protons in the alpha-Helical Domains of Staphylococcal Nuclease	28	X
189	NMR Signal Assignments of Amide Protons in the alpha-Helical Domains of Staphylococcal Nuclease	50	X
190	Proton-NMR studies show that the Thr-102 mutant of yeast iso-1-cytochrome is a typical member of the eukaryotic cytochrome c family	66	X
191	One- and two-dimensional NMR studies of yeast phosphoglycerate kinase	2	X
192	Determination of the Three-Dimensional Solution Structure of the C-Terminal Domain of CellobiohydrolOCe I from Trichodermi reesi. A Study using NMR and Hybrid distance Geometry-Dynamical Simulated Annealing.	218	X
193	Solution conformation of endothelin determined by nuclear magnetic resonance and distance geometry.	149	X
194	1H-NMR study of endothelin, sequence-specific assignment of the spectrum and a solution structure	145	X
195	Stereospecific Nuclear Magnetic Resonance Assignments of the Methyl Groups of Valine and Leucine in the DNA-Binding Domain of the 434 Repressor by Biosynthetically Directed Fractional 13C Labeling	112	X
196	Determination of the Three-Dimensional Solution Structure of the C-Terminal Domain of CellobiohydrolOCe I from Trichodermi reesi. A Study using NMR and Hybrid distance Geometry-Dynamical Simulated Annealing.	220	X
199	Determination of the Complete Three-dimensional Structure of the Trypsin Inhibitor from Squash Seeds in Aqueous Solution by Nuclear Magnetic Resonance and a Combination of Distance Geometry and Dynamical Simulated Annealing	192	X
200	Proton NMR and CD solution conformation determination and opioid receptor binding studies of a dynorphin A(1-17) model peptide	135	X
216	1H NMR Studies of Eukaryotic Cytochrome c Resonance Assignments and Iron-Hexacyanide-Mediated Electron Exchange	19	X
217	1H NMR Studies of Eukaryotic Cytochrome c Resonance Assignments and Iron-Hexacyanide-Mediated Electron Exchange	22	X
218	1H NMR Studies of Eukaryotic Cytochrome c Resonance Assignments and Iron-Hexacyanide-Mediated Electron Exchange	18	X
219	1H NMR Studies of Eukaryotic Cytochrome c Resonance Assignments and Iron-Hexacyanide-Mediated Electron Exchange	19	X
220	1H NMR Studies of Eukaryotic Cytochrome c Resonance Assignments and Iron-Hexacyanide-Mediated Electron Exchange	17	X
221	1H NMR Studies of Eukaryotic Cytochrome c Resonance Assignments and Iron-Hexacyanide-Mediated Electron Exchange	12	X
222	1H NMR Studies of Eukaryotic Cytochrome c Resonance Assignments and Iron-Hexacyanide-Mediated Electron Exchange	7	X
223	1H NMR Studies of Eukaryotic Cytochrome c Resonance Assignments and Iron-Hexacyanide-Mediated Electron Exchange	13	X
224	1H NMR Studies of Eukaryotic Cytochrome c Resonance Assignments and Iron-Hexacyanide-Mediated Electron Exchange	1	X
225	1H NMR Studies of Eukaryotic Cytochrome c Resonance Assignments and Iron-Hexacyanide-Mediated Electron Exchange	1	X
226	1H NMR Studies of Eukaryotic Cytochrome c Resonance Assignments and Iron-Hexacyanide-Mediated Electron Exchange	1	X
227	Determination of the Coordination Geometry at the Heme Iron in Three Cytochromes c from Saccharomyces cerevisiae and from Candida krusei Based on Individual 1H-NMR Assignments for Heme c and the Axially Coordinated Amino Acids	29	X
228	Determination of the Coordination Geometry at the Heme Iron in Three Cytochromes c from Saccharomyces cerevisiae and from Candida krusei Based on Individual 1H-NMR Assignments for Heme c and the Axially Coordinated Amino Acids	26	X
229	Determination of the Coordination Geometry at the Heme Iron in Three Cytochromes c from Saccharomyces cerevisiae and from Candida krusei Based on Individual 1H-NMR Assignments for Heme c and the Axially Coordinated Amino Acids	26	X
233	Determination of the Coordination Geometry at the Heme Iron in Three Cytochromes c from Saccharomyces cerevisiae and from Candida krusei Based on Individual 1H-NMR Assignments for Heme c and the Axially Coordinated Amino Acids	6	X
234	Determination of the Coordination Geometry at the Heme Iron in Three Cytochromes c from Saccharomyces cerevisiae and from Candida krusei Based on Individual 1H-NMR Assignments for Heme c and the Axially Coordinated Amino Acids	6	X
235	Determination of the Coordination Geometry at the Heme Iron in Three Cytochromes c from Saccharomyces cerevisiae and from Candida krusei Based on Individual 1H-NMR Assignments for Heme c and the Axially Coordinated Amino Acids	6	X
236	Individual Assignments of Amide Protein Resonances in the Proton NMR Spectrum of the Basic Pancreatic Trypsin Inhibitor	46	X
237	Systematic Application of Two-Dimensional 1H Nuclear-Magnetic-Resonance Techniques for Studies of Proteins 1. Combined Use of Spin-Echo-Correlated Spectroscopy and J-Resolved Spectroscopy for the Identification of Complete Spin Systems of	116	X
238	Assignment of Aromatic Resonances in the H1 Nuclear Magnetic Resonance Spectra of Cardioactive Polypeptides from Sea Anemones	25	X
239	Assignment of Aromatic Resonances in the H1 Nuclear Magnetic Resonance Spectra of Cardioactive Polypeptides from Sea Anemones	12	X
240	Assignment of Aromatic Resonances in the H1 Nuclear Magnetic Resonance Spectra of Cardioactive Polypeptides from Sea Anemones	21	X
241	Assignment of Aromatic Resonances in the H1 Nuclear Magnetic Resonance Spectra of Cardioactive Polypeptides from Sea Anemones	10	X
242	Assignment of Aromatic Resonances in the H1 Nuclear Magnetic Resonance Spectra of Cardioactive Polypeptides from Sea Anemones	17	X
243	Two-Dimensional 1H NMR Studies of Cytochrome c: Assignment of the N-Terminal Helix	55	X
244	Two-Dimensional 1H NMR Studies of Cytochrome c: Assignment of the N-Terminal Helix	5	X
245	Structure of Melittin Bound to Perdeuterated Dodecylphosphocholine Micelles As Studied by Two-Dimensional NMR and Distance Geometry Calculations	218	X
246	Polypeptide Chain Fold of Human Transforming Growth Factor alpha Analogous to Those of Mouse and Human Epidermal Growth Factors as Studied by Two-Dimensional 1H NMR	316	X
247	1H NMR Sequential Resonance Assignments, Secondary Structure, and Global Fold in Solution of the Major (trans-Pro43) Form of Bovine Calbindin D9k	566	X
248	Proton NMR Studies of a Metallothionein from Neurospora crassa: Sequence-Specific Assignments by NOE Measurements in the Rotating Frame	103	X
249	Sequential 1H Assignment and Secondary Structure Determination of Salmon Calcitonin in Solution	226	X
250	Solution Structures of alpha-Conotoxin G1 Determined by Two-Dimensional NMR Spectroscopy	69	X
252	High-Resolution Structure of an HIV Zinc Fingerlike Domain via a New NMR-Based Distance Geometry Approach	111	X
253	A Proton Nuclear Magnetic Resonance Assignment and Secondary Structure Determination of Recombinant Human Thioredoxin	1	X
254	A Proton Nuclear Magnetic Resonance Assignment and Secondary Structure Determination of Recombinant Human Thioredoxin	2	X
255	A Proton Nuclear Magnetic Resonance Assignment and Secondary Structure Determination of Recombinant Human Thioredoxin	1	X
256	A Proton Nuclear Magnetic Resonance Assignment and Secondary Structure Determination of Recombinant Human Thioredoxin	683	X
257	A Proton Nuclear Magnetic Resonance Assignment and Secondary Structure Determination of Recombinant Human Thioredoxin	690	X
258	Nuclear Magnetic Resonance Study on Rabbit Skeletal Troponin C: Calcium-Induced Conformational Change	47	X
259	Nuclear Magnetic Resonance Study on Rabbit Skeletal Troponin C: Calcium-Induced Conformational Change	4	X
260	Complete Assignment of the 1H Nuclear Magnetic Resonance Spectrum of French Bean Plastocyanin: Sequential Resonance Assignments, Secondary Structure and Global Fold	679	X
261	Complete Assignment of the 1H Nuclear Magnetic Resonance Spectrum of French Bean Plastocyanin: Sequential Resonance Assignments, Secondary Structure and Global Fold	2	X
262	Carbonyl 13C NMR Spectrum of Basic Pancreatic Trypsin Inhibitor: Resonance Assignments by Selective Amide Hydrogen Isotope Labeling and Detection of Isotope Effects on 13C Nuclear Shielding	49	X
263	Carbonyl 13C NMR Spectrum of Basic Pancreatic Trypsin Inhibitor: Resonance Assignments by Selective Amide Hydrogen Isotope Labeling and Detection of Isotope Effects on 13C Nuclear Shielding	51	X
264	Carbonyl 13C NMR Spectrum of Basic Pancreatic Trypsin Inhibitor: Resonance Assignments by Selective Amide Hydrogen Isotope Labeling and Detection of Isotope Effects on 13C Nuclear Shielding	51	X
274	Proton Resonance Assignments of Horse Ferricytochrome c	608	X
275	Sequence-Specific 1H NMR Assignments and Secondary Structure in the Sea Anemone Stichodactyla helianthus Neurotoxin I	313	X
276	1H NMR Study of the Solution Properties of the Polypeptide Neurotoxin I from the Sea Anemone Stichodactyla helianthus	18	X
280	Determination of the Secondary Structure of Interleukin-8 by Nuclear Magnetic Resonance Spectroscopy	530	X
283	Studies on the Solution Structure of Human Thioredoxin Using Heteronuclear 15N-1H Nuclear Magnetic Resonance Spectroscopy	104	X
284	Studies on the Solution Structure of Human Thioredoxin Using Heteronuclear 15N-1H Nuclear Magnetic Resonance Spectroscopy	106	X
285	Assignment of paramagnetically shifted resonances in the 1H NMR spectrum of horse ferricytochrome c	13	X
286	Assignment of paramagnetically shifted resonances in the 1H NMR spectrum of horse ferricytochrome c	14	X
287	Determination of The Secondary Structure of the DNA Binding Protein Ner from Phage Mu Using 1H Homonuclear and 15N-1H Heteronuclear NMR Spectroscopy	415	X
288	Determination of The Secondary Structure of the DNA Binding Protein Ner from Phage Mu Using 1H Homonuclear and 15N-1H Heteronuclear NMR Spectroscopy	10	X
289	Sequence-Specific 1H NMR Assignments and Secondary Structure of Eglin c	502	X
290	A 1H NMR Determination of the Solution Conformation of a Synthetic Peptide Analogue of Calcium-Binding Site III of Rabbit Skeletal Troponin C	73	X
291	Solution Structural Characterization of Cyanometmyoglobin: Resonance Assignment of Heme Cavity Residues by Two-Dimensional NMR	44	X
292	Solution Structural Characterization of Cyanometmyoglobin: Resonance Assignment of Heme Cavity Residues by Two-Dimensional NMR	37	X
293	Solution Structural Characterization of Cyanometmyoglobin: Resonance Assignment of Heme Cavity Residues by Two-Dimensional NMR	7	X
294	Structural Studies of Cytochrome b5: Complete Sequence-Specific Resonance Assignments for the Trypsin-Solubilized Microsomal Ferrocytochrome b5 Obtained from Pig and Calf	547	X
295	Structural Studies of Cytochrome b5: Complete Sequence-Specific Resonance Assignments for the Trypsin-Solubilized Microsomal Ferrocytochrome b5 Obtained from Pig and Calf	301	X
298	Structure-function relationships in the polypeptide cardiac stimulant, anthopleurin-A (Effects of limited proteolysis by trypsin)	129	X
300	NMR Studies of Toxin III from the Sea Anemone Radianthus paumotensis and Comparison of Its Secondary Structure with related Toxins	277	X
301	Conformation of secretin in dimethyl sulfoxide solution	147	X
302	1H NMR Studies of the Solution Conformation of an Analogue of the C-Peptide of Ribonuclease A	92	X
306	N-Terminal Half of a Mitochondrial Presequence Peptide Takes a Helical Conformation When Bound to Dodecylphosphocholine Micelles: A Proton Nuclear Magnetic Resonance Study	200	X
307	N-Terminal Half of a Mitochondrial Presequence Peptide Takes a Helical Conformation When Bound to Dodecylphosphocholine Micelles: A Proton Nuclear Magnetic Resonance Study	4	X
308	Structural Properties of Apocytochrome b5: Presence of a Stable Native Core	55	X
309	Structural Properties of Apocytochrome b5: Presence of a Stable Native Core	8	X
311	Structural Properties of Apocytochrome b5: Presence of a Stable Native Core	1	X
314	1H-n.m.r. studies of squash seed trypsin inhibitor	148	X
316	Proton NMR studies of horse ferricytochrome c Completion of the assignment of the well resolved hyperfine shifted resonances	22	X
317	Proton NMR studies of horse ferricytochrome c Completion of the assignment of the well resolved hyperfine shifted resonances	24	X
321	NMR study of a 34-residue N-terminal fragment of the parathyroid-hormone-related protein secreted during humoral hypercalcemia of malignancy	250	X
325	The Rate and Structural Consequences of Proline Cis-Trans Isomerization in Calbindin D9k: NMR Studies of the Minor (cis-pro43) Isoform and the Pro43Gly Mutant	202	X
326	The Rate and Structural Consequences of Proline Cis-Trans Isomerization in Calbindin D9k: NMR Studies of the Minor (cis-pro43) Isoform and the Pro43Gly Mutant	564	X
327	1H NMR Resonance Assignments, Secondary Structure, and Global Fold of Apo Bovine Calbindin D9k	564	X
329	Identification and Description of beta-Structure in Horse Muscle Acylphosphatase by Nuclear Magnetic Resonance Spectroscopy	312	X
330	Proton NMR Comparison of the Saccharomyces cerevisiae Ferricytochrome c Isozyme-1 Monomer and Covalent Disulfide Dimer	12	X
331	Proton NMR Comparison of the Saccharomyces cerevisiae Ferricytochrome c Isozyme-1 Monomer and Covalent Disulfide Dimer	12	X
335	Conformation of a Heptadecapeptide Comprising the Segment Encephalitogenic in Rhesus Monkeys	51	X
336	1H-NMR studies of structural homologies between the heme environments in horse cytochrome c and in cytochrome c-552 from Euglena gracilis	28	X
337	1H-NMR studies of structural homologies between the heme environments in horse cytochrome c and in cytochrome c-552 from Euglena gracilis	28	X
338	15N Chemical Shifts of Backbone Amides in Bovine Pancreatic Trypsin Inhibitor	104	X
339	15N Chemical Shifts of Backbone Amides in Bovine Pancreatic Trypsin Inhibitor	32	X
340	15N Chemical Shifts of Backbone Amides in Bovine Pancreatic Trypsin Inhibitor	32	X
341	15N Chemical Shifts of Backbone Amides in Bovine Pancreatic Trypsin Inhibitor	32	X
342	15N Chemical Shifts of Backbone Amides in Bovine Pancreatic Trypsin Inhibitor	30	X
345	Comparison of Reduced and Oxidized Yeast Iso-1-cytochrome c Using Proton Paramagnetic Shifts	603	X
346	Comparison of Reduced and Oxidized Yeast Iso-1-cytochrome c Using Proton Paramagnetic Shifts	584	X
349	Kringle-2 domain of the tissue-type plasminogen activator	575	X
350	Kringle-2 domain of the tissue-type plasminogen activator	1	X
351	Kringle-2 domain of the tissue-type plasminogen activator	1	X
353	Hydrogen Exchange of the Tryptophan Residues in Bovine, Goat, Guinea Pig, and Human alpha-Lactalbumin	9	X
354	Hydrogen Exchange of the Tryptophan Residues in Bovine, Goat, Guinea Pig, and Human alpha-Lactalbumin	3	X
355	Hydrogen Exchange of the Tryptophan Residues in Bovine, Goat, Guinea Pig, and Human alpha-Lactalbumin	3	X
356	Conformational behavior of fragments of adrenocorticotropin and their antisense peptides determined by NMR spectroscopy and CD spectropolarimetry	166	X
357	Conformational behavior of fragments of adrenocorticotropin and their antisense peptides determined by NMR spectroscopy and CD spectropolarimetry	152	X
358	Sequential Resonance Assignment and Secondary Structure Determination of the Ascaris Trypsin Inhibitor, a Member of a Novel Class of Proteinase Inhibitors	421	X
359	Proton magnetic resonance characterization of phoratoxins and homologous proteins related to crambin	24	X
360	Proton magnetic resonance characterization of phoratoxins and homologous proteins related to crambin	21	X
361	Proton magnetic resonance characterization of phoratoxins and homologous proteins related to crambin	21	X
362	Proton magnetic resonance characterization of phoratoxins and homologous proteins related to crambin	18	X
363	Rearrangement of the Distal Pocket Accompanying E7 His->Gln Substitution in Elephant Carbonmonoxy- and Oxymyoglobin: 1H NMR Identification of a New Aromatic Residue in the Heme Pocket	31	X
364	Rearrangement of the Distal Pocket Accompanying E7 His->Gln Substitution in Elephant Carbonmonoxy- and Oxymyoglobin: 1H NMR Identification of a New Aromatic Residue in the Heme Pocket	26	X
367	Assignments of 15N and 1H NMR Resonances and a Neutral pH Ionization in Rhodospirillum Rubrum Cytochrome c2	16	X
369	Characterization of pH-Dependent Conformational Heterogeneity in Rhodospirillum rubrum Cytochrome c2 Using 15N and 1H NMR	2	X
371	Secondary Structure of a Leucine Zipper Determined by Nuclear Magnetic Resonance Spectroscopy	125	X
372	A 1H NMR study of the solution conformation of the neuropeptide Galanin	190	X
373	A 1H NMR study of the solution conformation of the neuropeptide Galanin	103	X
374	Sequential 1H-NMR assignments and secondary structure of the sea anemone polypeptide anthopleurin-A	292	X
375	Sequential 1H-NMR assignments and secondary structure of the sea anemone polypeptide anthopleurin-A	288	X
376	A two-dimensional 1H NMR study on Megasphaera elsdenii flavodoxin in the reduced state	844	X
385	Proton NMR Assignments and Regular Backbone Structure of Bovine Pancreatic Ribonuclease A in Aqueous Solution	640	X
386	1H NMR Studies of Bovine and Porcine Phospholipase A2: Assignment of Aromatic Resonances and Evidence for a Conformational Equilibrium in Solution	145	X
387	1H NMR Studies of Bovine and Porcine Phospholipase A2: Assignment of Aromatic Resonances and Evidence for a Conformational Equilibrium in Solution	129	X
388	1H NMR Studies of Bovine and Porcine Phospholipase A2: Assignment of Aromatic Resonances and Evidence for a Conformational Equilibrium in Solution	103	X
389	1H NMR Studies of Bovine and Porcine Phospholipase A2: Assignment of Aromatic Resonances and Evidence for a Conformational Equilibrium in Solution	11	X
390	1H NMR Studies of Porcine Calbindin D9k in Solution: Sequential Resonance Assignment, Secondary Structure, and Global Fold	568	X
391	Structural Characterization of the Interactions between Calmodulin and Skeletal Muscle Myosin Light Chain Kinase: Effect of Peptide (576-594)G Binding on the Ca2+-Binding Domains	122	X
392	Structural Characterization of the Interactions between Calmodulin and Skeletal Muscle Myosin Light Chain Kinase: Effect of Peptide (576-594)G Binding on the Ca2+-Binding Domains	123	X
393	NMR Assignments for the Amino-Terminal Residues of trp Repressor and Their Role in DNA Binding	31	X
394	NMR Studies of Arc Repressor Mutants: Proton Assignments, Secondary Structure, and Long-Range Contacts for the Thermostable Proline-8 -> Leucine Variant of Arc	409	X
395	Sequence-Specific 1H NMR Assignment and Secondary Structure of the Arc Repressor of Bacteriophage P22, As Determined by Two-Dimensional 1H NMR Spectroscopy	351	X
397	Solution structure of EETI-II, a Squash Inhibitor Knottin from Ecballium elaterium.	255	X
398	Experimental Evidence of an alpha Helix in Desulfovibrio desulfuricans Norway Ferredoxin I: A Two-Dimensional NMR Study	55	X
401	High-Resolution NMR Studies of Fibrinogen-like Peptides in Solution: Structural Basis for the Bleeding Disorder Caused by a Single Mutation of Gly(12) to Val(12) in the Aalpha Chain of Human Fibrinogen Rouen	17	X
402	High-Resolution NMR Studies of Fibrinogen-like Peptides in Solution: Structural Basis for the Bleeding Disorder Caused by a Single Mutation of Gly(12) to Val(12) in the Aalpha Chain of Human Fibrinogen Rouen	18	X
405	Two-Dimensional 1H NMR of Gene 5 Protein Indicates That Only Two Aromatic Rings Interact Significantly with Oligodeoxynucleotide Bases	58	X
407	NMR identification of a partial helical conformation for bombesin in solution	100	X
408	Solution conformation of leiurotoxin I (scyllatoxin) by 1H nuclear magnetic resonance Resonance assignment and secondary structure	217	X
410	Two-dimensional 1H NMR spectroscopy of two chemically modified analogs of the basic pancreatic trypsin inhibitor Sequence-specific resonance assignments and sequence location of conformation changes relative to the native protein	59	X
411	The Influence of a Single Salt Bridge on Static and Dynamic Features of the Globular Solution Conformation of the Basic Pancreatic Trypsin Inhibitor 1H and 13C Nuclear-Magnetic-Resonance Studies of the Native and the Transaminated Inhibitor	4	X
412	The Influence of a Single Salt Bridge on Static and Dynamic Features of the Globular Solution Conformation of the Basic Pancreatic Trypsin Inhibitor 1H and 13C Nuclear-Magnetic-Resonance Studies of the Native and the Transaminated Inhibitor	4	X
413	The Influence of a Single Salt Bridge on Static and Dynamic Features of the Globular Solution Conformation of the Basic Pancreatic Trypsin Inhibitor 1H and 13C Nuclear-Magnetic-Resonance Studies of the Native and the Transaminated Inhibitor	4	X
414	The Influence of a Single Salt Bridge on Static and Dynamic Features of the Globular Solution Conformation of the Basic Pancreatic Trypsin Inhibitor 1H and 13C Nuclear-Magnetic-Resonance Studies of the Native and the Transaminated Inhibitor	4	X
415	The Influence of a Single Salt Bridge on Static and Dynamic Features of the Globular Solution Conformation of the Basic Pancreatic Trypsin Inhibitor 1H and 13C Nuclear-Magnetic-Resonance Studies of the Native and the Transaminated Inhibitor	4	X
416	The Influence of a Single Salt Bridge on Static and Dynamic Features of the Globular Solution Conformation of the Basic Pancreatic Trypsin Inhibitor 1H and 13C Nuclear-Magnetic-Resonance Studies of the Native and the Transaminated Inhibitor	4	X
417	High-Resolution NMR Studies of Fibrinogen-like Peptides in Solution: Structural Basis for the Bleeding Disorder Caused by a Single Mutation of Gly(12) to Val(12) in the Aalpha Chain of Human Fibrinogen Rouen	17	X
418	Solution Structure of Apamin Determined by Nuclear Magnetic Resonance and Distance Geometry	7	X
419	Systematic Application of Two-Dimensional 1H Nuclear-Magnetic-Resonance Techniques for Studies of Proteins 2. Combined Use of Correlated Spectroscopy and Nuclear Overhauser Spectroscopy for Sequential Assignments of Backbone Resonances and	85	X
420	Complete assignment of the 1H NMR spectrum of a synthetic zinc finger from Xfin Sequential resonance assignments and secondary structure	192	X
421	1H Nuclear Magnetic Resonance Assignments and Secondary Structure of Porcine C5ades Arg	388	X
422	Solution Conformation of Conotoxin GI Determined by 1H Nuclear Magnetic Resonance Spectroscopy and Distance Geometry Calculations	65	X
423	Solution Conformation of Conotoxin GI Determined by 1H Nuclear Magnetic Resonance Spectroscopy and Distance Geometry Calculations	5	X
426	Proton nuclear Overhauser effect investigation of the heme pocket expansion in trimethyl phosphine sperm whale myoglobin	17	X
428	Solution Conformation of the Type I Collagen alpha-1 Chain N-Telopeptide Studied by 1H NMR Spectroscopy	114	X
429	Solution Conformation of the Type I Collagen alpha-1 Chain N-Telopeptide Studied by 1H NMR Spectroscopy	9	X
430	Solution Conformation of the Type I Collagen alpha-1 Chain N-Telopeptide Studied by 1H NMR Spectroscopy	37	X
432	NMR Study of the Phosphoryl Binding Loop in Purine Nucleotide Proteins: Evidence for a Strong Hydrogen Bonding in Human N-ras p21	9	X
433	NMR Study of the Phosphoryl Binding Loop in Purine Nucleotide Proteins: Evidence for a Strong Hydrogen Bonding in Human N-ras p21	9	X
434	Complete Resonance Assignment for the Polypeptide Backbone of Interleukin 1beta Using Three-Dimensional Heteronuclear NMR Spectroscopy	926	X
435	Complete Resonance Assignment for the Polypeptide Backbone of Interleukin 1beta Using Three-Dimensional Heteronuclear NMR Spectroscopy	901	X
436	Salt-Dependent Structure Change and Ion Binding in Cytochrome c Studied by Two-Dimensional Proton NMR	21	X
437	Salt-Dependent Structure Change and Ion Binding in Cytochrome c Studied by Two-Dimensional Proton NMR	21	X
438	Salt-Dependent Structure Change and Ion Binding in Cytochrome c Studied by Two-Dimensional Proton NMR	6	X
439	Salt-Dependent Structure Change and Ion Binding in Cytochrome c Studied by Two-Dimensional Proton NMR	6	X
440	Secondary structure of complement component C3a anaphylatoxin in solution as determined by NMR spectroscopy: Differences between crystal and solution conformations	382	X
441	NMR studies of the Escherichia coli trp aporepressor Sequence-specific assignment of the aromatic proton residues	2	X
442	NMR studies of the Escherichia coli trp aporepressor Sequence-specific assignment of the aromatic proton residues	47	X
443	Sequential 1H-NMR assignment and solution structure of bovine pancreatic ribonuclease A	664	X
444	Structure of the DNA binding wing of the gene-V encoded single-stranded DNA binding protein of the filamentous bacteriophage M13	110	X
447	Multinuclear Magnetic Resonance Studies of the 2Fe-2S, Ferredoxin from Anabaena Species Strain PCC 7120. 1. Sequence-Specific Hydrogen-1 Resonance Assignments and Secondary Structure in Solution of the Oxidized Form	999	X
448	Helix Formation and Stability in a Signal Sequence	168	X
449	Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy	2	X
450	Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy	1	X
451	Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy	1	X
452	Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy	1	X
453	Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy	2	X
454	Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy	2	X
455	Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy	2	X
456	Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy	2	X
457	Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy	2	X
458	Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy	2	X
459	Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy	2	X
460	Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy	2	X
461	Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy	2	X
462	Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy	2	X
463	Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy	2	X
464	Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy	2	X
465	Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy	2	X
466	Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy	2	X
467	Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy	2	X
468	Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy	1	X
469	Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy	1	X
470	Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy	2	X
471	Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy	2	X
472	Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy	2	X
473	Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy	2	X
474	Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy	2	X
475	Characterization of Selectively 13C-Labeled Synthetic Melittin and Melittin Analogues in Isotropic Solvents by Circular Dichroism, Fluorescence, and NMR Spectroscopy	2	X
476	1H NMR Sequential Assignments and Secondary Structure Analysis of Human Fibrinogen gamma-Chain C-Terminal Residues 385-411	195	X
477	1H NMR Sequential Assignments and Secondary Structure Analysis of Human Fibrinogen gamma-Chain C-Terminal Residues 385-411	76	X
478	Structural and Dynamic Differences between Normal and Transforming N-ras Gene Products: A 31P and Isotope-Edited 1H NMR Study	6	X
479	Structural and Dynamic Differences between Normal and Transforming N-ras Gene Products: A 31P and Isotope-Edited 1H NMR Study	4	X
480	A Proton Nuclear Magnetic Resonance Study of the Antihypertensive and Antiviral Protein BDS-I from the Sea Anemone Anemonia sulcata: Sequential and Stereospecific Resonance Assignment and Secondary Structure	269	X
481	A Proton Nuclear Magnetic Resonance Study of the Antihypertensive and Antiviral Protein BDS-I from the Sea Anemone Anemonia sulcata: Sequential and Stereospecific Resonance Assignment and Secondary Structure	268	X
485	15N Chemical Shifts of Backbone Amides in Bovine Pancreatic Trypsin Inhibitor and Apamin [Additions and Corrections to J. Am. Chem. Soc. 1989 111,7716-7722]	104	X
486	1H and 13C NMR Chemical Shifts of the Diastereotopic Methyl Groups of Valyl and Leucyl Residues in Peptides and Proteins	112	X
488	Structure-function relationships in the polypeptide cardiac stimulant, anthopleurin-A (Effects of limited proteolysis by trypsin)	45	X
489	Structure-function relationships in the polypeptide cardiac stimulant, anthopleurin-A (Effects of limited proteolysis by trypsin)	9	X
490	Thrombin-Bound Conformation of the C-Terminal Fragments of Hirudin Determined by Transferred Nuclear Overhauser Effects	94	X
491	Nuclear magnetic resonance studies of recombinant Escherichia coli glutaredoxin (Sequence-specific assignments and secondary structure determination of the oxidized form)	554	X
494	Two-Dimensional NMR Studies of Staphylococcal Nuclease. 1. Sequence-Specific Assignments of Hydrogen-1 Signals and Solution Structure of the Nuclease H124L-Thymidine 3',5'-Bisphosphate-Ca2+ Ternary Complex	120	X
495	Two-Dimensional NMR Studies of Staphylococcal Nuclease. 1. Sequence-Specific Assignments of Hydrogen-1 Signals and Solution Structure of the Nuclease H124L-Thymidine 3',5'-Bisphosphate-Ca2+ Ternary Complex	538	X
496	Two-Dimensional NMR Studies of Staphylococcal Nuclease. 2. Sequence-Specific Assignments of Carbon-13 and Nitrogen-15 Signals from the Nuclease H124L-Thymidine 3',5'-Bisphosphate-Ca2+ Ternary Complex	104	X
497	Two-Dimensional NMR Studies of Staphylococcal Nuclease. 2. Sequence-Specific Assignments of Carbon-13 and Nitrogen-15 Signals from the Nuclease H124L-Thymidine 3',5'-Bisphosphate-Ca2+ Ternary Complex	163	X
498	Characterization of pH-Dependent Conformational Heterogeneity in Rhodospirillum rubrum Cytochrome c2 Using 15N and 1H NMR	7	X
499	Proton hyperfine resonance assignments using the nuclear Overhauser effect for ferric forms of horse and tuna cytochrome c	11	X
500	Proton hyperfine resonance assignments using the nuclear Overhauser effect for ferric forms of horse and tuna cytochrome c	11	X
505	1H NOE Studies on Dicopper(II) Dicobalt(II)Superoxide Dismutase	17	X
506	1H NOE Studies on Dicopper(II) Dicobalt(II)Superoxide Dismutase	3	X
507	Assignment of the 13C-NMR Spectra of Virgin and Reactive-Site Modified Turkey Ovomucoid Third Domain	110	X
508	Assignment of the 13C-NMR Spectra of Virgin and Reactive-Site Modified Turkey Ovomucoid Third Domain	37	X
509	Conformational analysis of PKI(5-22)amide, the active inhibitory fragment of the inhibitor protein of the cyclic AMP-dependent protein kinase	51	X
510	Conformational analysis of PKI(5-22)amide, the active inhibitory fragment of the inhibitor protein of the cyclic AMP-dependent protein kinase	48	X
511	Conformational analysis of PKI(5-22)amide, the active inhibitory fragment of the inhibitor protein of the cyclic AMP-dependent protein kinase	42	X
512	Conformational analysis of PKI(5-22)amide, the active inhibitory fragment of the inhibitor protein of the cyclic AMP-dependent protein kinase	54	X
513	Conformational analysis of PKI(5-22)amide, the active inhibitory fragment of the inhibitor protein of the cyclic AMP-dependent protein kinase	46	X
514	Conformational analysis of PKI(5-22)amide, the active inhibitory fragment of the inhibitor protein of the cyclic AMP-dependent protein kinase	42	X
515	Conformational analysis of PKI(5-22)amide, the active inhibitory fragment of the inhibitor protein of the cyclic AMP-dependent protein kinase	41	X
516	Secondary Structure of the Human Growth Hormone Releasing Factor (GRF 1-29) by Two-Dimensional 1H-NMR Spectroscopy	58	X
517	Conformation of the Second Disulfide Loop in Human Transforming Growth Factor-alpha Studied by Two-Dimensional NMR Spectroscopy	115	X
530	Two-Dimensional NMR Studies of Staphylococcal Nuclease: Evidence for Conformational Heterogeneity from Hydrogen-1, Carbon-13, and Nitrogen-15 Spin System Assignments of the Aromatic Amino Acids in the Nuclease H124L-Thymidine 3',5'-Bisphosp	197	X
531	1H NMR Studies on Bovine Cyclophilin: Preliminary Structural Characterization of Its Complex with Cyclosporin A	10	X
532	1H NMR Studies on Bovine Cyclophilin: Preliminary Structural Characterization of Its Complex with Cyclosporin A	10	X
537	13C NMR Studies of the Binding of Soybean Trypsin Inhibitor to Trypsin	1	X
538	13C NMR Studies of the Binding of Soybean Trypsin Inhibitor to Trypsin	1	X
539	13C NMR Studies of the Binding of Soybean Trypsin Inhibitor to Trypsin	1	X
540	13C NMR Studies of the Binding of Soybean Trypsin Inhibitor to Trypsin	1	X
541	13C NMR Studies of the Binding of Soybean Trypsin Inhibitor to Trypsin	1	X
543	Nuclear-Magnetic-Resonance Studies of Eucaryotic Cytochrome c Assignment of Resonances of Aliphatic Amino Acids	24	X
544	Nuclear-Magnetic-Resonance Studies of Eucaryotic Cytochrome c Assignment of Resonances of Aliphatic Amino Acids	6	X
545	Nuclear-Magnetic-Resonance Studies of Eucaryotic Cytochrome c Assignment of Resonances of Aliphatic Amino Acids	28	X
546	Nuclear-Magnetic-Resonance Studies of Eucaryotic Cytochrome c Assignment of Resonances of Aliphatic Amino Acids	23	X
547	A Novel Approach for Sequential Assignment of 1H, 13C, and 15N Spectra of Larger Proteins: Heteronuclear Triple-Resonance Three-Dimensional NMR Spectroscopy. Application to Calmodulin	746	X
548	Sequence-Specific 1H NMR Assignment and Secondary Structure of Neuropeptide Y in Aqueous Solution	274	X
554	Complete Sequence-Specific 1H NMR Assignments for Human Insulin	141	X
555	Complete Sequence-Specific 1H NMR Assignments for Human Insulin	222	X
556	Two-Dimensional NMR and Photo-CIDNP Studies of the Insulin Monomer: Assignment of Aromatic Resonances with Application to Protein Folding, Structure, and Dynamics	8	X
557	Two-Dimensional NMR and Photo-CIDNP Studies of the Insulin Monomer: Assignment of Aromatic Resonances with Application to Protein Folding, Structure, and Dynamics	26	X
558	Soybean Trypsin Inhibitor (Kunitz) and Its Complex with Trypsin. Carbon-13 Nuclear Magnetic Resonance Studies of the Reactive Site Arginine	1	X
559	Soybean Trypsin Inhibitor (Kunitz) and Its Complex with Trypsin. Carbon-13 Nuclear Magnetic Resonance Studies of the Reactive Site Arginine	1	X
560	Soybean Trypsin Inhibitor (Kunitz) and Its Complex with Trypsin. Carbon-13 Nuclear Magnetic Resonance Studies of the Reactive Site Arginine	1	X
561	Soybean Trypsin Inhibitor (Kunitz) and Its Complex with Trypsin. Carbon-13 Nuclear Magnetic Resonance Studies of the Reactive Site Arginine	1	X
562	Soybean Trypsin Inhibitor (Kunitz) and Its Complex with Trypsin. Carbon-13 Nuclear Magnetic Resonance Studies of the Reactive Site Arginine	1	X
563	Soybean Trypsin Inhibitor (Kunitz) and Its Complex with Trypsin. Carbon-13 Nuclear Magnetic Resonance Studies of the Reactive Site Arginine	1	X
568	Applications of Natural-Abundance Carbon-13 NMR to Studies of Proteins and Glycoproteins	20	X
569	A Structural Study of the Hydrophobic Box Region of Lysozyme in Solution Using Nuclear Overhauser Effects	120	X
573	GAL4 transcription factor is not a "zinc finger" but forms a Zn(II)2Cys6 binuclear cluster	6	X
595	1H Nuclear-Magnetic-Resonance Studies of the Conformation of Cardiotoxin VII2 from Naja mossambica mossambica	30	X
596	1H Nuclear-Magnetic-Resonance Studies of the Conformation of Cardiotoxin VII2 from Naja mossambica mossambica	11	X
597	1H Nuclear-Magnetic-Resonance Studies of the Conformation of Cardiotoxin VII2 from Naja mossambica mossambica	3	X
598	1H Nuclear-Magnetic-Resonance Studies of the Conformation of Cardiotoxin VII2 from Naja mossambica mossambica	3	X
599	1H Nuclear-Magnetic-Resonance Studies of the Conformation of Cardiotoxin VII2 from Naja mossambica mossambica	3	X
600	1H Nuclear-Magnetic-Resonance Studies of the Conformation of Cardiotoxin VII2 from Naja mossambica mossambica	4	X
606	Melittin Bound to Dodecylphosphocholine Micelles 1H-NMR Assignments and Global Conformational Features	46	X
611	A Proton-Magnetic-Resonance Study on the Molecular Conformation and Structure-Function Relationship of a Long Neurotoxin, Laticauda Semifasciata III from Laticauda semifasciata	27	X
613	The 1H Nuclear-Magnetic-Resonance Spectra and Spatial Structure of the Naja mossambica mossambica Neurotoxin III	46	X
614	The 1H Nuclear-Magnetic-Resonance Spectra and Spatial Structure of the Naja mossambica mossambica Neurotoxin III	1	X
623	Conformation of a Heptadecapeptide Comprising the Segment Encephalitogenic in Rhesus Monkeys	111	X
630	The Stability of Ferricytochrome c Temperature Dependence of Its NMR Spectrum	27	X
644	Proline Assignments and Identification of the Cis K116/P117 Peptide Bond in Liganded Staphylococcal Nuclease Using Isotope Edited 2D NMR Spectroscopy	54	X
645	N.m.r. and e.p.r. characterization of [4-carboxy-2,6-dinitrophenyllysine]cytochromes c	6	X
653	Assignment of tyrosine resonances in the 1H-NMR spectrum of tryptophan synthase alpha-subunit Monitoring conformational changes due to substitutions at position 49	28	X
660	Secondary and tertiary structure characteristics of Megasphaera elsdenii flavodoxin in the reduced state as determined by two-dimensional 1H NMR	79	X
661	A Folded Structure for the Lac-Repressor Headpiece	25	X
662	High-Resolution 13C-NMR Study of the Topography and Dynamics of Methionine Residues in Detergent-Solubilized Bacteriorhodopsin	1	X
664	Solution Structure of Mitochondrial Cytochrome c I. H1 Nuclear Magnetic Resonance of Ferricytochrome c	171	X
665	Solution Structure of Mitochondrial Cytochrome c I. H1 Nuclear Magnetic Resonance of Ferricytochrome c	159	X
666	Solution Structure of Mitochondrial Cytochrome c I. H1 Nuclear Magnetic Resonance of Ferricytochrome c	144	X
667	Solution Structure of Mitochondrial Cytochrome c I. H1 Nuclear Magnetic Resonance of Ferricytochrome c	36	X
668	Solution Structure of Mitochondrial Cytochrome c I. H1 Nuclear Magnetic Resonance of Ferricytochrome c	28	X
672	Cobalt-Cytochrome c. II. Magnetic Resonance Spectra and Conformational Transitions	14	X
673	Cobalt-Cytochrome c. II. Magnetic Resonance Spectra and Conformational Transitions	14	X
674	Physicochemical Characterization of Glucagon-Containing Lipid Micelles	65	X
676	1H NMR Study of Rabbit Skeletal Muscle Troponin C: Mg2+-Induced Conformational Change	21	X
677	1H NMR Study of Rabbit Skeletal Muscle Troponin C: Mg2+-Induced Conformational Change	114	X
682	Solution structure of the isolated ribonuclease C-terminal 112-124 fragment	85	X
695	Proton NMR studies of apo-neocarzinostatin from Streptomyces carzinostaticus Sequence-specific assignment and secondary structure	660	X
699	Sequential Resonance Assignments as a Basis for the Determination of a Three-dimensional Structure of Protein E-L30 of Escherichia coli	272	X
700	Proton Nuclear Magnetic Resonance Studies of Intact Native Bovine Parathyroid Hormone	5	X
704	Two-Dimensional 1H NMR of Gene 5 Protein Indicates That Only Two Aromatic Rings Interact Significantly with Oligodeoxynucleotide Bases	28	X
705	Two-Dimensional 1H NMR of Gene 5 Protein Indicates That Only Two Aromatic Rings Interact Significantly with Oligodeoxynucleotide Bases	23	X
706	Two-Dimensional 1H NMR of Gene 5 Protein Indicates That Only Two Aromatic Rings Interact Significantly with Oligodeoxynucleotide Bases	24	X
707	Two-Dimensional 1H NMR of Gene 5 Protein Indicates That Only Two Aromatic Rings Interact Significantly with Oligodeoxynucleotide Bases	24	X
736	Complex of lac Repressor Headpiece with a 14 Base-pair lac Operator Fragment Studied by Two-dimensional Nuclear Magnetic Resonance	7	X
749	Nuclear Magnetic Resonance Study on Rabbit Skeletal Troponin C: Calcium-Induced Conformational Change	10	X
750	Nuclear Magnetic Resonance Study on Rabbit Skeletal Troponin C: Calcium-Induced Conformational Change	83	X
753	1H NMR Resonance Assignments, Secondary Structure, and Global Fold of Apo Bovine Calbindin D9k	1	X
754	Sequence-Specific 1H NMR Assignments and Secondary Structure of Porcine Motilin	178	X
758	NMR Comparison of Prokaryotic and Eukaryotic Cytochromes c	104	X
759	NMR Comparison of Prokaryotic and Eukaryotic Cytochromes c	479	X
760	NMR Comparison of Prokaryotic and Eukaryotic Cytochromes c	6	X
761	NMR Comparison of Prokaryotic and Eukaryotic Cytochromes c	4	X
779	A 1H-NMR Study of the Solution Conformation of Icaria chemotactic peptide and its [Lys7] analog: Effects on the physiological activity of a substitution of proline to lysine at position 7	106	X
780	Sequence-specific [1H]NMR resonance assignments and secondary structure identification for 1- and 2-zinc finger constructs from SWI5 A hydrophobic core involving four invariant residues	238	X
781	Sequence-specific [1H]NMR resonance assignments and secondary structure identification for 1- and 2-zinc finger constructs from SWI5 A hydrophobic core involving four invariant residues	3	X
791	Proton NMR Detection of Long-Range Heteronuclear Multiquantum Coherences in Proteins: The Complete Assignment of the Quaternary Aromatic 13C Shifts in Lysozyme	87	X
810	Computer-aided assignment of the 1H-NMR spectrum of the viral-protein-genome-linked polypeptide from cowpea mosaic virus	203	X
811	Investigation of Copper-Zinc Superoxide Dismutase Ser-137 and Ala-137 Mutants	16	X
812	Investigation of Copper-Zinc Superoxide Dismutase Ser-137 and Ala-137 Mutants	16	X
813	Investigation of Copper-Zinc Superoxide Dismutase Ser-137 and Ala-137 Mutants	16	X
814	Investigation of Copper-Zinc Superoxide Dismutase Ser-137 and Ala-137 Mutants	15	X
821	Identification of Localized Redox States in Plant-Type Two-Iron Ferredoxins Using the Nuclear Overhauser Effect	11	X
822	Identification of Localized Redox States in Plant-Type Two-Iron Ferredoxins Using the Nuclear Overhauser Effect	9	X
823	Assignment of heme and distal amino acid resonances in the 1H-NMR spectra of the carbon monoxide and oxygen complexes of sperm whale myoglobin	15	X
824	Assignment of heme and distal amino acid resonances in the 1H-NMR spectra of the carbon monoxide and oxygen complexes of sperm whale myoglobin	7	X
846	Hydrogen-1 Nuclear Magnetic Resonance Investigation of Bovine Cardiac Troponin C. Comparison of Tyrosyl Assignments and Calcium-Induced Structural Changes to Those of Two Homologous Proteins, Rabbit Skeletal Troponin C and Bovine Brain Calm	8	X
848	High-Resolution Nuclear Magnetic Resonance Studies of the Lac Repressor. 1. Assignments of Tyrosine Resonances in the N-Terminal Headpiece	16	X
849	High-Resolution Nuclear Magnetic Resonance Studies of the Lac Repressor. 2. Partial Analysis of the Aliphatic Region of the Lac Repressor Headpiece Spectrum	22	X
862	Hydrogen-1 Nuclear Magnetic Resonance Investigation of Bovine Cardiac Troponin C. Comparison of Tyrosyl Assignments and Calcium-Induced Structural Changes to Those of Two Homologous Proteins, Rabbit Skeletal Troponin C and Bovine Brain Calm	12	X
877	Carbon-13 Nuclear-Magnetic-Resonance Spectroscopy of Whole Cells and of Cytochrome c from Neurospora crassa Grown with [S-Me-13C]Methionine	1	X
878	Carbon-13 Nuclear-Magnetic-Resonance Spectroscopy of Whole Cells and of Cytochrome c from Neurospora crassa Grown with [S-Me-13C]Methionine	2	X
883	1H Nuclear Magnetic Resonance Study of the Histidine Residues of Insulin	2	X
884	1H Nuclear Magnetic Resonance Study of the Histidine Residues of Insulin	2	X
887	pH-Induced Denaturation of Proteins: A Single Salt Bridge Contributes 3-5 kcal/mol to the Free Energy of Folding of T4 Lysozyme	1	X
888	pH-Induced Denaturation of Proteins: A Single Salt Bridge Contributes 3-5 kcal/mol to the Free Energy of Folding of T4 Lysozyme	1	X
893	Proton Magnetic Resonance Spectra of Porcine Muscle Adenylate Kinase and Substrate Complexes	1	X
907	Studies of Individual Carbon Sites of Hemoglobins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy	1	X
908	Studies of Individual Carbon Sites of Hemoglobins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy	2	X
909	Studies of Individual Carbon Sites of Hemoglobins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy	1	X
910	Studies of Individual Carbon Sites of Hemoglobins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy	4	X
911	Studies of Individual Carbon Sites of Hemoglobins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy	4	X
912	Studies of Individual Carbon Sites of Hemoglobins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy	1	X
913	Studies of Individual Carbon Sites of Hemoglobins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy	1	X
914	Studies of Individual Carbon Sites of Hemoglobins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy	1	X
915	Assignment of the Backbone 1H and 15N NMR Resonances of Bacteriophage T4 Lysozyme	885	X
916	Sequence-Specific 1H NMR Assignments and Secondary Structure in Solution of Escherichia coli trp Repressor	411	X
918	Mechanism of Adenylate Kinase. Structural and Functional Demonstration of Arginine-138 as a Key Catalytic Residue That Cannot Be Replaced by Lysine	4	X
919	Mechanism of Adenylate Kinase. Structural and Functional Demonstration of Arginine-138 as a Key Catalytic Residue That Cannot Be Replaced by Lysine	4	X
920	Mechanism of Adenylate Kinase. Structural and Functional Demonstration of Arginine-138 as a Key Catalytic Residue That Cannot Be Replaced by Lysine	4	X
922	Assignment of Proton Resonances, Identification of Secondary Structural Elements, and Analysis of Backbone Chemical Shifts for the C102T Variant of Yeast Iso-1-cytochrome c and Horse Cytochrome c	610	X
923	Assignment of Proton Resonances, Identification of Secondary Structural Elements, and Analysis of Backbone Chemical Shifts for the C102T Variant of Yeast Iso-1-cytochrome c and Horse Cytochrome c	594	X
932	Sequence-Specific 1H NMR Resonance Assignments of Bacillus subtilis HPr: Use of Spectra Obtained from Mutants To Resolve Spectral Overlap	550	X
934	A Proton Nuclear Magnetic Resonance and Molecular Modeling Study of Cardiac Troponin C Calcium Dependence and Aromatic Spectral Assignments	74	X
936	Two-dimensional NMR studies on des-pentapeptide-insulin Proton resonance assignments and secondary structure analysis	139	X
937	Two-dimensional NMR studies on des-pentapeptide-insulin Proton resonance assignments and secondary structure analysis	178	X
939	Comparative Structural Analysis of the Calcium Free and Bound States of the Calcium Regulatory Protein Calbindin D9K	25	X
940	Comparative Structural Analysis of the Calcium Free and Bound States of the Calcium Regulatory Protein Calbindin D9K	25	X
944	Nuclear Magnetic Resonances Study of Exchangeable Protons in Ferrocytochrome c	4	X
945	Nuclear Magnetic Resonances Study of Exchangeable Protons in Ferrocytochrome c	3	X
946	Cytochrome c. Observation of Numerous Single-Carbon Sites of the Reduced and Oxidized Species by Means of Natural-Abundance 13C Nuclear Magnetic Resonance Spectroscopy	3	X
947	Cytochrome c. Observation of Numerous Single-Carbon Sites of the Reduced and Oxidized Species by Means of Natural-Abundance 13C Nuclear Magnetic Resonance Spectroscopy	2	X
948	Assignment of aromatic amino acid pmr resonances of horse ferricytochrome c	12	X
949	Assignment of aromatic amino acid pmr resonances of horse ferricytochrome c	10	X
956	Pulsed NMR Study of the Structure of Cytochrome c	7	X
957	Pulsed NMR Study of the Structure of Cytochrome c	5	X
960	High Resolution Nuclear Magnetic Resonance Studies of the Active Site of Chymotrypsin II. Polarization of Histidine 57 by Substrate Analogues and Competitive Inhibitors	1	X
961	High Resolution Nuclear Magnetic Resonance Studies of the Active Site of Chymotrypsin II. Polarization of Histidine 57 by Substrate Analogues and Competitive Inhibitors	1	X
962	High Resolution Nuclear Magnetic Resonance Studies of the Active Site of Chymotrypsin II. Polarization of Histidine 57 by Substrate Analogues and Competitive Inhibitors	1	X
963	High Resolution Nuclear Magnetic Resonance Studies of the Active Site of Chymotrypsin II. Polarization of Histidine 57 by Substrate Analogues and Competitive Inhibitors	1	X
964	High Resolution Nuclear Magnetic Resonance Studies of the Active Site of Chymotrypsin II. Polarization of Histidine 57 by Substrate Analogues and Competitive Inhibitors	1	X
965	High Resolution Nuclear Magnetic Resonance Studies of the Active Site of Chymotrypsin II. Polarization of Histidine 57 by Substrate Analogues and Competitive Inhibitors	1	X
966	High Resolution Nuclear Magnetic Resonance Studies of the Active Site of Chymotrypsin II. Polarization of Histidine 57 by Substrate Analogues and Competitive Inhibitors	1	X
967	High Resolution Nuclear Magnetic Resonance Studies of the Active Site of Chymotrypsin II. Polarization of Histidine 57 by Substrate Analogues and Competitive Inhibitors	1	X
968	15N NMR Spectroscopy of Pseudomonas Cytochrome c-551	169	X
969	15N NMR Spectroscopy of Pseudomonas Cytochrome c-551	112	X
970	15N NMR Spectroscopy of Pseudomonas Cytochrome c-551	158	X
971	15N NMR Spectroscopy of Pseudomonas Cytochrome c-551	150	X
975	Sequential Assignment of the 1H Nuclear Magnetic Resonance Spectrum of Barnase	616	X
979	Sequence Specific 1H NMR Assignments and Determination of the Secondary Structure for the Activation Domain Isolated from Pancreatic Procarboxypeptidase B	570	X
994	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	8	X
995	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	27	X
996	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	8	X
997	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	27	X
998	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	8	X
999	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	27	X
1000	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	8	X
1001	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	27	X
1002	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	8	X
1003	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	27	X
1004	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	8	X
1005	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	27	X
1006	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	8	X
1007	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	27	X
1008	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	8	X
1009	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	27	X
1010	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	8	X
1011	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	27	X
1012	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	8	X
1013	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	27	X
1014	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	8	X
1015	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	27	X
1016	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	8	X
1017	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	19	X
1018	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	8	X
1019	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	15	X
1020	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	8	X
1021	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	20	X
1022	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	8	X
1023	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	11	X
1024	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	4	X
1025	Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin	26	X
1027	1H NMR Study of the Role of Individual Heme Propionates in Modulating Structural and Dynamic Properties of the Heme Pocket in Myoglobin	11	X
1028	1H NMR Study of the Role of Individual Heme Propionates in Modulating Structural and Dynamic Properties of the Heme Pocket in Myoglobin	11	X
1029	1H NMR Study of the Role of Individual Heme Propionates in Modulating Structural and Dynamic Properties of the Heme Pocket in Myoglobin	11	X
1030	1H NMR Study of the Role of Individual Heme Propionates in Modulating Structural and Dynamic Properties of the Heme Pocket in Myoglobin	11	X
1031	1H NMR Study of the Role of Individual Heme Propionates in Modulating Structural and Dynamic Properties of the Heme Pocket in Myoglobin	9	X
1032	1H NMR Study of the Role of Individual Heme Propionates in Modulating Structural and Dynamic Properties of the Heme Pocket in Myoglobin	9	X
1033	1H NMR Study of the Role of Individual Heme Propionates in Modulating Structural and Dynamic Properties of the Heme Pocket in Myoglobin	9	X
1037	Determination of the Three-dimensional Structure of the Antennapedia Homeodomain from Drosophila in Solution by 1H Nuclear Magnetic Resonance Spectroscopy	569	X
1039	Complete Tyrosine Assignments in the High Field 1H Nuclear Magnetic Resonance Spectrum of the Bovine Pancreatic Trypsin Inhibitor	2	X
1042	NMR Studies of Nickle(II)-Substituted Derivatives of Bovine Copper-Zinc Superoxide Dismutase with Nickle(II) Bound in the Copper Site	1	X
1043	NMR Studies of Nickle(II)-Substituted Derivatives of Bovine Copper-Zinc Superoxide Dismutase with Nickle(II) Bound in the Copper Site	1	X
1044	NMR Studies of Nickle(II)-Substituted Derivatives of Bovine Copper-Zinc Superoxide Dismutase with Nickle(II) Bound in the Copper Site	1	X
1045	NMR Studies of Nickle(II)-Substituted Derivatives of Bovine Copper-Zinc Superoxide Dismutase with Nickle(II) Bound in the Copper Site	1	X
1046	Solution conformation of endothelin-3 by 1H NMR and distance geometry calculations	152	X
1049	Solution Structure of Neurotoxin I from the Sea Anemone Stichodactyla helianthus	6	X
1053	Direct measurement of the pK Values of an Alkaline Bohr Group in Human Hemoglobin	1	X
1056	NMR Studies of Nickle(II)-Substituted Derivatives of Bovine Copper-Zinc Superoxide Dismutase with Nickle(II) Bound in the Copper Site	1	X
1058	Proton Magnetic Resonance Studies of Horse Cytochrome c	5	X
1061	Assignment of the Side-Chain 1H and 13C Resonances of Interleukin-1beta Using Double- and Triple-Resonance Heteronuclear Three-Dimensional NMR Spectroscopy	1431	X
1062	Assignment of the Side-Chain 1H and 13C Resonances of Interleukin-1beta Using Double- and Triple-Resonance Heteronuclear Three-Dimensional NMR Spectroscopy	1425	X
1065	Solution Conformation of Thymosin beta4: A Nuclear Magnetic Resonance and Simulated Annealing Study	242	X
1066	High-Resolution Nuclear Magnetic Resonance Studies of the Lac Repressor. 2. Partial Analysis of the Aliphatic Region of the Lac Repressor Headpiece Spectrum	33	X
1071	1H NMR Assignment and Secondary Structure of the Ca+2-Free Form of the Amino-Terminal Epidermal Growth Factor like Domain in Coagulation Factor X	240	X
1072	Nonnative Isomers of Proline-93 and -114 Predominate in Heat-Unfolded Ribonuclease A	18	X
1093	Sequential 1H NMR Assignments and Secondary Structure of Hen Egg White Lysozyme in Solution	687	X
1095	Two-dimensional NMR as a probe of structural similarity applied to mutants of cytochrome c	23	X
1096	The Influence of a Single Salt Bridge on Static and Dynamic Features of the Globular Solution Conformation of the Basic Pancreatic Trypsin Inhibitor 1H and 13C Nuclear-Magnetic-Resonance Studies of the Native and the Transaminated Inhibitor	3	X
1097	The Influence of a Single Salt Bridge on Static and Dynamic Features of the Globular Solution Conformation of the Basic Pancreatic Trypsin Inhibitor 1H and 13C Nuclear-Magnetic-Resonance Studies of the Native and the Transaminated Inhibitor	3	X
1098	The Influence of a Single Salt Bridge on Static and Dynamic Features of the Globular Solution Conformation of the Basic Pancreatic Trypsin Inhibitor 1H and 13C Nuclear-Magnetic-Resonance Studies of the Native and the Transaminated Inhibitor	3	X
1099	Proton Nuclear Magnetic Resonance Study of the Molecular and Electronic Structure of the Heme Cavity in Aplysia Cyanometmyoglobin	1	X
1100	Proton Nuclear Magnetic Resonance Study of the Molecular and Electronic Structure of the Heme Cavity in Aplysia Cyanometmyoglobin	2	X
1101	Resonance assignments in the proton-NMR spectrum of carbonmonoxy hemoglobin by two-dimensional methods	69	X
1102	Resonance assignments in the proton-NMR spectrum of carbonmonoxy hemoglobin by two-dimensional methods	41	X
1104	Studies of Individual Carbon Sites of Proteins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy	3	X
1105	Studies of Individual Carbon Sites of Proteins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy	3	X
1107	Studies of Individual Carbon Sites of Proteins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy	6	X
1108	Studies of Individual Carbon Sites of Proteins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy	1	X
1109	Studies of Individual Carbon Sites of Proteins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy	6	X
1110	Studies of Individual Carbon Sites of Proteins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy	4	X
1111	Studies of Individual Carbon Sites of Proteins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy	4	X
1112	Studies of Individual Carbon Sites of Proteins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy	5	X
1113	Studies of Individual Carbon Sites of Proteins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy	5	X
1114	Studies of Individual Carbon Sites of Proteins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy	5	X
1115	Studies of Individual Carbon Sites of Proteins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy	4	X
1116	Studies of Individual Carbon Sites of Proteins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy	4	X
1117	Studies of Individual Carbon Sites of Proteins in Solution by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy	1	X
1120	Sequential 1H NMR Assignments and Secondary Structure of the B Domain of Staphylococcal Protein A: Structural Changes between the Free B Domain in Solution and the Fc-Bound B Domain in Crystal	432	X
1127	Static and Transient Hydrogen-Bonding Interactions in Recombinant Desulfatohirudin Studied by 1H Nuclear Magnetic Resonance Measurements of Amide Proton Exchange Rates and pH-Dependent Chemical Shifts	23	X
1128	Conformation of Recombinant Desulfatohirudin in Aqueous Solution Determined by Nuclear Magnetic Resonance	412	X
1129	Conformation of Recombinant Desulfatohirudin in Aqueous Solution Determined by Nuclear Magnetic Resonance	148	X
1133	The Downfield Resonances in the 1H NMR Spectra of Azotobacter vinelandii and Pseudomonas putida Seven-iron Ferredoxins	4	X
1134	The Downfield Resonances in the 1H NMR Spectra of Azotobacter vinelandii and Pseudomonas putida Seven-iron Ferredoxins	4	X
1135	Antimicrobial Peptide, Tachyplesin I, Isolated from Hemocytes of the Horseshoe Crab (Tachypleus tridentatus)	119	X
1136	15N nuclear magnetic resonance studies of the B domain of Staphylococcal protein A: Sequence specific assignments of the imide 15N resonances of the proline residues and the interaction with human immunoglobin G	3	X
1137	Conformational Requirement of Signal Sequences Functioning in Yeast: Circular Dichroism and 1H Nuclear Magnetic Resonance Studies of Synthetic Peptides	123	X
1138	Conformational Requirement of Signal Sequences Functioning in Yeast: Circular Dichroism and 1H Nuclear Magnetic Resonance Studies of Synthetic Peptides	120	X
1139	Conformational Requirement of Signal Sequences Functioning in Yeast: Circular Dichroism and 1H Nuclear Magnetic Resonance Studies of Synthetic Peptides	131	X
1140	Conformational Requirement of Signal Sequences Functioning in Yeast: Circular Dichroism and 1H Nuclear Magnetic Resonance Studies of Synthetic Peptides	155	X
1144	NMR studies of the conformations of leghemoglobins from soybean and lupin	143	X
1145	NMR studies of the conformations of leghemoglobins from soybean and lupin	115	X
1147	Structure and Heme Environment of Ferrocytochrome c553 from 1H NMR Studies	12	X
1148	Structure and Heme Environment of Ferrocytochrome c553 from 1H NMR Studies	7	X
1149	Structure and Heme Environment of Ferrocytochrome c553 from 1H NMR Studies	8	X
1150	Structure and Heme Environment of Ferrocytochrome c553 from 1H NMR Studies	4	X
1151	Structure-function relationships in the polypeptide cardiac stimulant, anthopleurin-A (Effects of limited proteolysis by trypsin)	15	X
1152	Conformational Change of Adrenodoxin Induced by Reduction of Iron-Sulfur Cluster	55	X
1153	Conformational Change of Adrenodoxin Induced by Reduction of Iron-Sulfur Cluster	51	X
1154	Three-dimensional Structure of Human (113Cd7)Metallothionein-2 in Solution Determined by Nuclear Magnetic Resonance Spectroscopy	58	X
1155	Three-dimensional Structure of Human (113Cd7)Metallothionein-2 in Solution Determined by Nuclear Magnetic Resonance Spectroscopy	256	X
1156	Protein Structures in Solution by Nuclear Magnetic Resonance and Distance Geometry (The Polypeptide Fold of the Basic Pancreatic Trypsin Inhibitor Determined using Two Different Algorithms, DISGEO and DISMAN)	4	X
1158	Nuclear Magnetic Resonance Investigation of the Interactions with Phospholipid of an Amphipathic alpha-Helix-forming Peptide of the Apolipoprotein Class	1	X
1159	Nuclear Magnetic Resonance Investigation of the Interactions with Phospholipid of an Amphipathic alpha-Helix-forming Peptide of the Apolipoprotein Class	1	X
1160	Nuclear Magnetic Resonance Investigation of the Interactions with Phospholipid of an Amphipathic alpha-Helix-forming Peptide of the Apolipoprotein Class	1	X
1161	Nuclear Magnetic Resonance Investigation of the Interactions with Phospholipid of an Amphipathic alpha-Helix-forming Peptide of the Apolipoprotein Class	1	X
1162	Sequence-specific 1H-NMR assignment and conformation of proteolytic fragment 163-231 of bacterioopsin	440	X
1163	The 1H-NMR assignments of the aromatic resonances in complexes of Lactobacillus casei dihydrofolate reductase and the origins of their chemical shifts	71	X
1164	The 1H-NMR assignments of the aromatic resonances in complexes of Lactobacillus casei dihydrofolate reductase and the origins of their chemical shifts	72	X
1165	The 1H-NMR assignments of the aromatic resonances in complexes of Lactobacillus casei dihydrofolate reductase and the origins of their chemical shifts	71	X
1166	The 1H-NMR assignments of the aromatic resonances in complexes of Lactobacillus casei dihydrofolate reductase and the origins of their chemical shifts	56	X
1167	The 1H-NMR assignments of the aromatic resonances in complexes of Lactobacillus casei dihydrofolate reductase and the origins of their chemical shifts	70	X
1168	The 1H-NMR assignments of the aromatic resonances in complexes of Lactobacillus casei dihydrofolate reductase and the origins of their chemical shifts	70	X
1170	Assignment of Proton Resonances, Identification of Secondary Structural Elements, and Analysis of Backbone Chemical Shifts for the C102T Variant of Yeast Iso-1-cytochrome c and Horse Cytochrome c	591	X
1171	Assignment of Proton Resonances, Identification of Secondary Structural Elements, and Analysis of Backbone Chemical Shifts for the C102T Variant of Yeast Iso-1-cytochrome c and Horse Cytochrome c	594	X
1174	NMR analysis of site-specific mutants of yeast phosphoglycerate kinase An investigation of the triose-binding site	3	X
1175	NMR analysis of site-specific mutants of yeast phosphoglycerate kinase An investigation of the triose-binding site	2	X
1176	NMR analysis of site-specific mutants of yeast phosphoglycerate kinase An investigation of the triose-binding site	3	X
1177	NMR analysis of site-specific mutants of yeast phosphoglycerate kinase An investigation of the triose-binding site	3	X
1178	Helix Formation and Stability in a Signal Sequence	23	X
1179	Sequential Resonance Assignments in Protein 1H Nuclear Magnetic Resonance Spectra (Basic Pancreatic Trypsin Inhibitor)	2	X
1181	Coupling of Tertiary and Quaternary Changes in Human Hemoglobin: A 1D and 2D NMR Study of Hemoglobin Saint Mande (betaN102Y)	87	X
1182	Coupling of Tertiary and Quaternary Changes in Human Hemoglobin: A 1D and 2D NMR Study of Hemoglobin Saint Mande (betaN102Y)	79	X
1183	Coupling of Tertiary and Quaternary Changes in Human Hemoglobin: A 1D and 2D NMR Study of Hemoglobin Saint Mande (betaN102Y)	58	X
1184	Coupling of Tertiary and Quaternary Changes in Human Hemoglobin: A 1D and 2D NMR Study of Hemoglobin Saint Mande (betaN102Y)	45	X
1192	One- and two-dimensional proton NMR studies of cys-102 S-methylated yeast isozyme-1 ferricytochrome c	24	X
1194	One- and two-dimensional proton NMR studies of cys-102 S-methylated yeast isozyme-1 ferricytochrome c	25	X
1198	Three-Dimensional Structure of an alpha-Amylase Inhibitor HAIM as Determined by Nuclear Magnetic Resonance Methods	465	X
1200	Nuclear-magnetic-resonance investigations of the biliverdin-apomyoglobin complex	34	X
1201	Conformation in solution of porcine brain natriuretic peptide determined by combined use of nuclear magnetic resonance and distance geometry	171	X
1202	Characterization of Hydrophobic Cores in Apomyoglobin: A Proton NMR Spectroscopy Study	89	X
1203	Structural Features of the Protoporphyrin-Apomyoglobin Complex: A Proton NMR Spectroscopy Study	179	X
1204	Structural Features of the Protoporphyrin-Apomyoglobin Complex: A Proton NMR Spectroscopy Study	172	X
1205	Structural Features of the Protoporphyrin-Apomyoglobin Complex: A Proton NMR Spectroscopy Study	152	X
1206	Three-Dimensional Structure of the Neurotoxin ATX Ia From Anemonia sulcata in Aqueous Solution Determined by Nuclear Magnetic Resonance Spectroscopy	24	X
1207	An analysis of pseudocontact shifts and their relationship to structural features of the redox states of cytochrome b5	323	X
1208	An analysis of pseudocontact shifts and their relationship to structural features of the redox states of cytochrome b5	324	X
1209	1H nuclear magnetic resonance study of the solution conformation of an antibacterial protein, sapecin	243	X
1210	Purification and characterization of a non-reconstitutable azurin, obtained by heterologous expression of the Pseudomonas aeruginosa azu gene in Escherichia coli	17	X
1211	Purification and characterization of a non-reconstitutable azurin, obtained by heterologous expression of the Pseudomonas aeruginosa azu gene in Escherichia coli	17	X
1212	Purification and characterization of a non-reconstitutable azurin, obtained by heterologous expression of the Pseudomonas aeruginosa azu gene in Escherichia coli	16	X
1213	Purification and characterization of a non-reconstitutable azurin, obtained by heterologous expression of the Pseudomonas aeruginosa azu gene in Escherichia coli	14	X
1214	Purification and characterization of a non-reconstitutable azurin, obtained by heterologous expression of the Pseudomonas aeruginosa azu gene in Escherichia coli	15	X
1215	Purification and characterization of a non-reconstitutable azurin, obtained by heterologous expression of the Pseudomonas aeruginosa azu gene in Escherichia coli	15	X
1216	Purification and characterization of a non-reconstitutable azurin, obtained by heterologous expression of the Pseudomonas aeruginosa azu gene in Escherichia coli	16	X
1217	Purification and characterization of a non-reconstitutable azurin, obtained by heterologous expression of the Pseudomonas aeruginosa azu gene in Escherichia coli	16	X
1218	Purification and characterization of a non-reconstitutable azurin, obtained by heterologous expression of the Pseudomonas aeruginosa azu gene in Escherichia coli	1	X
1219	Purification and characterization of a non-reconstitutable azurin, obtained by heterologous expression of the Pseudomonas aeruginosa azu gene in Escherichia coli	1	X
1220	High Mobility of N-Terminal Parts of A and B Subunits of Ricin	6	X
1221	High Mobility of N-Terminal Parts of A and B Subunits of Ricin	5	X
1222	Laser Photochemically Induced Dynamic Nuclear Polarization Proton Nuclear Magnetic Resonance Studies on Three Homologous Calcium Binding Proteins: Cardiac Troponin-C, Skeletal Troponin-C, and Calmodulin	6	X
1225	Ca2+ and Mg2+ Dependent Conformations of Troponin C as Determined by 1H and 19F Nuclear Magnetic Resonance	4	X
1226	Ca2+ and Mg2+ Dependent Conformations of Troponin C as Determined by 1H and 19F Nuclear Magnetic Resonance	4	X
1227	Nuclear Magnetic Resonance Studied of a Ca2+-Binding Fragment of Troponin C.	6	X
1228	Nuclear Magnetic Resonance Studied of a Ca2+-Binding Fragment of Troponin C.	4	X
1230	Partial 1H NMR Assignments of the Escherichia coli Dihydrofolate Reductase Complex with Folate: Evidence for a Unique Conformation of Bound Folate	242	X
1323	Investigation of the solution structures and mobility of oxidised and reduced cytochrome b5 by 2D NMR spectroscopy	62	X
1324	Investigation of the solution structures and mobility of oxidised and reduced cytochrome b5 by 2D NMR spectroscopy	58	X
1333	Sequential 1H NMR Assignments of Iron(II) Cytochrome c551 from Pseudomonas aeruginosa	482	X
1334	Sequential 1H NMR Assignments of Iron(II) Cytochrome c551 from Pseudomonas aeruginosa	2	X
1336	High-Resolution Three-Dimensional Structure of a Single Zinc Finger from a Human Enhancer Binding Protein Solution	211	X
1337	High-Resolution Three-Dimensional Structure of a Single Zinc Finger from a Human Enhancer Binding Protein Solution	2	X
1338	Interaction Mechanism between Microtubule-Associated Proteins and Microtubules. A Proton Nuclear Resonance Analysis on the Binding of Synthetic Peptide to Tubulin	146	X
1339	Interaction Mechanism between Microtubule-Associated Proteins and Microtubules. A Proton Nuclear Resonance Analysis on the Binding of Synthetic Peptide to Tubulin	127	X
1343	2D NMR and Structural Model for a Mitochondrial Signal Peptide Bound to a Micelle	153	X
1344	Toward the Solution Structure of Human Insulin: Sequential 2D 1H NMR Assignment of a Des-pentapeptide Analogue and Comparison with Crystal Structure	141	X
1346	NMR Studies of Multiple Conformations in Complexes of Lactobacillus casei Dihydrofolate Reductase with Analogues of Pyrimethamine	57	X
1347	NMR Studies of Multiple Conformations in Complexes of Lactobacillus casei Dihydrofolate Reductase with Analogues of Pyrimethamine	64	X
1348	NMR Studies of Multiple Conformations in Complexes of Lactobacillus casei Dihydrofolate Reductase with Analogues of Pyrimethamine	64	X
1358	NH resonances of Ribonuclease S-peptide in aqueous solution	32	X
1360	NH resonances of Ribonuclease S-peptide in aqueous solution	28	X
1374	Two-Dimensional NMR Studies of Kazal Proteinase Inhibitors. 2. Sequence-Specific Assignments and Secondary Structure of Reactive Site Modified Turkey Ovomucoid Third Domain	236	X
1375	Assignment of the 13C-NMR Spectra of Virgin and Reactive-Site Modified Turkey Ovomucoid Third Domain	64	X
1376	Sequence-specific 1H-NMR assignments and determination of the secondary structure in aqueous solution of the cardiotoxins CTXIIa and CTXIIb from Naja mossambica mossambica	1	X
1377	Nuclear-magnetic-resonance studies of human epidermal growth factor	319	X
1378	Nuclear-magnetic-resonance studies of human epidermal growth factor	366	X
1379	A two-dimensional 1H-NMR study on Megasphaera elsdenii flavodoxin in the oxidized state and some comparisons with the two-electron-reduced state	842	X
1381	Two-dimensional NMR studies and secondary structure of cobrotoxin in aqueous solution	292	X
1393	Identification and Description of alpha-Helical Regions in Horse Muscle Acylphosphatase by 1H Nuclear Magnetic Resonance Spectroscopy	173	X
1394	The sequence-specific assignment of the 1H-NMR spectrum of an enzyme, horse-muscle acylphosphatase	617	X
1396	Solution structure of the DNA-binding domain of the yeast transcriptional activator protein GCN4	471	X
1397	Solution structure of the DNA-binding domain of the yeast transcriptional activator protein GCN4	469	X
1398	Solution structure of the DNA-binding domain of the yeast transcriptional activator protein GCN4	471	X
1399	Solution structure of the DNA-binding domain of the yeast transcriptional activator protein GCN4	469	X
1400	A Proton Nuclear Magnetic Resonance Assignment and Secondary Structure Determination of Recombinant Human Thioredoxin	1	X
1403	Solution Structure of Human Calcitonin Gene-Related Peptide by 1H NMR and Distance Geometry with Restrained Molecular Dynamics	238	X
1404	A systematic approach towards the complete assignment of 13C resonances for horse ferrocytochrome c	201	X
1413	1H NMR Resonance Assignment of the Active Site Residues of Paramagnetic Proteins by 2D Bond Correlation Spectroscopy: Metcyanomyoglobin	36	X
1414	1H Resonance Assignment and Secondary Structure Determination of the Dimerization Domain of Transcription Factor LFB1	237	X
1416	Rates and Energetics of Tyrosine Ring Flips in Yeast Iso-2-cytochrome c	6	X
1439	Two-Dimensional Magnetization Exchange Spectroscopy of Anabaena 7120 Ferredoxin. Nuclear Overhauser Effect and Electron Self Exchange Cross Peaks from Amino Acid Residues Surrounding the 2Fe-2S, Cluster	23	X
1440	Two-Dimensional Magnetization Exchange Spectroscopy of Anabaena 7120 Ferredoxin. Nuclear Overhauser Effect and Electron Self Exchange Cross Peaks from Amino Acid Residues Surrounding the 2Fe-2S, Cluster	3	X
1441	Two-Dimensional Magnetization Exchange Spectroscopy of Anabaena 7120 Ferredoxin. Nuclear Overhauser Effect and Electron Self Exchange Cross Peaks from Amino Acid Residues Surrounding the 2Fe-2S, Cluster	3	X
1442	2D 1H NMR Studies of Monomeric Insulin	125	X
1443	2D 1H NMR Studies of Monomeric Insulin	6	X
1444	2D 1H NMR Studies of Monomeric Insulin	217	X
1445	Studies of Synthetic Helical Peptides Using Circular Dichroism and Nuclear Magnetic Resonance	132	X
1446	Studies of Synthetic Helical Peptides Using Circular Dichroism and Nuclear Magnetic Resonance	132	X
1447	Solution Structure of the Basic Region from the Transcriptional Activator GCN4	296	X
1448	Solution Structure of the Basic Region from the Transcriptional Activator GCN4	294	X
1449	Solution Structure of the Basic Region from the Transcriptional Activator GCN4	296	X
1450	Solution Structure of the Basic Region from the Transcriptional Activator GCN4	294	X
1451	Solution Structure of the Basic Region from the Transcriptional Activator GCN4	266	X
1452	Solution Structure of the Basic Region from the Transcriptional Activator GCN4	264	X
1453	Solution Structure of the Basic Region from the Transcriptional Activator GCN4	266	X
1454	Solution Structure of the Basic Region from the Transcriptional Activator GCN4	264	X
1455	1H-NMR study of the mechanism of assembly and equilibrium heme orientation of sperm whale myoglobin reconstituted with protohemin type-isomers	14	X
1457	1H-NMR study of the mechanism of assembly and equilibrium heme orientation of sperm whale myoglobin reconstituted with protohemin type-isomers	14	X
1459	1H-NMR study of the mechanism of assembly and equilibrium heme orientation of sperm whale myoglobin reconstituted with protohemin type-isomers	14	X
1461	1H-NMR study of the mechanism of assembly and equilibrium heme orientation of sperm whale myoglobin reconstituted with protohemin type-isomers	14	X
1463	1H-NMR study of the mechanism of assembly and equilibrium heme orientation of sperm whale myoglobin reconstituted with protohemin type-isomers	14	X
1465	1H-NMR study of the mechanism of assembly and equilibrium heme orientation of sperm whale myoglobin reconstituted with protohemin type-isomers	14	X
1467	1H-NMR study of the mechanism of assembly and equilibrium heme orientation of sperm whale myoglobin reconstituted with protohemin type-isomers	8	X
1469	1H-NMR study of the mechanism of assembly and equilibrium heme orientation of sperm whale myoglobin reconstituted with protohemin type-isomers	9	X
1471	1H-NMR study of the mechanism of assembly and equilibrium heme orientation of sperm whale myoglobin reconstituted with protohemin type-isomers	14	X
1474	Sequence-specific 1H NMR Assignments and Structural Characterization of Bovine Seminal Fluid Protein PDC-109 Domain b	278	X
1475	Isotope-Edited NMR of Cyclosporin A Bound to Cyclophilin: Evidence for a Trans 9,10 Amide Bond	3	X
1476	1H NMR Structure Characterization of a Recombinant Kringle 2 Domain from Human Tissue-Type Plasminogen Activator	42	X
1477	1H NMR Structure Characterization of a Recombinant Kringle 2 Domain from Human Tissue-Type Plasminogen Activator	46	X
1478	Two-Dimensional 1H Nuclear Magnetic Resonance Study of AaH IT, an Anti-Insect Toxin from the Scorpion Androctonus australis Hector. Sequential Resonance Assignments and Folding of the Polypeptide Chain	440	X
1479	Secondary Structure of a Complement Control Protein Module by Two-Dimensional 1H NMR	391	X
1480	Secondary Structure of a Complement Control Protein Module by Two-Dimensional 1H NMR	327	X
1481	Two-Dimensional NMR and Structure Determination of Salmon Calcitonin in Methanol	208	X
1482	Two-Dimensional NMR and Structure Determination of Salmon Calcitonin in Methanol	207	X
1483	Microviridin: A Novel Tricyclic Depsipeptide from the Toxic Cyanobacterium Microcystis viridis	90	X
1484	Histidine 121 of Staphylococcal Nuclease. Correlation of the Hdelta2 1H NMR Assignment and Reinterpretation of the Role This Residue Plays in Conformational Heterogeneity of the Protein	2	X
1485	Histidine 121 of Staphylococcal Nuclease. Correlation of the Hdelta2 1H NMR Assignment and Reinterpretation of the Role This Residue Plays in Conformational Heterogeneity of the Protein	2	X
1486	A characterization of copper/zinc superoxide dismutase mutants at position 124	14	X
1487	A characterization of copper/zinc superoxide dismutase mutants at position 124	14	X
1494	Assignment of the 1H-NMR spectrum of a lac repressor headpiece-operator complex in H2O and identification of NOEs	296	X
1495	1H Assignments and Secondary Structure Determination of the Soybean Trypsin/Chymotrypsin Bowman-Birk Inhibitor	403	X
1496	ADR1a, a Zinc Finger Peptide, Exists in Two Folded Conformations	218	X
1497	ADR1a, a Zinc Finger Peptide, Exists in Two Folded Conformations	218	X
1500	Alternating Zinc Fingers in the Human Male Associated Protein ZFY: 2D NMR Structure of an Even Finger and Implications for "Jumping-Linker" DNA Recognition	204	X
1503	Solution conformation of endothelin, a potent vaso-constricting bicyclic peptide	145	X
1515	NMR and circular dichroic studies on the solution conformation of a synthetic peptide derived from the calmodulin-binding domain of Bordetella pertussis adenylate cyclase	151	X
1516	Three-dimensional correlated NMR study of Megasphaera elsdenii flavodoxin in the oxidized state	91	X
1517	Complete assignment of the 1H NMR spectrum and secondary structure of the DNA binding domain of GAL4	331	X
1518	Structure and Function of X-Pro Dipeptide Repeats in the TonB Proteins of Salmonella typhimurium and Escherichia coli	55	X
1519	Structure and Function of X-Pro Dipeptide Repeats in the TonB Proteins of Salmonella typhimurium and Escherichia coli	54	X
1520	Characterization of a Partially Denatured State of a Protein by Two-Dimensional NMR: Reduction of the Hydrophobic Interactions in Ubiquitin	79	X
1538	A 1H NMR Study of Human Calcitonin in Solution	213	X
1539	A 1H NMR Study of Human Calcitonin in Solution	213	X
1541	Analysis of the Methyl 1H-NMR Spectrum of Crambin, a Hydrophobic Protein	15	X
1542	Analysis of the Methyl 1H-NMR Spectrum of Crambin, a Hydrophobic Protein	15	X
1543	A 1H NMR Study of Human Calcitonin in Solution	213	X
1544	A 1H NMR Study of Human Calcitonin in Solution	213	X
1545	A 1H NMR Study of Human Calcitonin in Solution	220	X
1546	A 1H NMR Study of Human Calcitonin in Solution	213	X
1551	1H NMR Identification of a B-Sheet Structure and Description of Folding Topology in Putidaredoxin	222	X
1552	pH Dependence of the High-Resolution Proton Nuclear Magnetic Resonance Spectrum of the lac Repressor Headpiece	24	X
1553	Solution Structure of a Polypeptide Dimer Comprising the Fourth Ca+2-Binding Site of Troponin C by Nuclear Magnetic Resonance Spectroscopy	253	X
1562	Opioid Peptides in Micellar Systems: Conformational Analysis by CD and by One-Dimensional and Two-Dimensional 1H-NMR Spectroscopy	115	X
1566	Evidence for Two Interconverting Protein Isomers in the Methotrexate Complex of Dihydrofolate Reductase from Escherichia coli	240	X
1567	Evidence for Two Interconverting Protein Isomers in the Methotrexate Complex of Dihydrofolate Reductase from Escherichia coli	240	X
1571	1H NMR Study of the Solution Molecular and Electronic Structure of Escherichia coli Ferricytochrome b562: Evidence for S = 1/2 <=> S = 5/2 Spin Equilibrium for Intact His/Met Ligation	9	X
1573	1H NMR Study of the Solution Molecular and Electronic Structure of Escherichia coli Ferricytochrome b562: Evidence for S = 1/2 <=> S = 5/2 Spin Equilibrium for Intact His/Met Ligation	2	X
1574	Proton magnetic resonance characterization of phoratoxins and homologous proteins related to crambin	7	X
1575	Proton magnetic resonance characterization of phoratoxins and homologous proteins related to crambin	7	X
1576	Proton magnetic resonance characterization of phoratoxins and homologous proteins related to crambin	5	X
1577	Proton magnetic resonance characterization of phoratoxins and homologous proteins related to crambin	5	X
1578	Proton magnetic resonance characterization of phoratoxins and homologous proteins related to crambin	3	X
1580	Hydrogen-1, Carbon-13, Nitrogen-15 NMR Spectroscopy of Anabaena 7120 Flavodoxin: Assignment of beta-Sheet and Flavin Binding Site Resonances and Analysis of Protein-Flavin Interactions	321	X
1581	Deletion of the omega-loop in the Active Site of Staphylococcal Nuclease 2. Effects on Protein Structure and Dynamics	270	X
1582	Deletion of the omega-loop in the Active Site of Staphylococcal Nuclease 2. Effects on Protein Structure and Dynamics	258	X
1583	Deletion of the omega-loop in the Active Site of Staphylococcal Nuclease 2. Effects on Protein Structure and Dynamics	266	X
1584	Deletion of the omega-loop in the Active Site of Staphylococcal Nuclease 2. Effects on Protein Structure and Dynamics	266	X
1585	Proton Nuclear Magnetic Resonance Study of the B9(Asp)Mutant of Human Insulin Sequential Assignment and Secondary Structure	127	X
1586	Proton Nuclear Magnetic Resonance Study of the B9(Asp)Mutant of Human Insulin Sequential Assignment and Secondary Structure	203	X
1587	Proton Nuclear Magnetic Resonance Study of the B9(Asp)Mutant of Human Insulin Sequential Assignment and Secondary Structure	2	X
1588	Solution Phase Conformation Studies of the Prekallikrein Binding Domain of High Molecular Weight Kininogen	184	X
1589	Solution Phase Conformation Studies of the Prekallikrein Binding Domain of High Molecular Weight Kininogen	170	X
1590	A protein structural change in aglycosylated IgG3 correlates with loss of huFcgammaR1 and huFcgammaR111 binding and/or activation	2	X
1591	A protein structural change in aglycosylated IgG3 correlates with loss of huFcgammaR1 and huFcgammaR111 binding and/or activation	1	X
1592	NMR Studies of the MgATP Binding Site of Adenylate Kinase and of a 45-Residue Peptide Fragment of the Enzyme	27	X
1616	Isolation and 2D 1H NMR of the NH2-terminal 24 residues peptide fragment from dog serum albumin and its complexation with copper and nickel	134	X
1620	GAL4 transcription factor is not a "zinc finger" but forms a Zn(II)2Cys6 binuclear cluster	6	X
1624	Secondary structure of the phosphocarrier protein III(Glc), a signal-transducing protein from Escherichia coli, determined by heteronuclear three-dimensional NMR spectroscopy	13	X
1632	Comparative 2D NMR Studies of Human Insulin and Des-pentapeptide Insulin: Sequential Resonance Assignment and Implications for Proteins Dynamics and Receptor Recognition	141	X
1633	Comparative 2D NMR Studies of Human Insulin and Des-pentapeptide Insulin: Sequential Resonance Assignment and Implications for Proteins Dynamics and Receptor Recognition	217	X
1634	Triple-Resonance Multidimensional NMR Study of Calmodulin Complexed with the Binding Domain of Skeletal Muscle Myosin Light-Chain Kinase: Indication of a Conformational Change in the Central Helix	746	X
1635	Solution Conformation of a Peptide Fragment Representing a Proposed RNA-Binding Site of a Viral Coat Protein Studied by Two-Dimensional NMR	174	X
1638	Polypeptide-metal cluster connectivities in Cd(II) GAL4	18	X
1639	Sequential 1H NMR Assignments and Secondary Structure of an IgG-Binding Domain from Protein G	426	X
1640	High-Resolution Structure of an HIV Zinc Fingerlike Domain via a New NMR-Based Distance Geometry Approach	47	X
1642	Complete Assignment of the Noncarbonylic Carbon-13 Resonances of Tendamistat	255	X
1643	Solution Structure of Salmon Calcitonin	207	X
1646	A spectroscopic analysis of the Pro35-->Ala mutant of Rhodobacter capsulatus cytochrome c2. The strictly conserved Pro35 is not structurally essential.	20	X
1647	A spectroscopic analysis of the Pro35-->Ala mutant of Rhodobacter capsulatus cytochrome c2. The strictly conserved Pro35 is not structurally essential.	18	X
1648	Triple-Resonance Multidimensional NMR Study of Calmodulin Complexed with the Binding Domain of Skeletal Muscle Myosin Light-Chain Kinase: Indication of a Conformational Change in the Central Helix	2	X
1649	Polypeptide-metal cluster connectivities in Cd(II) GAL4	18	X
1650	Hydrophobic Clustering in Nonnative States of a Protein: Interpretation of Chemical Shifts in NMR Spectra of Denatured States of Lysozyme	100	X
1651	Hydrophobic Clustering in Nonnative States of a Protein: Interpretation of Chemical Shifts in NMR Spectra of Denatured States of Lysozyme	100	X
1652	Structural Determination of the Vasoactive Intestinal Peptide by Two-Dimensional 1H-NMR Spectroscopy	174	X
1653	Hydrophobic Clustering in Nonnative States of a Protein: Interpretation of Chemical Shifts in NMR Spectra of Denatured States of Lysozyme	1	X
1654	Determination of the structure of [Nle7]-endothelin by 1H NMR	130	X
1655	Determination of the structure of [Nle7]-endothelin by 1H NMR	106	X
1656	C-Terminal Retroviral-Type Zinc Finger Domain from the HIV-1 Nucleocapsid Protein Is Structurally Similar to the N-Terminal Zinc Finger Domain	113	X
1657	Assignments of Backbone 1H, 13C, 15N Resonances and Secondary Structure of Ribonuclease H from Escherichia coli by Heteronuclear Three-Dimensional NMR Spectroscopy	587	X
1658	Two-dimensional 1H, 15N-NMR investigation of uniformly 15N-labeled ribonuclease T1 (Complete assignment of 15N resonances)	120	X
1660	Proton nuclear magnetic resonance investigation of adrenodoxin (Assignment of aromatic resonances and evidence for a conformational similarity with ferredoxin from Spirulina platensis	87	X
1661	Proton nuclear magnetic resonance investigation of adrenodoxin (Assignment of aromatic resonances and evidence for a conformational similarity with ferredoxin from Spirulina platensis	26	X
1662	Proton nuclear magnetic resonance investigation of adrenodoxin (Assignment of aromatic resonances and evidence for a conformational similarity with ferredoxin from Spirulina platensis	66	X
1663	Polypeptide Backbone Resonance Assignments and Secondary Structure of Bacillus subtilis Enzyme III(glc) Determined by Two-Dimensional and Three-Dimensional Heteronuclear NMR Spectroscopy	951	X
1664	Tertiary Structure of Conotoxin GIIIA in Aqueous Solution	128	X
1665	Tertiary Structure of Conotoxin GIIIA in Aqueous Solution	4	X
1666	Investigation of the Solution Structure of the Human Parathyroid Hormone Fragment (1-34) by 1H NMR Spectroscopy, Distance Geometry, and Molecular Dynamics Calculations	245	X
1669	A structural study of calcium-binding equine lysozome by two-dimensional 1H-NMR	28	X
1670	A structural study of calcium-binding equine lysozome by two-dimensional 1H-NMR	27	X
1672	1H and 15N NMR Resonance Assignments and Preliminary Structural Characterization of Escherichia coli Apocytochrome b562	710	X
1673	1H and 15N Resonance Assignments of Oxidized Flavodoxin from Anacystis nidulans with 3D NMR	798	X
1674	Sequence-specific 1H-NMR Assignments and Identification of Slowly Exchanging Amide Protons in Murine Epidermal Growth Factor	343	X
1675	Solution Structure of Neuronal Bungarotoxin Determined by Two-Dimensional NMR Spectroscopy: Sequence-Specific Assignments, Secondary Structure, and Dimer Formation	391	X
1676	Mimicking the Membrane-Mediated Conformation of Dynorphin A-(1-13)-Peptide: Circular Dichroism and Nuclear Magnetic Resonance Studies in Methanolic Solution	109	X
1677	1H-NMR Assignments and Conformational Studies of Melanin Concentrating Hormone in Water Using Two-Dimensional NMR	107	X
1692	Comparison of Helix Stability in Wild-type and Mutant LamB Signal Sequences	49	X
1693	Comparison of Helix Stability in Wild-type and Mutant LamB Signal Sequences	41	X
1696	Complete 1H and 13C assignment of Lys and Leu sidechains of staphylococcal nuclease using HCCH-COSY and HCCH-TOCSY 3D NMR spectroscopy	539	X
1697	Conformations of neurotensin in solution and in membrane environments studied by 2D-NMR spectroscopy	107	X
1698	Conformations of neurotensin in solution and in membrane environments studied by 2D-NMR spectroscopy	96	X
1699	Conformations of neurotensin in solution and in membrane environments studied by 2D-NMR spectroscopy	103	X
1700	1H NMR Study of the Solution Structure of Sarafotoxin-S6b	128	X
1702	Positioning of a Spin-Labeled Substrate Analogue into the Structure of delta5-3-Ketosteroid Isomerase by Combined Kinetic, Magnetic Resonance, and X-ray Diffraction Methods	32	X
1704	Two-Dimensional NMR Studies of Staphylococcal Nuclease: Evidence for Conformational Heterogeneity from Hydrogen-1, Carbon-13, and Nitrogen-15 Spin System Assignments of the Aromatic Amino Acids in the Nuclease H124L-Thymidine 3',5'-Bisphosp	201	X
1705	Structure-function relationships in the polypeptide cardiac stimulant, anthopleurin-A (Effects of limited proteolysis by trypsin)	11	X
1706	Structure-function relationships in the polypeptide cardiac stimulant, anthopleurin-A (Effects of limited proteolysis by trypsin)	11	X
1707	Characterization of wild-type and mutant M13 gene V proteins by means of 1H-NMR	37	X
1709	Cell Adhesion Promoting Peptide GVKGDKGNPGWPGAP from the CollagenType IV Triple Helix: Cis/Trans Proline-Induced Multiple 1H NMR Conformations and Evidence for a KG/PG Multiple Turn Repeat Motif in the All-Trans Proline State	94	X
1710	Two-dimensional Proton-NMR studies on a hybrid peptide between cecropin A and melittin	165	X
1712	C-Terminal Structure and Mobility of Rabbit Skeletal Muscle Light Meromyosin As Studied by One- and Two-Dimensional 1H NMR Spectroscopy and X-ray Small-Angle Scattering	60	X
1713	C-Terminal Structure and Mobility of Rabbit Skeletal Muscle Light Meromyosin As Studied by One- and Two-Dimensional 1H NMR Spectroscopy and X-ray Small-Angle Scattering	8	X
1719	Proton Nuclear Magnetic Resonance as a Probe of Differences in Structure between the C102T and F82S,C102T Variants of Iso-1-cytochrome c from the Yeast Saccharomyces cerevisiae	539	X
1720	Proton Nuclear Magnetic Resonance as a Probe of Differences in Structure between the C102T and F82S,C102T Variants of Iso-1-cytochrome c from the Yeast Saccharomyces cerevisiae	626	X
1722	Cell Adhesion Promoting Peptide GVKGDKGNPGWPGAP from the CollagenType IV Triple Helix: Cis/Trans Proline-Induced Multiple 1H NMR Conformations and Evidence for a KG/PG Multiple Turn Repeat Motif in the All-Trans Proline State	63	X
1723	Cell Adhesion Promoting Peptide GVKGDKGNPGWPGAP from the CollagenType IV Triple Helix: Cis/Trans Proline-Induced Multiple 1H NMR Conformations and Evidence for a KG/PG Multiple Turn Repeat Motif in the All-Trans Proline State	86	X
1724	Cell Adhesion Promoting Peptide GVKGDKGNPGWPGAP from the CollagenType IV Triple Helix: Cis/Trans Proline-Induced Multiple 1H NMR Conformations and Evidence for a KG/PG Multiple Turn Repeat Motif in the All-Trans Proline State	56	X
1725	Cell Adhesion Promoting Peptide GVKGDKGNPGWPGAP from the CollagenType IV Triple Helix: Cis/Trans Proline-Induced Multiple 1H NMR Conformations and Evidence for a KG/PG Multiple Turn Repeat Motif in the All-Trans Proline State	29	X
1726	Cell Adhesion Promoting Peptide GVKGDKGNPGWPGAP from the CollagenType IV Triple Helix: Cis/Trans Proline-Induced Multiple 1H NMR Conformations and Evidence for a KG/PG Multiple Turn Repeat Motif in the All-Trans Proline State	29	X
1727	Nuclear-magnetic-resonance studies on the conformation of membrane-bound alpha-mating factor (Transferred nuclear Overhauser effect analysis)	91	X
1728	Solution conformation of endothelin determined by means of 1H-NMR spectroscopy and distance geometry calculations	149	X
1729	Complete Sequence-Specific 1H Nuclear Magnetic Resonance Assignments for Mouse Epidermal Growth Factor	344	X
1734	Heteronuclear Multiple-Quantum Coherence NMR Spectroscopy of Paramagnetic Heme and Cytochrome c-551	18	X
1736	Heteronuclear Multiple-Quantum Coherence NMR Spectroscopy of Paramagnetic Heme and Cytochrome c-551	25	X
1739	Properties of aromatic residues in ferricytochrome c3 of Desulfovibrio vulgaris miyazaki f studied by 1H NMR	5	X
1743	Assignments of 1H-15N magnetic resonances and identification of secondary structure elements of the lambda-cro repressor	438	X
1744	Assignments of 1H-15N magnetic resonances and identification of secondary structure elements of the lambda-cro repressor	30	X
1745	Alternating Zinc Fingers in the Human Male Associated Protein ZFY: Refinement of the NMR Structure of an Even Finger by Selective Deuteration Labeling and Implications for DNA Recognition	22	X
1751	NMR study of Galeorhinus japonicus myoglobin (1H-NMR study of molecular structure of the heme cavity)	18	X
1752	NMR study of Galeorhinus japonicus myoglobin (1H-NMR study of molecular structure of the heme cavity)	18	X
1756	Sequence-specific 1H-NMR assignments and secondary structure of the lipoyl domain of the Bacillus stearothermophilus pyruvate dehydrogenase multienzyme complex	508	X
1757	1H NMR and Circular Dichroism Studies of the N-Terminal Domain of Cyclic GMP Dependent Protein Kinase: A Leucine/Isoleucine Zipper	285	X
1760	Heteronuclear 2D NMR Studies of an Engineered Insulin Monomer: Assignment and Characterization of the Receptor-Binding Surface by Selective 2H and 13C Labeling with Application to Protein Design	72	X
1761	Heteronuclear 2D NMR Studies of an Engineered Insulin Monomer: Assignment and Characterization of the Receptor-Binding Surface by Selective 2H and 13C Labeling with Application to Protein Design	14	X
1762	Heteronuclear 2D NMR Studies of an Engineered Insulin Monomer: Assignment and Characterization of the Receptor-Binding Surface by Selective 2H and 13C Labeling with Application to Protein Design	13	X
1766	Two and Three-Dimensional Proton NMR Studies of Apo-Neocarzinostatin	690	X
1767	The conformation of porcine-brain natriuretic peptide by two-dimensional NMR spectroscopy	173	X
1769	Identification of resonances from an oncogenic activating locus of human N-Ras-encoded p21 protein using isotope-edited NMR	2	X
1770	1H-NMR Study of the Intramolecular Interaction of a Substrate Analogue Covalently Attached to Aspartic Acid-101 in Lysozyme	62	X
1771	1H-NMR Study of the Intramolecular Interaction of a Substrate Analogue Covalently Attached to Aspartic Acid-101 in Lysozyme	58	X
1772	1H-NMR Study of the Intramolecular Interaction of a Substrate Analogue Covalently Attached to Aspartic Acid-101 in Lysozyme	55	X
1773	1H-NMR Study of the Intramolecular Interaction of a Substrate Analogue Covalently Attached to Aspartic Acid-101 in Lysozyme	55	X
1775	Proton-NMR studies of the effects of ionic strength and pH on the hyperfine-shifted resonances and phenylalanine-82 environment of three species of mitochondrial ferricytochrome c	22	X
1777	Proton-NMR studies of the effects of ionic strength and pH on the hyperfine-shifted resonances and phenylalanine-82 environment of three species of mitochondrial ferricytochrome c	17	X
1779	Proton-NMR studies of the effects of ionic strength and pH on the hyperfine-shifted resonances and phenylalanine-82 environment of three species of mitochondrial ferricytochrome c	15	X
1781	Proton-NMR studies of the effects of ionic strength and pH on the hyperfine-shifted resonances and phenylalanine-82 environment of three species of mitochondrial ferricytochrome c	15	X
1783	Proton-NMR studies of the effects of ionic strength and pH on the hyperfine-shifted resonances and phenylalanine-82 environment of three species of mitochondrial ferricytochrome c	17	X
1785	Proton-NMR studies of the effects of ionic strength and pH on the hyperfine-shifted resonances and phenylalanine-82 environment of three species of mitochondrial ferricytochrome c	22	X
1787	Proton-NMR studies of the effects of ionic strength and pH on the hyperfine-shifted resonances and phenylalanine-82 environment of three species of mitochondrial ferricytochrome c	15	X
1789	Proton-NMR studies of the effects of ionic strength and pH on the hyperfine-shifted resonances and phenylalanine-82 environment of three species of mitochondrial ferricytochrome c	15	X
1791	Proton-NMR studies of the effects of ionic strength and pH on the hyperfine-shifted resonances and phenylalanine-82 environment of three species of mitochondrial ferricytochrome c	18	X
1793	Proton-NMR studies of the effects of ionic strength and pH on the hyperfine-shifted resonances and phenylalanine-82 environment of three species of mitochondrial ferricytochrome c	18	X
1795	Proton-NMR studies of the effects of ionic strength and pH on the hyperfine-shifted resonances and phenylalanine-82 environment of three species of mitochondrial ferricytochrome c	16	X
1797	Proton-NMR studies of the effects of ionic strength and pH on the hyperfine-shifted resonances and phenylalanine-82 environment of three species of mitochondrial ferricytochrome c	16	X
1798	Effect of inhibitors on conformational changes in hen lysozyme around thermal transition point in solution and solid state	14	X
1799	Effect of inhibitors on conformational changes in hen lysozyme around thermal transition point in solution and solid state	14	X
1800	Effect of inhibitors on conformational changes in hen lysozyme around thermal transition point in solution and solid state	13	X
1801	Effect of inhibitors on conformational changes in hen lysozyme around thermal transition point in solution and solid state	18	X
1802	Effect of inhibitors on conformational changes in hen lysozyme around thermal transition point in solution and solid state	13	X
1803	Effect of inhibitors on conformational changes in hen lysozyme around thermal transition point in solution and solid state	13	X
1808	2D NMR of paramagnetic metalloenzymes: Cyanide-inhibited horseradish peroxidase	11	X
1811	Conformation of sarafotoxin-6b in aqueous solution determined by NMR spectroscopy and distance geometry	137	X
1812	Assignment of the 15N NMR spectra of reduced and oxidized Escherichia coli thioredoxin	101	X
1813	Assignment of the 15N NMR spectra of reduced and oxidized Escherichia coli thioredoxin	101	X
1814	Calorimetric and Spectroscopic Examination of the Solution Phase Structures of Prekallikrein Binding Domain Peptides of High Molecular Weight Kininogen	97	X
1815	Calorimetric and Spectroscopic Examination of the Solution Phase Structures of Prekallikrein Binding Domain Peptides of High Molecular Weight Kininogen	99	X
1816	Tendamistat (12-26) fragment (NMR characterization of isolated Beta-turn folding intermediates)	102	X
1817	The Solution Conformation of Tubulin-beta(422-434)-NH2 and Its Nac-DATADEQG-NH2 Fragment Based on NMR	73	X
1819	Interaction of Sulphate and Chloride with Cobalt(II)-Carbonic Anhydrase	1	X
1820	Interaction of Sulphate and Chloride with Cobalt(II)-Carbonic Anhydrase	1	X
1821	Interaction of Sulphate and Chloride with Cobalt(II)-Carbonic Anhydrase	1	X
1822	Interaction of Sulphate and Chloride with Cobalt(II)-Carbonic Anhydrase	1	X
1825	Anantin-A peptide antagonist of the atrial natriuretic factor(ANF) II. Determination of the primary sequence by NMR on the basis of proton assignments	99	X
1826	Anantin-A peptide antagonist of the atrial natriuretic factor(ANF) II. Determination of the primary sequence by NMR on the basis of proton assignments	64	X
1839	Proton NMR Assignments of Heme Contacts and Catalytically Implicated Amino Acids in Cyanide-Ligated Cytochrome c Peroxidase Determined from One- and Two-Dimensional Nuclear Overhauser Effects	29	X
1841	Proton Hyperfine Resonance Assignments in Cyanide-ligated Cytochrome c Peroxidase Using the Nuclear Overhauser Effect	9	X
1843	NMR analysis of site-specific mutants of yeast phosphoglycerate kinase An investigation of the triose-binding site	3	X
1844	NMR analysis of site-specific mutants of yeast phosphoglycerate kinase An investigation of the triose-binding site	2	X
1845	NMR analysis of site-specific mutants of yeast phosphoglycerate kinase An investigation of the triose-binding site	3	X
1846	NMR analysis of site-specific mutants of yeast phosphoglycerate kinase An investigation of the triose-binding site	3	X
1851	Conformational and Receptor Binding Properties of Human EGF and TGF-alpha Second Loop Fragments	114	X
1854	Reductive cleavage and regeneration of the disulfide bonds in Streptomyces subtilisin inhibitor (SSI) as studied by the carbonyl 13C NMR resonances of cysteinyl residues	4	X
1855	Reductive cleavage and regeneration of the disulfide bonds in Streptomyces subtilisin inhibitor (SSI) as studied by the carbonyl 13C NMR resonances of cysteinyl residues	4	X
1856	Reductive cleavage and regeneration of the disulfide bonds in Streptomyces subtilisin inhibitor (SSI) as studied by the carbonyl 13C NMR resonances of cysteinyl residues	4	X
1857	Reductive cleavage and regeneration of the disulfide bonds in Streptomyces subtilisin inhibitor (SSI) as studied by the carbonyl 13C NMR resonances of cysteinyl residues	4	X
1858	Reductive cleavage and regeneration of the disulfide bonds in Streptomyces subtilisin inhibitor (SSI) as studied by the carbonyl 13C NMR resonances of cysteinyl residues	4	X
1859	Reductive cleavage and regeneration of the disulfide bonds in Streptomyces subtilisin inhibitor (SSI) as studied by the carbonyl 13C NMR resonances of cysteinyl residues	4	X
1865	Studies of Individual Carbon Sites of Hen Egg White Lysozyme by Natural Abundance Carbon 13 Nuclear Magnetic Resonance Spectroscopy	22	X
1866	Proton resonance assignments for Pseudomonas aeruginosa ferrocytochrome c-551	42	X
1867	The Conformation of Endothelin-1 in Aqueous Solution: NMR-Derived Constraints Combined with Distance Geometry and Molecular Dynamics Calculations	146	X
1869	Sequence specific assignment of the proton nuclear magnetic resonance spectrum of barley serine proteinase inhibitor 2	514	X
1870	Sequence specific assignment of the proton nuclear magnetic resonance spectrum of barley serine proteinase inhibitor 2	449	X
1871	Sequence specific assignment of the proton nuclear magnetic resonance spectrum of barley serine proteinase inhibitor 2	2	X
1872	Sequence specific assignment of the proton nuclear magnetic resonance spectrum of barley serine proteinase inhibitor 2	2	X
1874	Solution Studies of Staphylococcal Nuclease H124L. 2. 1H, 13C, and 15N Chemical Shift Assignments for the Unligated Enzyme and Analysis of Chemical Shift Changes That Accompany Formation of the Nuclease-Thymidine 3',5'-Bisphosphate-Calcium	112	X
1875	Solution Studies of Staphylococcal Nuclease H124L. 2. 1H, 13C, and 15N Chemical Shift Assignments for the Unligated Enzyme and Analysis of Chemical Shift Changes That Accompany Formation of the Nuclease-Thymidine 3',5'-Bisphosphate-Calcium	868	X
1876	Solution Studies of Staphylococcal Nuclease H124L. 2. 1H, 13C, and 15N Chemical Shift Assignments for the Unligated Enzyme and Analysis of Chemical Shift Changes That Accompany Formation of the Nuclease-Thymidine 3',5'-Bisphosphate-Calcium	69	X
1877	Solution Studies of Staphylococcal Nuclease H124L. 2. 1H, 13C, and 15N Chemical Shift Assignments for the Unligated Enzyme and Analysis of Chemical Shift Changes That Accompany Formation of the Nuclease-Thymidine 3',5'-Bisphosphate-Calcium	11	X
1878	Solution Studies of Staphylococcal Nuclease H124L. 2. 1H, 13C, and 15N Chemical Shift Assignments for the Unligated Enzyme and Analysis of Chemical Shift Changes That Accompany Formation of the Nuclease-Thymidine 3',5'-Bisphosphate-Calcium	124	X
1881	Hydrophobic Clustering in Nonnative States of a Protein: Interpretation of Chemical Shifts in NMR Spectra of Denatured States of Lysozyme	2	X
1882	Hydrophobic Clustering in Nonnative States of a Protein: Interpretation of Chemical Shifts in NMR Spectra of Denatured States of Lysozyme	2	X
1883	Hydrophobic Clustering in Nonnative States of a Protein: Interpretation of Chemical Shifts in NMR Spectra of Denatured States of Lysozyme	2	X
1884	Hydrophobic Clustering in Nonnative States of a Protein: Interpretation of Chemical Shifts in NMR Spectra of Denatured States of Lysozyme	3	X
1885	Solution Conformational Preferences of Immunogenic Peptides Derived from the Principal Neutralizing Determinant of the HIV-1 Envelope Glycoprotein gp120	276	X
1886	Solution Conformational Preferences of Immunogenic Peptides Derived from the Principal Neutralizing Determinant of the HIV-1 Envelope Glycoprotein gp120	175	X
1887	Solution Conformational Preferences of Immunogenic Peptides Derived from the Principal Neutralizing Determinant of the HIV-1 Envelope Glycoprotein gp120	81	X
1889	Proton Homonuclear Correlated Spectroscopy as an Assignment Tool for Hyperfine-Shifted Resonances in Medium-Sized Paramagnetic Proteins: Cyanide-Ligated Yeast Cytochrome c Peroxidase as an Example	16	X
1891	Nuclear Magnetic Resonance Study on the Structure and Interaction of Cyclic AMP Receptor Protein and Its Mutants: A Deuterium-Labeling and Photo-CIDNP Study	23	X
1892	Nuclear Magnetic Resonance Study on the Structure and Interaction of Cyclic AMP Receptor Protein and Its Mutants: A Deuterium-Labeling and Photo-CIDNP Study	3	X
1893	Conformations of neurotensin in solution and in membrane environments studied by 2D-NMR spectroscopy	103	X
1895	A Nuclear Magnetic Resonance Study on the Cyclic AMP Receptor Protein (CRP): Assignments of the NH Protons of Histidine and Tryptophan Residues and the Effect of Binding of cAMP to CRP	7	X
1911	Alternating Zinc Fingers in the Human Male-Associated Protein ZFY: HX3H and HX4H Motifs Encode a Local Structural Switch	185	X
1917	Three-Dimensional Structure of Potato Carboxypeptidase Inhibitor in Solution. A Study Using Nuclear Magnetic Resonance, Distance Geometry, and Restrained Molecular Dynamics	226	X
1918	Three-Dimensional Structure of Potato Carboxypeptidase Inhibitor in Solution. A Study Using Nuclear Magnetic Resonance, Distance Geometry, and Restrained Molecular Dynamics	228	X
1919	Two-dimensional 1H-NMR studies of phospholipase-A2-inhibitor complexes bound to a micellar lipid-water interface	100	X
1920	Two-dimensional 1H-NMR studies of phospholipase-A2-inhibitor complexes bound to a micellar lipid-water interface	96	X
1921	Two-dimensional 1H-NMR studies of phospholipase-A2-inhibitor complexes bound to a micellar lipid-water interface	101	X
1968	Location of an alpha-Helix in Fragment 96-133 from Bovine Somatotropin by 1H NMR Spectroscopy	241	X
1975	N.m.r. study of conformational changes in lysozyme around the thermal transition point	33	X
1977	N.m.r. study of conformational changes in lysozyme around the thermal transition point	33	X
1991	Determinants of Protein Hyperthermostability: Purification and Amino Acid Sequence of Rubredoxin from the Hyperthermophilic Archaebacterium Pyrococcus furiosus and Secondary Structure of the Zinc Adduct by NMR	286	X
1995	NMR Study of the Phosphate-Binding Elements of Escherichia coli Elongation Factor Tu Catalytic Domain	8	X
1996	NMR Study of the Phosphate-Binding Elements of Escherichia coli Elongation Factor Tu Catalytic Domain	8	X
1997	1H NMR and CD Secondary Structure Analysis of Cell Adhesion Promoting Peptide F-9 from Laminin	156	X
1998	Conformational studies on a peptide fragment representing the RNA-binding N-terminus of a viral coat protein using circular dichroism and NMR spectroscopy	6	X
1999	Conformational studies on a peptide fragment representing the RNA-binding N-terminus of a viral coat protein using circular dichroism and NMR spectroscopy	6	X
2000	Conformational studies on a peptide fragment representing the RNA-binding N-terminus of a viral coat protein using circular dichroism and NMR spectroscopy	6	X
2001	Conformational studies on a peptide fragment representing the RNA-binding N-terminus of a viral coat protein using circular dichroism and NMR spectroscopy	6	X
2002	Conformational studies on a peptide fragment representing the RNA-binding N-terminus of a viral coat protein using circular dichroism and NMR spectroscopy	6	X
2003	Conformational studies on a peptide fragment representing the RNA-binding N-terminus of a viral coat protein using circular dichroism and NMR spectroscopy	6	X
2006	Assignment of proton resonances in the NMR spectrum of carbonmonoxy hemoglobin beta subunit tetramers	64	X
2012	Sequential 1H Assignment and Secondary Structure Determination of Salmon Calcitonin in Solution	226	X
2013	Structure of the Propeptide of Prothrombin Containing the gamma-Carboxylation Recognition Site Determined by Two-Dimensional NMR Spectroscopy	166	X
2014	Structure of the Propeptide of Prothrombin Containing the gamma-Carboxylation Recognition Site Determined by Two-Dimensional NMR Spectroscopy	93	X
2024	Sequential NMR Resonance Assignment and Structure Determination of the Kunitz-Type Inhibitor Domain of the Alzheimer's B-Amyloid Precursor Protein	397	X
2030	Two-Dimensional 1H NMR Studies on HPr Protein from Staphylococcus aureus: Complete Sequential Assignments and Secondary Structure	579	X
2031	Secondary Structure and Topology of Human Interleukin 4 in Solution	824	X
2038	NMR Study of the Active Site of Resting State and Cyanide-inhibited Lignin Peroxidase from Phanerochaete chrysosporium (Comparison with horseradish peroxidase)	9	X
2039	Sequence-specific 1H-NMR assignment and secondary structure of the Tyr41->His mutant of the single-stranded DNA binding protein, gene V protein, encoded by the filamentous bacteriophage M13	533	X
2040	Determination of the orientations of tryptophan analogues bound to the trp repressor and the relationship to activation	37	X
2042	Determination of the orientations of tryptophan analogues bound to the trp repressor and the relationship to activation	45	X
2043	Determination of the orientations of tryptophan analogues bound to the trp repressor and the relationship to activation	46	X
2047	Solution Conformation of Salmon Calcitonin in Sodium Dodecyl Sulfate Micelles As Determined by Two-Dimensional NMR and Distance Geometry Calculations	216	X
2048	Solution Conformation of Salmon Calcitonin in Sodium Dodecyl Sulfate Micelles As Determined by Two-Dimensional NMR and Distance Geometry Calculations	216	X
2049	The Secondary Structure in Solution of Acyl-Coenzyme A Binding Protein from Bovine Liver Using 1H Nuclear Magnetic Resonance Spectroscopy	531	X
2050	The Secondary Structure in Solution of Acyl-Coenzyme A Binding Protein from Bovine Liver Using 1H Nuclear Magnetic Resonance Spectroscopy	49	X
2051	Structure of the Binuclear Metal-Binding Site in the GAL4 Transcription Factor	18	X
2052	Structure of the Binuclear Metal-Binding Site in the GAL4 Transcription Factor	18	X
2053	Structure of the Binuclear Metal-Binding Site in the GAL4 Transcription Factor	18	X
2059	Assignment of the 600-MHz 1H-NMR spectrum of amicyanin from Thiobacillus versutus by two-dimensional NMR methods provides information on secondary structure	652	X
2060	Reexamination of the Secondary and Tertiary Structure of Histidine-Containing Protein from Escherichia coli by Homonuclear and Heteronuclear NMR Spectroscopy	643	X
2061	Proton NMR Assignments and Secondary Structure of the Snake Venom Protein Echistatin	315	X
2062	Periodicity of Amide Proton Exchange Rates in a Coiled-Coil Leucine Zipper Peptide	35	X
2063	High-resolution Solution Structure of Reduced French Bean Plastocyanin and Comparison with the Crystal Structure of Poplar Plastocyanin	122	X
2065	Two- and Three-Dimensional 1H NMR Studies of a Wheat Phospholipid Transfer Protein: Sequential Resonance Assignments and Secondary Structure	591	X
2066	Characterization of Phosphate Binding in the Active Site of Barnase by Site-Directed Mutagenesis and NMR	85	X
2067	Characterization of Phosphate Binding in the Active Site of Barnase by Site-Directed Mutagenesis and NMR	76	X
2068	Characterization of Phosphate Binding in the Active Site of Barnase by Site-Directed Mutagenesis and NMR	20	X
2069	Characterization of Phosphate Binding in the Active Site of Barnase by Site-Directed Mutagenesis and NMR	13	X
2070	Characterization of Phosphate Binding in the Active Site of Barnase by Site-Directed Mutagenesis and NMR	82	X
2071	Characterization of Phosphate Binding in the Active Site of Barnase by Site-Directed Mutagenesis and NMR	82	X
2074	Determination of the orientations of tryptophan analogues bound to the trp repressor and the relationship to activation	45	X
2075	Structure-Function Relationships in Human Epidermal Growth Factor Studied by Site-Directed Mutagenesis and 1H NMR	10	X
2076	Structure-Function Relationships in Human Epidermal Growth Factor Studied by Site-Directed Mutagenesis and 1H NMR	5	X
2077	Structure-Function Relationships in Human Epidermal Growth Factor Studied by Site-Directed Mutagenesis and 1H NMR	113	X
2078	Structure-Function Relationships in Human Epidermal Growth Factor Studied by Site-Directed Mutagenesis and 1H NMR	71	X
2113	The solution structures of Escherichia coli trp repressor and trp aporepressor at an intermediate resolution	176	X
2114	The solution structures of Escherichia coli trp repressor and trp aporepressor at an intermediate resolution	22	X
2115	The solution structures of Escherichia coli trp repressor and trp aporepressor at an intermediate resolution	19	X
2116	Interaction of Troponin I and Troponin C (Use of the Two-dimensional Nuclear Magnetic Resonance Transferred Nuclear Overhauser Effect to Determine the Structure of the Inhibitory Troponin I Peptide when Bound to Skeletal Troponin C)	85	X
2117	Interaction of Troponin I and Troponin C (Use of the Two-dimensional Nuclear Magnetic Resonance Transferred Nuclear Overhauser Effect to Determine the Structure of the Inhibitory Troponin I Peptide when Bound to Skeletal Troponin C)	85	X
2118	Structural studies on the [But-Cys18](19-37)-fragment of human beta-calcitonin-gene-related peptide	121	X
2151	Sequence-specific 1H n.m.r. Assignments and Determination of the Three-dimensional Structure of Reduced Escherichia coli Glutaredoxin	570	X
2169	Two-dimensional 1H nuclear magnetic resonance study of the (5-55) single-disulphide folding intermediate of bovine pancreatic trypsin inhibitor	401	X
2173	Determination of the orientations of tryptophan analogues bound to the trp repressor and the relationship to activation	46	X
2192	Solution Structure of the 45-Residue MgATP-Binding Peptide of Adenylate Kinase As Examined by 2-D NMR, FTIR, and CD Spectroscopy	276	X
2193	Solution Structure of the 45-Residue MgATP-Binding Peptide of Adenylate Kinase As Examined by 2-D NMR, FTIR, and CD Spectroscopy	23	X
2196	Sequence Specific Assignments in the 1H NMR Spectrum of the Human Inflammatory Protein C5a	462	X
2197	Solution Conformation of a Synthetic Fragment of Human Pituitary Growth Hormone. Two-Dimensional NMR of an alpha-Helical Dimer	210	X
2198	1H NMR Studies of Plastocyanin from Scenedesmus obliquus: Complete Sequence-Specific Assignment, Secondary Structure Analysis, and Global Fold	580	X
2199	Solution Structure of an Analogue of Vasoactive Intestinal Peptide As Determined by Two-Dimensional NMR and Circular Dichroism Spectroscopies and Constrained Molecular Dynamics	189	X
2200	Solution Structure of an Analogue of Vasoactive Intestinal Peptide As Determined by Two-Dimensional NMR and Circular Dichroism Spectroscopies and Constrained Molecular Dynamics	189	X
2201	Solution Structure of Murine Epidermal Growth Factor Determined by NMR Spectroscopy and Refined by Energy Minimization with Restraints	72	X
2202	1H and 15N NMR Characterization of Free and Bound States of an Amphiphilic Peptide Interacting with Calmodulin	171	X
2203	1H and 15N NMR Characterization of Free and Bound States of an Amphiphilic Peptide Interacting with Calmodulin	11	X
2204	The secondary structure of echistatin from 1H-NMR, circular-dichroism and Raman spectroscopy	317	X
2205	1H NMR studies of echistatin in solution Sequential resonance assignments and secondary structure	305	X
2206	Nuclear magnetic resonance studies of the snake toxin echistatin 1H resonance assignments and secondary structure	315	X
2207	Nuclear magnetic resonance studies of the snake toxin echistatin 1H resonance assignments and secondary structure	6	X
2208	1H, 13C and 15N backbone assignments of cyclophilin when bound to cyclosporin A (CsA) and preliminary structural characterization of the CsA binding site	797	X
2209	Determination of the orientations of tryptophan analogues bound to the trp repressor and the relationship to activation	43	X
2217	Structural characterization of a 39-residue synthetic peptide containing the two zinc binding domains from the HIV-1 p7 nucleocapsid protein by CD and NMR spectroscopy	255	X
2218	NMR Study of the Molecular and Electronic Structure of the Heme Cavity of Aplysia Metmyoglobin. Resonance Assignments Based on Isotope Labeling and Proton Nuclear Overhauser Effect Measurements	6	X
2219	Sequential Resonance Assignments of Oxidized High-Potential Iron-Sulfur Protein from Chromatium vinosum	339	X
2220	Sequential Resonance Assignments of Oxidized High-Potential Iron-Sulfur Protein from Chromatium vinosum	8	X
2221	Sequential Resonance Assignments of Oxidized High-Potential Iron-Sulfur Protein from Chromatium vinosum	9	X
2222	Sequential Resonance Assignments of Oxidized High-Potential Iron-Sulfur Protein from Chromatium vinosum	9	X
2223	Sequence-Specific 1H NMR Assignments and Solution Structure of Bovine Pancreatic Polypeptide	248	X
2224	Assignment of the 1H NMR Spectrum and Secondary Structure Elucidation of the Single-Stranded DNA Binding Protein Encoded by the Filamentous Bacteriophage IKe	553	X
2225	Proton NMR Studies of Cucurbita maxima Trypsin Inhibitors: Evidence for pH-Dependent Conformational Change and His25-Tyr27 Interaction	3	X
2226	Proton NMR Studies of Cucurbita maxima Trypsin Inhibitors: Evidence for pH-Dependent Conformational Change and His25-Tyr27 Interaction	3	X
2227	Two-Dimensional NMR Studies of Squash Family Inhibitors. Sequence-Specific Proton Assignments and Secondary Structure of Reactive-Site Hydrolyzed Cucurbita maxima Trypsin Inhibitor III	187	X
2228	Two-Dimensional NMR Studies of Squash Family Inhibitors. Sequence-Specific Proton Assignments and Secondary Structure of Reactive-Site Hydrolyzed Cucurbita maxima Trypsin Inhibitor III	37	X
2229	The Role of an Active Site Histidine in the Catalytic Mechanism of Aspartate Transcarbamoylase	1	X
2231	Preparation of a Lysozyme Derivative in Which Two Domains Are Cross-Linked Intramolecularly between Trp62 and Asp101	50	X
2232	Preparation of a Lysozyme Derivative in Which Two Domains Are Cross-Linked Intramolecularly between Trp62 and Asp101	47	X
2233	Proton Nuclear Magnetic Resonance Studies of Intact Native Bovine Parathyroid Hormone	4	X
2234	Proton Nuclear Magnetic Resonance Studies of Intact Native Bovine Parathyroid Hormone	3	X
2235	Evidence for a Tetrahedral Intermediate Complex during Serpin-Proteinase Interactions	1	X
2236	Evidence for a Tetrahedral Intermediate Complex during Serpin-Proteinase Interactions	1	X
2247	Conformational Changes in the Metal-Binding Sites of Cardiac Troponin C Induced by Calcium Binding	27	X
2249	Structure of Epidermal Growth Factor Bound to Perdeuterated Dodecylphosphocholine Micelles Determined by Two-Dimensional NMR and Simulated Annealing Calculations	315	X
2261	Solution Structure of the Tissue-type Plasminogen Activator Kringle 2 Domain complexed to 6-Aminohexanoic Acid an Antifibrinolytic Drug	213	X
2262	Conformational Isomerism of Endothelin in Acidic Aqueous Media: A Quantitative NOESY Analysis	146	X
2263	Conformational Isomerism of Endothelin in Acidic Aqueous Media: A Quantitative NOESY Analysis	39	X
2265	Two-Dimensional NMR Strategies for Carbon-Carbon Correlations and Sequence-Specific Assignments in Carbon-13 Labeled Proteins	27	X
2266	Fluorescence, CD, Attenuated Total Reflectance (ATR) FTIR, and 13C NMR Characterization of the Structure and Dynamics of Synthetic Melittin and Melittin Analogues in Lipid Environments	2	X
2267	Fluorescence, CD, Attenuated Total Reflectance (ATR) FTIR, and 13C NMR Characterization of the Structure and Dynamics of Synthetic Melittin and Melittin Analogues in Lipid Environments	2	X
2268	Fluorescence, CD, Attenuated Total Reflectance (ATR) FTIR, and 13C NMR Characterization of the Structure and Dynamics of Synthetic Melittin and Melittin Analogues in Lipid Environments	2	X
2269	Fluorescence, CD, Attenuated Total Reflectance (ATR) FTIR, and 13C NMR Characterization of the Structure and Dynamics of Synthetic Melittin and Melittin Analogues in Lipid Environments	2	X
2270	Fluorescence, CD, Attenuated Total Reflectance (ATR) FTIR, and 13C NMR Characterization of the Structure and Dynamics of Synthetic Melittin and Melittin Analogues in Lipid Environments	2	X
2271	Fluorescence, CD, Attenuated Total Reflectance (ATR) FTIR, and 13C NMR Characterization of the Structure and Dynamics of Synthetic Melittin and Melittin Analogues in Lipid Environments	2	X
2272	Immunogenic Peptides Corresponding to the Dominant Antigenic Region Alanine-597 to Cysteine-619 in the Transmembrane Protein of Simian Immunodeficiency Virus Have a Propensity To Fold in Aqueous Solution	82	X
2274	1H Spin System Identifications of S-Sulfonated Insulin B Chain with 2D-NMR	45	X
2275	Identification of Two Antiparallel-sheet Structure of Cobrotoxin in Aqueous Solution by 1H NMR	56	X
2276	Conformational Studies on Bombesin Antagonists: CD and NMR Characterization of [Thr6, Leu13psi(CH2NH) Met14] Bombesin (6-14)	30	X
2277	Syringopeptins, new phytotoxic lipodepsipeptides of Pseudomonas syringae pv. syringae	26	X
2278	1H NMR Sequential Assignments and Identification of Secondary Structural Elements in Oxidized Putidaredoxin, an Electron-Transfer Protein from Pseudomonas	595	X
2279	NMR studies of lantibiotics Assignment of the 1H-NMR spectrum of nisin and identification of interresidual contacts	196	X
2281	1H NMR Assignment and Secondary Structure of the Cell Adhesion Type III Module of Fibronectin	600	X
2282	Two-dimensional 1H-NMR study of bacterioopsin-(34-65)-polypeptide conformation	215	X
2283	Toxin III of the scorpion Androctonus australis Hector: Proton nuclear magnetic resonance assignments and secondary structure	389	X
2284	Toxin III of the scorpion Androctonus australis Hector: Proton nuclear magnetic resonance assignments and secondary structure	7	X
2285	Catalytic mechanism of serine proteases: Reexamination of the pH dependence of the histidyl 1J13C2-H coupling constant in the catalytic triad of alpha-lytic protease	1	X
2288	Assignment of the Three Methionyl Carbonyl Carbon Resonances in Streptomyces Subtilisin Inhibitor by a Carbon-13 and Nitrogen-15 Double -Labeling Technique. A New Strategy for Structural Studies of Proteins in Solution	3	X
2324	The Structural Isomerisation of Human-Muscle Adenylate Kinase as Studied by 1H-Nuclear Magnetic Resonance	3	X
2325	The Structural Isomerisation of Human-Muscle Adenylate Kinase as Studied by 1H-Nuclear Magnetic Resonance	3	X
2326	The Structural Isomerisation of Human-Muscle Adenylate Kinase as Studied by 1H-Nuclear Magnetic Resonance	3	X
2327	The Essential Tyrosine of the Internalization Signal in Lysosomal Acid Phosphatase Is Part of a beta Turn	105	X
2328	Structural determinants of Cys2His2 zinc fingers	169	X
2329	Structural determinants of Cys2His2 zinc fingers	173	X
2331	Individual Assignments of the Amide Proton Resonances Involved in the Triple-Stranded Antiparallel Pleated beta-Sheet Structure of a Long Neurotoxin, Laticauda Semifasciata III from Laticauda semifasciata	34	X
2338	A Two-Dimensional NMR Method for Assignment of Imidazole Ring Proton Resonances of Histidine Residues in Proteins	4	X
2345	Influence of Molecular Correlation Time on the Homonuclear Overhauser Effect in Paramagnetic Proteins	8	X
2346	Influence of Molecular Correlation Time on the Homonuclear Overhauser Effect in Paramagnetic Proteins	8	X
2347	Influence of Molecular Correlation Time on the Homonuclear Overhauser Effect in Paramagnetic Proteins	8	X
2348	Influence of Molecular Correlation Time on the Homonuclear Overhauser Effect in Paramagnetic Proteins	8	X
2352	Structural and Electronic Properties of the Liver Fluke Heme Cavity by Nuclear Magnetic Resonance and Optical Spectroscopy. Evidence for a Distal Tyrosine Residue in a Normally Functioning Hemoglobin.	5	X
2353	15N nuclear magnetic resonance studies of the B domain of Staphylococcal protein A: Sequence specific assignments of the imide 15N resonances of the proline residues and the interaction with human immunoglobin G	3	X
2366	Nuclear Magnetic Resonance Studies of Metal Substituted Horse Cytochrome c	7	X
2367	Nuclear Magnetic Resonance Studies of Metal Substituted Horse Cytochrome c	7	X
2368	Nuclear Magnetic Resonance Studies of Metal Substituted Horse Cytochrome c	7	X
2371	Three-Dimensional 15N-1H-1H and 15N-13C-1H nuclear-magnetic resonance studies of HPr a central component of the phosphoenolpyruvate-dependent phosphotransferase system from Escherichia coli	340	X
2384	1H NMR-Based Determination of the Secondary Structure of Porcine Pancreatic Spasmolytic Polypeptide: One of a New Family of "Trefoil" Motif Containing Cell Growth Factors	587	X
2395	Location of an alpha-Helix in Fragment 96-133 from Bovine Somatotropin by 1H NMR Spectroscopy	241	X
2396	Mapping the Substrate-Binding Site of a Human Class Mu Glutathione Transferase Using Nuclear Magnetic Resonance Spectroscopy	18	X
2410	Sequence-specific 1H, 15N, and 13C assignment of the N-terminal domain of the human oncoprotein MDM2 that binds to p53	364	X
2425	Nature and Locations of the Most Slowly Exchanging Peptide NH Protons in Residues 1 to 19 of Ribonuclease S	14	X
2426	Nature and Locations of the Most Slowly Exchanging Peptide NH Protons in Residues 1 to 19 of Ribonuclease S	1	X
2431	Influence of Propionate Side Chains on the Equilibrium Heme Orientation in Sperm Whale Myoglobin. Heme Resonance Assignments and Structure Determination by Nuclear Overhauser Effect Measurements	8	X
2432	Influence of Propionate Side Chains on the Equilibrium Heme Orientation in Sperm Whale Myoglobin. Heme Resonance Assignments and Structure Determination by Nuclear Overhauser Effect Measurements	8	X
2433	Influence of Propionate Side Chains on the Equilibrium Heme Orientation in Sperm Whale Myoglobin. Heme Resonance Assignments and Structure Determination by Nuclear Overhauser Effect Measurements	8	X
2434	Influence of Propionate Side Chains on the Equilibrium Heme Orientation in Sperm Whale Myoglobin. Heme Resonance Assignments and Structure Determination by Nuclear Overhauser Effect Measurements	8	X
2435	Nuclear Magnetic Resonance Studies on Calmodulin: Calcium-Induced Conformational Change	6	X
2436	Nuclear Magnetic Resonance Studies on Calmodulin: Calcium-Induced Conformational Change	6	X
2437	Nuclear Magnetic Resonance Studies on Calmodulin: Calcium-Induced Conformational Change	6	X
2438	Nuclear Magnetic Resonance Studies on Calmodulin: Calcium-Induced Conformational Change	4	X
2439	Nuclear Magnetic Resonance Studies on Calmodulin: Calcium-Induced Conformational Change	4	X
2440	Nuclear Magnetic Resonance Studies on Calmodulin: Calcium-Induced Conformational Change	4	X
2442	Nucleotide Binding and GTP Hydrolysis by Elongation Factor Tu from Thermus thermophilus As Monitored by Proton NMR	1	X
2443	Nucleotide Binding and GTP Hydrolysis by Elongation Factor Tu from Thermus thermophilus As Monitored by Proton NMR	3	X
2446	Studies of beta-Sheet Structure in Lysozyme by Proton Nuclear Magnetic Resonance. Assignments and Analysis of Spin-Spin Coupling Constants	41	X
2454	Acyl Carrier Protein from Escherichia coli I. Aspects of the Solution Structure As Evidenced by Proton Nuclear Overhauser Experiments at 500 MHz	25	X
2455	pH and Temperature Effects on the Molecular Conformation of the Porcine Pancreatic Secretory Trypsin Inhibitor As Detected by Hydrogen-1 Nuclear Magnetic Resonance	8	X
2457	Preliminary Structural Comparison of the Proteinase Isoinhibitors IIA and IIB from Bull Seminal Plasma Based on Individual Assignments of the 1H Nuclear Magnetic Resonance Spectra by Two-dimensional Nuclear Magnetic Resonance at 500 MHz	71	X
2463	Heternuclear (1H,13C) Two-Dimensional Chemical Shift Correlation NMR Spectroscopy of a Protein. Ferredoxin from Anabaena variabilis	40	X
2472	1H NMR Studies of a Two-Iron: Two-Sulfur Ferredoxin from Halobacterium of the Dead Sea	1	X
2473	Ligand-binding effects on the kringle 4 domain from human plasminogen: a study by laser photo-CIDNP 1H-NMR spectroscopy	17	X
2474	Ligand-binding effects on the kringle 4 domain from human plasminogen: a study by laser photo-CIDNP 1H-NMR spectroscopy	31	X
2475	Ligand-binding effects on the kringle 4 domain from human plasminogen: a study by laser photo-CIDNP 1H-NMR spectroscopy	27	X
2476	A Proton NMR and Nuclear Overhauser Effect (NOE) Study of Human Plasma Prealbumin, Including the Development and Application to Spectral Assignment of a Combined Ring Current Shift and NOE Prediction Program	50	X
2488	Assignment of hyperfine-shifted resonances in yeast ferricytochrome c isozyme 2 using the proton pre-steady-state nuclear Overhauser effect	10	X
2489	Assignment of hyperfine-shifted resonances in yeast ferricytochrome c isozyme 2 using the proton pre-steady-state nuclear Overhauser effect	3	X
2498	1H-NMR Assignment and Secondary structure of Human Insulin-Like Growth Factor-I (IGF-I) in Solution	459	X
2506	Heteronuclear Three-Dimensional NMR Spectroscopy of the Inflammatory Protein C5a	63	X
2512	pH-Dependent Properties of Cobalt(II) Carboxypeptidase A-Inhibitor Complexes	3	X
2513	pH-Dependent Properties of Cobalt(II) Carboxypeptidase A-Inhibitor Complexes	3	X
2527	Two-Dimensional NMR Studies of Squash Family Inhibitors. Sequence-Specific Proton Assignments and Secondary Structure of Reactive-Site Hydrolyzed Cucurbita maxima Trypsin Inhibitor III	157	X
2528	Conformation and Dynamics of an Fab'-Bound Peptide by Isotope-Edited NMR Spectroscopy	16	X
2529	Conformation and Dynamics of an Fab'-Bound Peptide by Isotope-Edited NMR Spectroscopy	19	X
2539	Determination of the Nuclear Magnetic Resonance Solution Structure of the DNA-binding Domain (Residues 1 to 69) of the 434 Repressor and Comparison with the X-ray Crystal Structure	501	X
2542	1H and 15N NMR Study of Human Lysozyme	148	X
2546	Three-Dimensional Solution Structure of the E3-Binding Domain of the Dihydrolipoamide Succinyltransferase Core from the 2-Oxoglutarate Dehydrogenase Multienzyme Complex of Escherichia coli	343	X
2547	Three-Dimensional Solution Structure of the E3-Binding Domain of the Dihydrolipoamide Succinyltransferase Core from the 2-Oxoglutarate Dehydrogenase Multienzyme Complex of Escherichia coli	6	X
2573	Fast Internal Main-Chain Dynamics of Human Ubiquitin	70	X
2574	Fast Internal Main-Chain Dynamics of Human Ubiquitin	1	X
2575	Sequence-Specific 1H NMR Assignments and Secondary Structure of the Streptococcal Protein G B2-Domain	352	X
2580	Sequence-specific resonance assignment and secondary structure of (1-71) bacterioopsin	464	X
2590	Transmembrane Region of Wild-type and Mutant M13 Coat Proteins Conformational Role of beta-Branched Residues	1	X
2591	Transmembrane Region of Wild-type and Mutant M13 Coat Proteins Conformational Role of beta-Branched Residues	1	X
2592	Transmembrane Region of Wild-type and Mutant M13 Coat Proteins Conformational Role of beta-Branched Residues	1	X
2606	Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes	2	X
2607	Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes	2	X
2608	Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes	2	X
2609	Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes	2	X
2610	Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes	2	X
2611	Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes	2	X
2612	Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes	2	X
2613	Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes	2	X
2614	Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes	2	X
2615	Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes	2	X
2616	Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes	2	X
2617	Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes	2	X
2618	Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes	2	X
2619	Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes	2	X
2620	Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes	2	X
2621	Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes	1	X
2622	Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes	1	X
2623	Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes	1	X
2624	Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes	2	X
2625	Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes	2	X
2627	Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes	2	X
2628	Nitrogen-15 NMR Spectroscopy of the Catalytic-Triad Histidine of a Serine Protease in Peptide Boronic Acid Inhibitor Complexes	1	X
2630	Multidimensional 1H and 15N NMR investigation of glutamine-binding protein of Escherichia coli	1	X
2631	Multidimensional 1H and 15N NMR investigation of glutamine-binding protein of Escherichia coli	1	X
2632	Multidimensional 1H and 15N NMR investigation of glutamine-binding protein of Escherichia coli	2	X
2638	1H NMR and UV-Vis Spectroscopic Characterization of Sulfonamide Complexes of Nickel(II)-Carbonic Anhydrase. Resonance Assignments Based on NOE Effects	1	X
2639	1H NMR and UV-Vis Spectroscopic Characterization of Sulfonamide Complexes of Nickel(II)-Carbonic Anhydrase. Resonance Assignments Based on NOE Effects	1	X
2640	1H NMR and UV-Vis Spectroscopic Characterization of Sulfonamide Complexes of Nickel(II)-Carbonic Anhydrase. Resonance Assignments Based on NOE Effects	4	X
2641	1H NMR and UV-Vis Spectroscopic Characterization of Sulfonamide Complexes of Nickel(II)-Carbonic Anhydrase. Resonance Assignments Based on NOE Effects	4	X
2642	1H NMR and UV-Vis Spectroscopic Characterization of Sulfonamide Complexes of Nickel(II)-Carbonic Anhydrase. Resonance Assignments Based on NOE Effects	4	X
2651	Site-Directed Mutagenesis and 1H NMR Spectroscopy of an Interdomain Segment in the Pyruvate Dehydrogenase Multienzyme Complex of Escherichia coli	2	X
2652	Hydrogen-Exchange Kinetics of the Indole NH Proton of the Buried Tryptophan in the Constant Fragment of the Immunoglobulin Light Chain	5	X
2707	Proton Magnetic Resonance Investigation of the Influence of Quaternary Structure on Iron-Histidine Bonding in Deoxyhemoglobins	1	X
2708	Proton Magnetic Resonance Investigation of the Influence of Quaternary Structure on Iron-Histidine Bonding in Deoxyhemoglobins	1	X
2709	Proton Magnetic Resonance Investigation of the Influence of Quaternary Structure on Iron-Histidine Bonding in Deoxyhemoglobins	1	X
2710	Proton Magnetic Resonance Investigation of the Influence of Quaternary Structure on Iron-Histidine Bonding in Deoxyhemoglobins	1	X
2711	Proton Magnetic Resonance Investigation of the Influence of Quaternary Structure on Iron-Histidine Bonding in Deoxyhemoglobins	1	X
2712	Proton Magnetic Resonance Investigation of the Influence of Quaternary Structure on Iron-Histidine Bonding in Deoxyhemoglobins	1	X
2718	A 1H-NMR study of human interleukin-1beta Sequence-specific assignment of aromatic residues using site-directed mutant proteins	21	X
2719	A 1H-NMR study of human interleukin-1beta Sequence-specific assignment of aromatic residues using site-directed mutant proteins	2	X
2763	Comparison of the Structure and Dynamics of Chicken Gizzard and Rabbit Cardiac Tropomyosins: 1H NMR Spectroscopy and Measurement of Amide Hydrogen Exchange Rates	2	X
2764	NMR studies of the trp repressor from Escherichia coli Characterisation and assignments of residue types	7	X
2768	Different conformations for the same polypeptide bound to chaperones DnaK and GroEL	10	X
2784	Dynamics of Methyl Groups in Proteins As Studied by Proton-Detected 13C NMR Spectroscopy. Application to the Leucine Residues of Staphylococcal Nuclease	99	X
2785	Dynamics of Methyl Groups in Proteins As Studied by Proton-Detected 13C NMR Spectroscopy. Application to the Leucine Residues of Staphylococcal Nuclease	99	X
2786	Complete Assignment of Aromatic 1H Nuclear Magnetic Resonances of the Tyrosine Residues of Hen Lysozyme	12	X
2787	Sequential Individual Resonance Assignments in the 1H Nuclear-Magnetic-Resonance Spectrum of Cardiotoxin VII 2 from Naja mossambica mossambica	302	X
2798	Proton NMR Studies of Cucurbita maxima Trypsin Inhibitors: Evidence for pH-Dependent Conformational Change and His25-Tyr27 Interaction	13	X
2799	Proton NMR Studies of Cucurbita maxima Trypsin Inhibitors: Evidence for pH-Dependent Conformational Change and His25-Tyr27 Interaction	13	X
2802	Determination of the Molecular Dynamics of Alamethicin Using 13C NMR: Implications for the mechanism of Gating of a Voltage-Dependent Channel	33	X
2804	Solution Structure of Endothelin-3 Determined Using NMR Spectroscopy	147	X
2852	1H-n.m.r. studies of the fibronectin 13kDa collagen-binding fragment Evidence for autonomous conserved typeI and type II domain folds	127	X
2853	1H-n.m.r. studies of the fibronectin 13kDa collagen-binding fragment Evidence for autonomous conserved typeI and type II domain folds	1	X
2856	Sequential 1H NMR Assignments of Kistrin, a Potent Platelet Aggregation Inhibitor and Glycoprotein IIB-IIIa Antagonist	391	X
2858	Comparisons of Ring-Current Shifts Calculated from the Crystal Structure of Egg White Lysozyme of Hen with the Proton Nuclear Magnetic Resonance Spectrum of Lysozyme in Solution	109	X
2868	Sequential assignment of the proton NMR spectrum of isolated alpha(CO) chains from human adult hemoglobin	619	X
2917	Study of Tryptophan Residues of Lysozyme Using 1H Nuclear Magnetic Resonance	8	X
2928	3D structure of bovine pancreatic ribonuclease A in aqueous solution: An approach to tertiary structure determination from a small basis of 1H NMR NOE correlations	34	X
2935	1H NMR Study of the Molecular and Electronic Structure of Paramagnetic Iron Chlorin Complexes of Myoglobin: Dynamic Heterogeneity of the Heme Pocket	1	X
2936	1H NMR Study of the Molecular and Electronic Structure of Paramagnetic Iron Chlorin Complexes of Myoglobin: Dynamic Heterogeneity of the Heme Pocket	1	X
2939	Solution Structures of Cyclic and Dicyclic Analogues of Growth Hormone Releasing factor as Determined by Two-Dimensional NMR an CD Spectroscopies and Constrained Molecular Dynamics	212	X
2940	Solution Structures of Cyclic and Dicyclic Analogues of Growth Hormone Releasing factor as Determined by Two-Dimensional NMR an CD Spectroscopies and Constrained Molecular Dynamics	216	X
2941	Solution Structures of Cyclic and Dicyclic Analogues of Growth Hormone Releasing factor as Determined by Two-Dimensional NMR an CD Spectroscopies and Constrained Molecular Dynamics	196	X
2948	Evidence for the presence of a secondary structure at the dibasic processing site of prohormone: the pro-ocytocin model	107	X
2950	Assessment of cheY binding regions using 2D NMR and paramagnetic ligands	21	X
2951	Assessment of cheY binding regions using 2D NMR and paramagnetic ligands	19	X
2956	Importance of Protein and DNA Phosphate Ester Backbone Flexibility in Protein-DNA Recognition	320	X
2957	Complete Assignment of the 1H NMR Spectrum of the Aromatic Residues of Lysozyme	65	X
2958	High-resolution Three-Dimensional Structure of Reduced Recombinant Human Thioredoxin in Solution	9	X
2959	High-resolution Three-Dimensional Structure of Reduced Recombinant Human Thioredoxin in Solution	9	X
2960	Computer-Aided Sequential Assignment of Protein 1H NMR Spectra	27	X
2968	Hydrogen exchange in Pseudomonas cytochrome c-551	77	X
2990	Different conformations for the same polypeptide bound to chaperones DnaK and GroEL	10	X
2991	Different conformations for the same polypeptide bound to chaperones DnaK and GroEL	10	X
2999	Sequence-Specific Assignments of the 1H Nuclear Magnetic Resonance Spectra of Reduced High-Potential Ferredoxin (HiPIP) from Chromatium vinosum	412	X
3000	Sequence-Specific Assignments of the 1H Nuclear Magnetic Resonance Spectra of Reduced High-Potential Ferredoxin (HiPIP) from Chromatium vinosum	25	X
3032	Changing the Inhibitory Specificity and Function of the Proteinase Inhibitor Eglin c by Site-Directed Mutagenesis: Functional and Structural Investigation	117	X
3036	Effect of Trifluoroethanol on Protein Secondary Structure: An NMR and CD Study Using a Synthetic Actin Peptide	156	X
3065	Studies of the structure of bacteriophage lambda cro protein in solution Analysis of the aromatic region of the 1H NMR spectrum	2	X
3078	1H NMR Assignments and Secondary Structure of Human beta2-Microglobulin in Solution	704	X
3079	1H NMR Assignments and Secondary Structure of Human beta2-Microglobulin in Solution	7	X
3084	The interaction of acetate and formate with cobalt carbonic anhydrase An NMR study	22	X
3085	The interaction of acetate and formate with cobalt carbonic anhydrase An NMR study	22	X
3118	Stoichiometry of Calcium Binding to a Synthetic Heterodimeric Troponin-C Domain	2	X
3119	Stoichiometry of Calcium Binding to a Synthetic Heterodimeric Troponin-C Domain	2	X
3127	Proton Nuclear Magnetic Resonance Studies of Porcine Intestinal Calcium Binding Protein	4	X
3128	Proton Nuclear Magnetic Resonance Studies of Porcine Intestinal Calcium Binding Protein	4	X
3322	Characterisation of a cellulosome dockerin domain from the anaerobic fungus Piromyces equi	363	X
3394	The solution structure of the leucine zipper motif of the Jun oncoprotein homodimer	335	X
3404	A Single-Stranded Amphiphatic alpha-Helix in Aqueous Solution: Design, Structural Characterization, and Its Application for Determining alpha-Helical Propensities of Amino Acids	121	X
3427	NMR Solution Structure of Human Parathyroid Hormone(1-34)	274	X
3433	1H and 15N assignments and secondary structure of the Src Sh3 domain	486	X
3435	Proton NMR Conformational Study of an Annexin I Fragment: Influence of a Phospholipidic Micellar Environment	215	X
3436	Proton NMR Conformational Study of an Annexin I Fragment: Influence of a Phospholipidic Micellar Environment	218	X
3437	Proton NMR Conformational Study of an Annexin I Fragment: Influence of a Phospholipidic Micellar Environment	222	X
3440	1H- and 15N-NMR assignment and solution structure of the chemotactic Escherichia coli Che Y protein	995	X
3441	1H-NMR analysis of turkey egg-white lysozyme and comparison with hen egg-white lysozyme	657	X
3442	Sequential assignment of proton resonances in the NMR spectrum of Zn-substituted alpha chains from human hemoglobin	647	X
3449	Stabilized NMR structure of human parathyroid hormone(1-34)	265	X
3456	Two-dimensional 1H NMR study of recombinant insect defensin A in water: Resonance assignments, secondary structure and global folding	245	X
3466	Proton Nuclear Magnetic Resonance Sequential Assignments and Secondary Structure of an Immunoglobulin Light Chain-Binding Domain of Protein L	516	X
3471	Symmetrical Rearrangement of the Cation-Binding Sites of Parvalbumin upon Ca2+/Mg2+ Exchange. A Study by 1H 2D NMR	51	X
3472	Symmetrical Rearrangement of the Cation-Binding Sites of Parvalbumin upon Ca2+/Mg2+ Exchange. A Study by 1H 2D NMR	49	X
3485	1H-n.m.r. study of the solution properties and secondary structure of neurotoxin III from the sea anemone Anemonia sulcata	158	X
3524	13C NMR Determination of the Tautomeric and Ionization States of Folate in Its Complexes with Lactobacillus casei Dihydrofolate Reductase	26	X
3525	13C NMR Determination of the Tautomeric and Ionization States of Folate in Its Complexes with Lactobacillus casei Dihydrofolate Reductase	26	X
3548	Two-dimensional nuclear magnetic resonance study of brain natriuretic peptide in aqueous solution.	194	X
4001	1H, 13C, and 15N resonance assignments for reduced apo-S100beta	1277	X
4010	Resonance Assignments for the OB-fold Sub-Domain of Staphylococcal Nuclease (SNOB) -> Nuclease 1-103 (V66L, G88V)	852	X
4011	1H and 15N Assignments and Secondary Structure of the Starch-binding Domain of Glucoamylase from Aspergillus niger	833	X
4012	Structure of the Acid State of E. coli Ribonuclease HI	552	X
4019	1H, 13C and 15N Resonance Assignments of Recombinant Poplar Plastocyanin	1194	X
4020	Solution Structure of the Immunodominant Region of Protein G of Bovine Respiratory Syncytial Virus	286	X
4022	Sequential NMR Assignment of 1H, 13C, and 15N Resonances of Human Carbonic Anhydrase I (HCAI) by Triple-Resonance NMR Techniques and Extensive Amino Acid Specific 15N Labeling	1847	X
4023	1H, 13C and 15N Resonance Assignments for the Z Domain of Staphylococcal Protein A at pH* 6.5 and Temperature of 30 deg. C	928	X
4024	1H Resonance Assignments for the First Zinc Finger Domain of SWI5	430	X
4027	Sequence Specific 1H, 13C, and 15N assignment of the S. aureus TMP-resistant dihydrofolate reductase mutant DHFR(F98Y) in the ternary complex with TMP and NADPH	1990	X
4028	Chemical Shift Mapping of the RNA-binding Interface to the Multiple-RBD Protein Sex-Lethal: Chemical Shifts for the Protein-RNA Complex	718	X		X
4029	Chemical Shift Mapping of the RNA-binding Interface to the Multiple-RBD Protein Sex-Lethal: Chemical Shifts for the Free Protein	757	X
4030	Refinement of the Solution Structure of Calcium-Free, Myristoylated Recoverin	2471	X
4031	1H, 13C and 15N Resonance Assignments for the Bovine Pancreatic Ribonuclease A at pH* 4.6 and Temperature of 20 Deg. C	731	X
4032	1H, 13C and 15N Resonance Assignments for the Bovine Pancreatic [C65S, C72S] Ribonuclease A at pH* 4.6 and Temperature of 20 deg. C	726	X
4033	NMR Spectroscopic Studies of the DNA Binding Domain of the Monomer-Binding Nuclear Orphan Receptor, Human ERR2. The Carboxy-Terminal Extension to the Zinc-Finger Region is Unstructured in the Free Form of the Protein.	467	X
4034	NMR Spectroscopic Studies of the DNA Binding Domain of the Monomer-Binding Nuclear Orphan Receptor, Human ERR2. The Carboxy-Terminal Extension to the Zinc-Finger Region is Unstructured in the Free Form of the Protein.	673	X
4035	Solution Structure of the DNA-Binding Domain of a Human Papillomavirus E2 Protein: Evidence for Flexible DNA-Binding Regions	979	X
4036	Sequential 1H, 13C, and 15N, NMR Assignments and Solution Conformation of Apokedarcidin	1107	X
4037	Secondary Structure and Backbone Resonance Assignments of the Periplasmic Cyclophilin Type Peptidyl-Prolyl Isomerase from Escherichia Coli	804	X
4038	Detailed NMR Analysis of the Heme-Protein Interactions in Component IV Glycera Dibranchiata Monomeric Hemoglobin-CO	1702	X
4039	Assignments of the 1H, 15N and 13C resonances of the calcium-free form of the first C2-domain of synaptotagmin I	1673	X
4040	Main-Chain NMR Assignments for AsiA	506	X
4041	Assignments of the 1H, 15N and 13C resonances of the calcium-bound form of the first C2-domain of synaptotagmin I	1653	X
4042	Sequence-specific Assignment of the 1H and 15N Nuclear Magnetic Resonance Spectra of the Reduced Recombinant High-potential Iron-sulfur Protein I from Ectothiorhodospira halophila	491	X
4043	Solution Structure of an Old World-like Neurotoxin from the Venom of the New World Scorpion Centruroides sculpturatus Ewing	406	X
4044	Secondary Structure of Uracil-DNA Glycosylase Inhibitor Protein	586	X
4045	Solution Structure of the C-Terminal Single-Stranded DNA-Binding Domain of Escherichia Coli Topoisomerase I	1400	X
4046	NMR Evidence for Similarities between the DNA-Binding Regions of Drosophila melanogaster Heat Shock Factor and the Helix-Turn-Helix and HNF-3/forkhead Families of Transcription Factors	946	X
4047	1H, 13C, 15N Resonance Assignments and Secondary Structure Analysis of the HU Protein from Bacillus stearothermophilus Using Two- and Three- Dimensional Double- and Triple-Resonance Heteronuclear Magnetic Resonance Spectroscopy	1169	X
4048	Solution Structure of the tetrameric minimum transforming domain of p53	446	X
4049	Solution Structure of the Amino-Terminal Fragment of Urokinase-Type Plasminogen Activator	1342	X
4050	1H, 13C, 15N Chemical Shift Assignments for Reduced Clostridium Pasteurianum Rubredoxin	426	X
4051	1H, 13C, and 15N Chemical Shift Assignments for Oxidized Clostridium pasteurianum Rubredoxin	328	X
4052	Solution structures of Staphylococcal Nuclease from multidimensional, multinuclear NMR: nuclease-H124L and its ternary complex with Ca2+ and Thymidine-3'-5'-bisphosphate	1655	X
4053	Solution structures of Staphylococcal Nuclease from multidimensional, multinuclear NMR: nuclease-H124L and its ternary complex with Ca2+ and Thymidine-3'-5'-bisphosphate	1668	X
4054	Alpha-Helical Coiled Coil Trimerization Domain of Chicken Cartilage Matrix Protein (Reduced C5-C7 Disulfide Bonds)	242	X
4055	Alpha-Helical Coiled Coil Trimerization Domain of Chicken Cartilage Matrix Protein (Oxidized)	533	X
4056	Solution Structure of Calmodulin-W-7 Complex: The Basis of Diversity in Molecular Recognition	1588	X
4057	Three-Dimensional Structures of Three Engineered Cellulose-Binding Domains of Cellobiohydrolase I from Trichoderma reesei	216	X
4058	Three-Dimensional Structures of Three Engineered Cellulose-Binding Domains of Cellobiohydrolase I from Trichoderma reesei	210	X
4059	Three-Dimensional Structures of Three Engineered Cellulose-Binding Domains of Cellobiohydrolase I from Trichoderma reesei	213	X
4060	Multinuclear Backbone NMR Resonance Assignments and the Secondary Structure of Escherichia coli Thioesterase/Protease I - A Member of a New Subclass of Lipolytic Enzymes	1246	X
4061	Overexpression of Myoglobin and Assignment of Its Amide, C Alpha and C Beta Resonances	553	X
4062	1H and 15N Resonance Assignments and Secondary Structure of the Carbon Monoxide Complex of Sperm Whale Myoglobin	998	X
4063	Resonance Assignments for Oncostatin M, a 24-kDa Alpha-Helical Protein	1171	X
4064	Assignments, Secondary Structure and Dynamics of the Inhibitor-Free Catalytic Fragment of Human Fibroblast Collagenase	1968	X
4065	Sequence-Specific Resonance Assignments for a Designed Four-Alpha-Helix-Bundle Protein	714	X
4066	Amplification of One-Bond 1H/2H Isotope Efects on 15N Chemical Shifts in Clostridium pasteurianum Rubredoxin by Fermi-Contact Effects through Hydrogen Bonds --Fe(III)	8	X
4067	Complete 1H and Partial 13C Resonance Assignments at 37 and 22 C for Brazzein, an Intensely Sweet Protein	1231	X
4068	Assignment of 1H, 13C, and 15N Signals of Turkey Ovomucoid Third Domain at pH 2.0	575	X
4069	Secondary Structure Determination of 15N-Labelled Human Long-[Arg-3]-Insulin-Like Growth Factor-I by Multidimensional NMR Spectroscopy	625	X
4070	Sequence-Specific 1H, 15N and 13C Assignments of the Periplasmic Chaperone FimC from Escherichia coli	2431	X
4071	1H Chemical Shift Assignments and Interproton 3JNHA Coupling Constants of Raphanus sativus Antifungal Protein 1 (Rs-AFP1), a Plant Defensin Isolated from Seeds of Radish	341	X
4072	Sequence Specific 1HA, 15N, 13CA, and 13CB Assignments for RNA-1 Modulator Protein ROM	303	X
4073	Backbone 1H, 13C and 15N Chemical Shift Assignments for Oxidized Human Ferredoxin	538	X
4074	Backbone 1H, 13C and 15N Chemical Shift Assignments for Reduced Human Ferredoxin	580	X
4075	Backbone NMR Assignments and Secondary Structure of the N Terminal Domain of DnaB Helicase from E. coli	636	X
4076	1H, 15N, 13C Chemical Shift Assignments of Outer Surface Protein A from Borrelia burgdorferi	2225	X
4078	1H, 15N and 13C Resonance Assignments and Secondary Structure of Group II Phospholipase A2 from Agkistrodon piscivorus piscivorus: Presence of an Amino-Terminal Helix in Solution	1326	X
4079	Structure of the A-Domain of HMG1 and Its Interaction with DNA As Studied by Heteronuclear Three- and Four-Dimensional NMR Spectroscopy	965	X
4080	NMR Solution Structure of Calcium-Saturated Skeletal Muscle Troponin C	989	X
4081	Sequence-specific 1H, 13C and 15N NMR Assignments of Recombinant Human Interferon Alpha-2a	2089	X
4082	Characterization of the Three-Dimensional Solution Structure of Human Profilin: 1H, 13C, and 15N NMR Assignments amd Global Folding Pattern	1521	X
4083	Assignments, Secondary Structure, Global Fold, and Dynamics of Chemotaxis Y Protein Using Three- and Four-Dimensional Heteronuclear (13C, 15N) NMR Spectroscopy	1436	X
4084	Determination of the Secondary Structure and Folding Topology of an RNA Binding Domain of Mammalian hnRNP A1 Protein Using Three-Dimensional Heteronuclear Magnetic Resonance Spectroscopy	943	X
4085	Resonance Assignments and Solution Structure of the Second RNA-Binding Domain of Sex-lethal Determined by Multidimensional Heteronuclear Magnetic Resonance	995	X
4086	Tumor Suppressor p16ink4a: Structural Characterization of Wild-Type and Mutant Proteins by NMR and Circular Dichroism	1137	X
4087	E2 DNA-binding domain from papillomavirus bpv-1	1142	X
4088	Solution Structure of Compstatin, a Potent Complement Inhibitor	94	X
4089	Peptide Deformylase Catalytic Core (Residues 1 - 147)	1757	X
4090	Solution NMR Structure of the I gamma Subdomain of the Mu end DNA Binding Domain of Mu Phage Transposase, Minimized Average Structure	759	X
4091	1H, 15N, 13C, and 13CO Assignments and Secondary Structure Determination of Basic Fibroblast Growth Factor using 3D Heteronuclear NMR Spectroscopy	1897	X
4092	Complete Heteronuclear NMR Resonance Assignments, Secondary Structure, and Mapping of Core Binding Factor a Binding Site for Core Binding Factor b (1-141)	1835	X
4093	Secondary Structure of the Ribonuclease H Domain of the Human Immunodeficiency Virus Reverse Transcriptase in Solution Using Three-Dimensional Double and Triple Resonance Heteronuclear Magnetic Resonance Spectroscopy	599	X
4094	1H, 15N, and 13CO Assignments of Human Interleukin-4 Using Three Dimensional Double- and Triple-Resonance Heteronuclear Magnetic Resonance Spectroscopy	1712	X
4095	From Genetic to Structural Characterization of a New Class of RNA-Binding Domain Within the SacY/BglG family of Antiterminator	476	X
4097	Backbone 1H, 13C and 15N Chemical Shift Assignment for the HIV-1 RNase H Domain	439	X
4098	1H, 15N and 13C Resonance Assignments and Secondary Structure of Apo Liver Fatty Acid-Binding Protein	1276	X
4099	The Ca2+-Dependent Interaction of S100B(bb)with a Peptide Derived from p53	2054	X
4100	Resonance Assignments of the Mrf-2 DNA-binding Domain	1199	X
4101	1H, 13C, and 15N Resonance Assignments of Fusarium Solani Pisi Cutinase and Preliminary Features of the Structure in Solution	2503	X
4102	1H, 13C and 15N NMR Backbone Assignments of 25.5 KDa Metallo-beta-lactamase	1305	X
4103	1H, 13C and 15N Chemical Shift Assignments of the 14mer DNA Duplex BS2	468		X
4104	1H, 13C and 15N Chemical Shift Assignments of the 14mer DNA Duplex BS2 in the Complex with the Antennapedia Homeodomain	456	X	X
4105	1H, 13C, and 15N Resonance Assignments for Reduced Calcium-Bound S100B from Rat	1029	X
4106	Solution Structure of the 30 Kda N-terminal Domain of Enzyme I of the Escherichia coli Phosphoenolpyruvate:Sugar Phosphotransferase System by Multidimensional NMR	2272	X
4107	Acid Denatured Cold Shock Protein A (CspA)	460	X
4108	Acid/Urea denatured cold shock protein A (CspA)	282	X
4109	Sequence Specific 1H, 13C and 15N Resonance Assignment of Rat CD2 Domain 1	3278	X
4110	1H, 13C, 15N Resonance Assignment of the 20 KDa Double Stranded RNA Binding Domain of PKR	1936	X
4111	Sequential Assignment of the Triple Labelled 30 kDa Cell-adhesion Domain from Enteropathogenic E.coli	972	X
4112	Sequence-specific 1H Assignment and Secondary Structure of the Bacteriocin AS-48 Cyclic Peptide.	511	X
4113	1H, 13C, and 15N NMR Resonance Assignments of Vaccinia Glutaredoxin-1 in the Fully Reduced Form	1380	X
4114	Chicken B-MYB DNA Binding Domain, Repeat 2 and Repeat 3	1302	X
4115	Assignment of 1H, 13C and 15N Signals of the Inhibitor Protein Im9 Bound to the DNase Domain of Colicin E9	864	X
4116	1H, 13C and 15N Chemical Shift Assignments of the Colicin E9 Immunity Protein from Escherichia coli	847	X
4117	1H, 15N and 13C Chemical Shift Assignment of the Guanine Nucleotide Exchange Domain of Human Elongation Factor-one Beta	1107	X
4120	NMR Structure of a Classical Pseudoknot: Interplay of Single- and Double-Stranded RNA	636			X
4121	1H, 13C and 15N Assignment of the Isl-1 Homeodomain	704	X
4122	Solution Structure of the Human Hck SH3 Domain and Identification of its Ligand Binding Site	866	X
4123	Main-chain Signal Assignment for the PDZ2 Domain from Human Protein Tyrosine Phosphatase hPTP1E and its Complex with a C-terminal Peptide from the Fas Receptor	593	X
4124	Main-chain Signal Assignment for the PDZ2 Domain from Human Protein Tyrosine Phosphatase hPTP1E and its Complex with a C-terminal Peptide from the Fas Receptor	176	X
4125	The NMR Structure of 31mer RNA Domain of Escherichia Coli RNase P RNA Using Its Non-uniformly Deuterium Labelled Counterpart [the 'NMR-window' concept]	192			X
4126	Solution Structure and Dynamics of a De Novo Designed Three-helix Bundle Protein	880	X
4127	Sequence-specific 1H, 13C, and 15N Resonance Assignment of the Origin DNA-binding Domain of SV40 T Antigen	1490	X
4128	NMR Backbone Assignments of the Cyanobacterial Transcriptional Factor, SmtB, that Senses the Zinc Concentration in the Cell	351	X
4129	1H and 15N Resonance Assignment of the Calcium-bound Form of the Nereis Diversicolor Sarcoplasmic Calcium(2+)-binding Protein.	1210	X
4130	1H, 15N, 13C Chemical Shifts of Recombinant Rat Ferrocytochrome b5, A conformation	901	X
4131	1H, 15N, 13C chemical shifts of recombinant rat ferrocytochrome b5, B conformation	901	X
4132	Backbone Resonance Assignments of Human UBC9	1036	X
4133	The Structure of the N-terminus of Striated Muscle Alpha-Tropomyosin in a Chimeric Peptide: Solution Nuclear Magnetic Resonance Structure and Circular Dichroism Studies.	249	X
4134	NMR Assignments for Denatured LysN	754	X
4135	Assignments of a RNA Duplex Including the C-U Mismatch: Unusual Chemical Shifts of a Cytidine Amino Group in the C-U Pair.	180			X
4136	Chemical Shift Assignments, 3JHNHA Coupling Constants and Secondary Structure of E.coli Multidrug Resistance Protein (EmrE)	1135	X
4137	Amplification of One-Bond 1H/2H Isotope Efects on 15N Chemical Shifts in Clostridium pasteurianum Rubredoxin by Fermi-Contact Effects Through Hydrogen Bonds --Fe(II)	8	X
4138	Proton Resonance Assignments of RC-RNase	768	X
4140	Sequence-specific 1H, 13C and 15N Assignment of the EH1 Domain of Mouse Eps15	1399	X
4141	vnd/NK-2 Homeodomain DNA Complex Protein 1H, 13C, and 15N Chemical Shifts and HNHA Coupling Constant	1313	X	X
4142	1H Chemical Shift Assignments of the Complex between Palmitate and a Non-Specific Lipid Transfer Protein (ns-LTP1) Isolated from Barley Seeds	582	X
4143	1H and 15N Resonance Assignment of Neural Cell Adhesion Molecule module 2	733	X
4144	1H, 13C, 15N Sequential Assignment of the RNA Polymerase 'H' Subunit from Methanococcus jannaschii	438	X
4145	Assignment of 1H and 15N Resonances of Murine Tec SH3 Domain	535	X
4146	Solution Structure of the Transmembrane H+-Transporting Subunit c of the F1Fo ATP Synthase	946	X
4147	Resonance Assignment and Secondary Structure of the Cold Shock Domain of the Human YB-1 Protein	803	X
4148	Solution Structure of the Cellulose-binding Domain of Endoglucanase I from Trichoderma reesei and Its Interaction with Cello-oligosaccharides	218	X
4149	Solution Structure of Gallium-Substituted Putidaredoxin Mutant: GaPdx C85S	1280	X
4150	The Signal Transducer gp130: Solution Structure of the Carboxy-terminal Domain of the Cytokine Receptor Homology Region	1272	X
4151	1H, 13C, and 15N Assignment and Secondary Structure of the High pH Form of Subunit c of the F1FO ATP Synthase	898	X
4152	1H, 13C and 15N Backbone Resonance Assignment of Escherichia coli Adenylate Kinase, a 23.6 kDa Protein	1490	X
4153	High-Resolution Solution Structure of the Retinoid X Receptor DNA-Binding Domain	863	X
4154	13C and Stereospecific 13C and 1H Resonance Assignments for Oxidized Putidaredoxin	1097	X
4155	Solution Structure of Eotaxin: A Chemokine that Selectively Recruits Eosinophils in Allergic Inflammation	542	X
4156	The Structure in Solution of the b Domain of Protein Disulfide Isomerase	1350	X
4157	Three-dimensional Solution Structure of Lactoferricin B, an Antimicrobial Peptide Derived from Bovine Lactoferrin	186	X
4158	1H and 15N Nuclear Magnetic Resonance Chemical Shifts of the Cytotoxic Ribonuclease Alpha-sarcin	1062	X
4159	Solution Structure of LSIII, a Long Neurotoxin from the Venom of Laticauda semifasciata	387	X
4160	Resonance Assignments of the Tn916 Integrase DNA-Binding Domain and Integrase: DNA Complex	855	X
4161	1H, 13C and 15N Assignment of the DNA Binding Domain of Interferon Regulatory Factor-2	1276	X
4162	1H, 13C and 15N Resonance Assignment of the Neural Cell Adhesion Molecule Module-1	1180	X
4163	1H Chemical Shift Assignments and Interproton 3JNHA and 3JHAHB Coupling Constants of Aesculus hippocastanum Antimicrobial Protein 1 (Ah-AMP1), a Plant Defensin Isolated from Horse Chestnuts.	321	X
4164	Bacterial Iron Transport: 1H NMR Determination of the Three-dimensional Structure of the Gallium Complex of Pyoverdin G4R, the Peptidic Siderophore of Pseudomonas putida G4R	42	X
4165	1H, 13C, and 15N Chemical Shift Assignments for Tn916 N-terminal DNA Binding Domain complex with DNA	978	X	X
4166	Backbone H, CA, N Chemical Shift Assignments for C2A/Ca2+ Binary Complex	355	X
4167	Backbone H, CA, N chemical shift assignments for C2A/Ca2+/6PS ternary complex	370	X
4168	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Receptor Binding Domain of Human Alpha-2-macroglobulin	539	X
4169	Bacterial Iron Transport: 1H NMR Determination of the Three-dimensional Structure of the Gallium Complex of Pyoverdin G4R, the Peptidic Siderophore of Pseudomonas putida G4R	51	X
4170	2'-Deoxy-Isoguanosine Base Paired to Thymidine, NMR Minimized Average Structure	131		X
4171	Backbone and C beta Assignments of the Anti-gp120 Antibody Fv Fragment Complexed with an Antigenic Peptide	1088	X
4172	Response Element of the Orphan Nuclear Receptor Rev-erb Beta	296		X
4173	Solution Structure of the Catalytic Domain of Human Stromelysin-1 Complexed to a Potent, Non-peptidic Inhibitor	1077	X
4174	Chemical Shift Assignments of the Mg2+-Loaded State of the N-Terminal Domain of Calmodulin	615	X
4175	SL3 Hairpin from the Packaging Signal of HIV-1	194			X
4176	NMR Solution Structure of a DNA Dodecamer Containing Single G:T Mismatches	123		X
4177	Monocyte Chemoattractant Protein-3	894	X
4179	1H Chemical Shift Assignments for the Peptide H1a	101	X
4180	1H Chemical Shift Assignments for the Peptide L1	90	X
4181	The Solution Structure of Parsley [2Fe-2S] Ferredoxin	570	X
4182	Solution Structure of Reduced Clostridium pasteurianum Rubredoxin	285	X
4183	Expression and Assignment of 1H, 15N,and 13C Resonances of the C-terminal Domain of the Diphtheria Toxin Repressor	1117	X
4184	Structure and Asn-Pro-Phe Binding Pocket of the Eps15 Homology Domain	1218	X
4185	1H Chemical Shift Assignments for Gurmarin	268	X
4186	NMR Solution Structure of Human Cellular Retinoic Acid Binding Protein-Type II	1269	X
4187	Nuclear Magnetic Resonance Structure of d(GCATATGATAG).d(CTATCATATGC): A Consensus Sequence for Promoters Recognized by Sigma-K RNA Polymerase	204		X
4188	C2 Domain of Cytosolic Phospholipase A2	1685	X
4189	Solution Structure of Reduced Horse Heart Cytochrome c	692	X
4190	BmTX1 Toxin from Scorpion Buthus martensii Karsch	228	X
4191	BmTX2 Toxin from Scorpion Buthus martensii Karsch	244	X
4192	Helical Structure of Polypeptides from the C-terminal Half of HIV-1 Vpr	255	X
4193	Sequence-Specific 1H, 15N and 13C Assignment of Adenylate Kinase from Escherichia coli in Complex with the Inhibitor AP5A	2503	X
4194	Structural Studies of D-Pro Melittin	150	X
4195	Solution NMR Structure of the Complex of Alpha-Bungarotoxin with a Library-Derived Peptide (NMR, Average Structure)	477	X
4197	Solution NMR Structures of the Major Coat Protein of Filamentous Bacteriophage M13 Solubilized in Sodium Docecyl Sulphate Micelles, 25 Lowest Energy Structures	571	X
4198	Three-dimensional Structure of an Evolutionarily Conserved N-terminal Domain of Syntaxin 1A	1504	X
4199	Determination of the Solution Structure of the N-Domain Plus Linker of Antarctic Eel Pout Antifreeze Protein RD3	599	X
4200	NMR Solution Structure of the c-Myc-Max Heterodimeric Leucine Zipper	377	X
4201	Role of the 6-20 Disulfide Bridge in the Structure and Activity of Epidermal Growth Factor	274	X
4202	Solution Structure of Reduced Monomeric Q133M2 Copper, Zinc Superoxide Dismutase(SOD). Why SOD is a Dimeric Enzyme?	1695	X
4203	An NMR Conformational Analysis of Synthetic Peptide Cn2(1-15)NH2-S-S-AcetylCn2(52-66)NH2 from the New World Centruroides Noxius 2(Cn2) Scorpion Toxin. Comparison of the Structure with those of the Centruroides Scorpion Toxins.	212	X
4204	Three-Dimensional Structure of Human Insulin-Like Growth Factor-I (IGF-I) Determined by 1H-NMR and Distance Geometry	459	X
4205	Structure of the Ets-1 Pointed Domain and Mitogen-activiated Protein Kinase Phosphorylation Site.	1370	X
4206	Solution NMR Structure of Linked Cell Attachment Modules of Mouse Fibronectin Containing the RGD and Synergy Regions, 20 Structures	1957	X
4207	CRO Repressor Insertion Mutant K56-[DGEVK]	511	X
4208	The Y64A Mutant of Cytochrome c553 from Desulfovibrio vulgaris Hildenborough	473	X
4209	Solution NMR structures of the major coat protein of filamentous bacteriophage M13 solubilized in Dodecyl Phosphocholine micelles, 25 lowest energy structures	524	X
4210	DNA-binding domain of human telomeric protein, hTRF1	368	X
4211	Ragweed pollen allergen from Ambrosia trifida V	253	X
4212	Synthetic peptide corresponding to the major immunogen site of FMD virus	118	X
4213	Retro-inverso analogue of G-H loop of VP1 in FMD virus	102	X
4214	N-terminal Domain of Tissue Inhibitor of Metalloproteinase-2 (N-TIMP-2)	1328	X
4215	Staphylokinase (NMR, Sakstar Variant)	1746	X
4216	Structure of Transcriptional Activation Domain of CRE-BP1/ATF-2	331	X
4217	The 3D structure of the streptomyces metalloproteinase inhibitor, SMPI, isolated from streptomyces nigrescens TK-23	911	X
4218	Solution structure of toxin 2 from centruroides noxius hoffmann,a beta scorpion neurotoxin acting on sodium channels	384	X
4219	Effects of Glycosylation on the Structure and Dynamics of Eel Calcitonin	220	X
4220	HIV-1 capsid protein major homology region peptide analog	178	X
4221	Solution Structures of Human Immunodeficiency Virus Type 1 (HIV-1) and Moloney Murine Leukemia Virus (MoMLV) Capsid Protein Major Homology Region Peptide Analogs by NMR Spectroscopy	211	X
4222	High-Resolution Solution Structure of a Sweet Protein Single-Chain Monellin (SCM) determined by Nuclear Magnetic Resonance Spectroscopy and Dynamical Simulated Annealing Calculations	599	X
4223	Solution Structure of a TBP-TAFII230 Complex: Protein Mimicry of the Minor Groove Surface of the TATA Box Unwound by TBP	708	X
4224	Solution Structure of Myotrophin	1313	X
4225	NMR structure of Escherichia coli glutaredoxin3-glutathione mixed disulfide complex	682	X
4226	The Lead-Dependent Ribozyme	576			X
4227	NMR structures (20) of the J-domain (residues 1-77) of the Escherichia coli N-terminal fragment (residues 1-78) of the Molecular Chaperone DNAJ	947	X
4228	NMR structures (20) of the J-Domain (residues 1-77) of the Escherichia coli n-terminal fragment (residues 1-104) of the molecular chaperone DNAJ	1068	X
4229	Artificial Fe8S8 ferredoxin: the D13C variant of Bacillus schlegelii Fe7S8 ferredoxin	586	X
4230	Solution Structure of delta-5-3-Ketosteroid Isomerase Complexed with the Steroid 19-Nortestosterone- Hemisuccinate	1373	X
4231	Artificial Fe8S8 ferredoxin: the D13C variant of Bacillus schlegelii Fe7S8 ferredoxin	653	X
4232	N-Domain of Troponin C from Chicken Skeletal Muscle.	1213	X
4233	1H Chemical Shift Assignments for Omega-Atracotoxin-Hv1a	226	X
4234	1H Chemical Shift Assignments for Delta-Atracotoxin-Hv1 (Versutoxin)	262	X
4235	NMR Solution Structure of [d(GCGAATTCGC)2]	91		X
4236	Sequence-specific Resonance Assignments for the NADP(H)-binding Component (domain III) of Proton-translocating Transhydrogenase from Rhodospirillum rubrum.	1118	X
4237	Backbone and side-chain 1H, 15N, and 13C Assignments for the Topological Specificity Domain of the MinE cell Division Protein	756	X
4239	Sequence-specific 1H, 13C and 15N assignment of the single-stranded DNA binding protein of the bacteriophage f29	770	X
4240	Minor conformer of a benzo[a]pyrene diol epoxide adduct of DA in duplex DNA	109		X
4241	1H and 15N Assignments of Internal xylan binding domain from XYLD	632	X
4242	Motile Major Sperm Protein (MSP) of Ascaris suum	1367	X
4243	Intercalated d(TCCCGTTTCCA) dimer	94		X
4244	NMR Solution Structure of [d(GCGAAT-3'-3'-alphaT-5'-5'-CGC)2]	103		X
4246	3D Structure of the M8L Mutant of Squash Trypsin Inhibitor CMTI-I, NMR, 6 Structures	198	X
4247	1H Chemical Shift Assignments of the 8mer Chimeric Hybrid Duplex r(GCAGUGGC).r(RCCA)d(CTGC)	145		X	X
4248	LEF1 HMG Domain (From Mouse), Complexed with DNA (15bp), NMR, 12 Structures	1212	X	X
4249	Solution Structure of the DNA- and RPA-binding Domain of the Human Repair Factor XPA	1344	X
4250	Structure of the 3' hairpin of the TYMV pseudoknot: Preformation in RNA folding	149			X
4251	Triple Resonance Assignment for Abl SH(32) and One in the Complex with a Consolidated Ligand	1536	X
4252	Triple Resonance Assignment for Abl SH(32) and One in the Complex with a Consolidated Ligand	1440	X
4253	An Examination of Coaxial Stacking of Helical Stems in a Pseudoknot Motif: the Gene 32 Messenger RNA Pseudoknot of Bacteriophage T2	476			X
4254	1H, 15N and 13C Assignments of the DNA Binding Domain of Transcription Factor Mbp1 from Sassharomyces cerevisiae in Both Its Free and DNA Bound Forms and 1H Assignments of the Free DNA	856	X
4255	Human Translation Initiation Factor eIF1	1310	X
4256	1H, 15N and 13C Assignments of the DNA Binding Domain of Transcription Factor Mbp1 from S. cerevisiae in Both Its Free and DNA Bound Forms, and 1H Assignments of the Free DNA	690	X	X
4257	(52-96)C-Terminal Domain of the HIV-1 Regulatory Protein VPR	377	X
4258	1H Chemical Shift Assignments of the Palindromic 12mer d(TTTGACGCGTCAA)2 (MCB12T) which Contains the Recognition Site for the Yeast Transcription Factor Mbp1.	94		X
4259	Sequential Assignment and Solution Secondary Structure of Doubly Labelled Ribonuclease Sa	914	X
4260	Effects of Glycosylation on the Structure and Dynamics of Eel Calcitonin in Micelles and Lipid Bilayers Determined by NMR Spectroscopy	211	X
4261	Effects of Glycosylation on the Structure and Dynamics of Eel Calcitonin in Micelles and Lipid Bilayers Determined by NMR Spectroscopy	211	X
4262	NMR SOLUTION STRUCTURE AND DYNAMICS OF THE COMPLEX OF LACTOBACILLUS CASEI DIHYDROFOLATE REDUCTASE WITH THE NEW LIPOPHILIC ANTIFOLATE DRUG TRIMETREXATE	1234	X
4263	dNumb PTB Domain Complexed with a Phosphotyrosine Peptide, NMR, Ensemble of Structures.	1891	X
4264	Complex of the amino terminal domain of enzyme I and the histidine-containing phosphocarrier protein HPr from Escherichia coli nmr, restrained regularized mean structure	5105	X
4265	1H, 15N and 13C Resonance Assignments for the 22KDa LC1 Light Chain from Chlamydomonas Outer Arm Dynein	2006	X
4266	The Solution Structure of a Superpotent B-chain-shortened Single-replacement Insulin Analogue	293	X
4267	Chemical shift assignments, 3JHNHA coupling constants and secondary structure of HNGAL (Human Neutrophil Gelatinase-Associated Lipocalin) in its apo form.	2191	X
4268	7-Fe Ferredoxin from Bacillus Schlegelii	407	X
4269	1H, 15N and 13C Chemical Shift Assignments for the Catalytic Core of Resolvase	1216	X
4270	Chemical Shift Assignment of Ca2+/calmodulin (1H, 13C, and 15N) Complexed with Its Binding Domain from Rat Ca2+/calmodulin Dependent Protein Kinase Kinase (1H).	1891	X
4271	Sequence Specific 1H, 13C and 15N Assignments of a Calcium Binding Protein from Entamoeba Histolytica	1007	X
4272	1H, 15N, 13C Resonance Assignments of SynaptobrevinII	834	X
4273	Candidacidal Activity Prompted by N-terminus Histatin-like Domain of Human Salivary Mucin (MUC7)	327	X
4276	Solution Structure and Dynamics of the Plasminogen Kringle 2-AMCHA Complex: 3/1-Helix in Homologous Domains	728	X
4278	Backbone 1H and 15N Chemical Shift Assignments for Long-[L60]-IGF-I, an Insulin-Like Growth Factor 1 Analogue (IGF-I)	613	X
4279	Solution Structure of a beta-Neurotoxin from the New World Scorpion Centruroides sculpturatus Ewing	380	X
4280	Sequence Specific 1H, 13C and 15N Assignment of the Methyl Binding Domain of the Methyl-CpG-binding Protein MeCP2.	1000	X
4281	Backbone and Side Chain 1H, 13C, and 15N Chemical Shift Assignments for AbrBN	695	X
4282	1H, 15N, and 13C Resonance Assignments for the N-terminal 20 kDa Domain of the DNA Single-Strand Break Repair Protein XRCC1	2154	X
4283	NMR Structure of the Angiogenesis Marker Oncofoetal Fibronectin ED-B Domain	754	X
4284	NMR Solution Structure of a Complex of Calmodulin with a Binding Peptide of the Ca2+-Pump	1686	X
4285	1H, 13C and 15N NMR Sequence-Specific Resonance Assignments for Rat Apo-S100A1(aa).	1152	X
4286	1H and 15N Chemical Shift Assignments of the Unstructured Yeast Vesicular SNARE Snc1.	604	X
4287	1H and 15N Chemical Shift Assignments of the Unstructured Yeast Target Membrane SNARE Sso1.	506	X
4288	Sequence-specific 1H, 13C and 15N Assignment and Secondary Structure of the Apo EH2 Domain of Mouse Eps15.	1287	X
4289	1H and 15N Chemical-Shift Assignments of a Carboxy-Terminal Functional Domain of the Bacteriophage P22 Scaffolding Protein	486	X
4290	Sequence-specific 1H Assignment of Antimicrobial Protein Tachycitin.	496	X
4291	Solution Structure of Desulfovibrio Vulgaris (Hildenborough) Ferrocytochrome C3: Structural Basis for Functional Cooperativity	668	X
4292	NMR Structure of PSP1, Plasmatocyte-spreading Peptide from Pseudoplusia includens	143	X
4293	Assignment of 1H, 13C and 15N Signals of the DNase Domain of Colicin E9	1201	X
4294	Resonance Assignments, Secondary Structure and 15N Relaxation data of the Human Transcriptional Coactivator hMBF1(57-148)	910	X
4295	Titin Module A71 from Human Cardiac Muscle	832	X
4296	1H, 13C, and 15N Chemical Shift Assignments for E. coli Cold-shock Protein A (CspA)	765	X
4297	Chemical Shifts (1H, 13C, 15N) and J-couplings (3JHNHA, 3JNHB, 3JHAHB) for the N-terminal Domain of E. coli DnaB Helicase, DnaB(24-136)	1336	X
4298	A Synthetic Cyclic Peptide Corresponding to the Complete V3 Loop of the RF HIV-1 Strain in Water Solution	255	X
4299	1H, 13C and 15N Resonance Assignments of Escherichia coli 6-hydroxymethyl-7,8-dihydropterin Pyrophosphokinase and its Complex with MgAMPPCP	1225	X
4300	1H , 13C, 15N Assigned Chemical Shifts for HPPK-AMPPCP Complex	1247	X
4301	1H, 13C and 15N Chemical Shift Assignments of the Pathogenesis-related Protein P14a	1439	X
4302	Assignment of 1H, 13C and 15N Resonances of the a' Domain of Protein Disulfide Isomerase	1411	X
4303	Chemical Shift Assignment of Rb. sphearoides LH1b	342	X
4304	1H, 13C, and 15N Chemical Shift Assignment of the Extended Neuronal Nitric Oxide Synthase PDZ Domain Complexed with an Associated Peptide	1376	X
4305	1H, 13C, 15N Assignment of PIN: A Protein Inhibitor of Neuronal Nitric Oxide Synthase	968	X
4306	Backbone NMR asignment of a cyanobacterial transcriptional factor, SmtB, that has bound zinc ions	347	X
4307	1H, 13C, and 15N Chemical Shift Assignments for SHa rPrP(90-231).	1431	X
4308	1H and 15N Chemical Shift Assignments for Domain 4 of the Common Beta-Chain of the IL-3, IL-5 and GM-CSF Receptors	821	X
4309	Backbone NMR Assignment and Secondary Structure of the 19 kDa Hemophore HasA	878	X
4310	Calmodulin SEF2-1 Complex	1860	X
4311	Sequence-Specific 1H, 13C and 15N Chemical Shift Assignment and Secondary Structure of the HTLV-I Capsid Protein	3325	X
4312	1H, 15N and 13C Resonance Assignments for the Bromodomain of the Histone Acetyltransferase hsP/CAF	1197	X
4313	1H, 13C and 15N NMR Assignments for a Carbon Monoxide Generating Metalloenzyme from Klebsiella pneumoniae, Acireductone Dioxygenase (ARD)	1797	X
4314	1H Assignments for the Human Chemokine HCC2	465	X
4315	Assignment of the Backbone of Oxidized Fe-superoxide Dismutase, a 42kDa Paramagnet- containing Enzyme	510	X
4316	1H, 13C and 15N Chemical Shift Assignements for Subunit c of the ATP Synthase from Propionigenium modestum	971	X
4317	1H, 13C, and 15N Chemical Shift Assignments for NS1(1-73)	922	X
4318	Assignment of 1H, 13C, and 15N Resonances of Reduced Escherichia coli Glutaredoxin 2	2180	X
4321	1H, 13C, and 15N Chemical Shift Assignments for the Catalytic Domain of Tetrahymena GCN5 Histone Acetyltransferase in Complex with CoA	2040	X
4322	1H Chemical Shift Assignment for the Complete Consensus V3 Loop Peptide of the Envelope Protein gp120 of HIV-1 in 20% Trifluoroethanol/Water.	480	X
4323	1H, 13C, 15N NMR backbone assignments of 37 kDa surface antigen OspC from Borrelia burgdorferi	831	X
4324	Characterization of Monomeric and Dimeric B-domain of Staphyococcal Protein A: Sources of Stabilization of a 3-helix Bundle Protein.	480	X
4325	Characterization of Monomeric and Dimeric B-domain of Staphylococcal Protein A.	845	X
4326	Complete 1H, 13C, and 15N Chemical Shift Assignments for the N-terminal Domain of DNA Polymerase B (residues 2-87).	993	X
4327	1H, 13C, and 15N Resonance Assignment and Secondary Structure of the N-terminal Inhibitory Domain of Human Tissue Inhibitor of Metalloproteinases-1	1506	X
4328	1H, 13C, and 15N Chemical Shift Assignments for Human Rad51(1-114)	1071	X
4329	Sequential Assignment and Secondary Structure Analysis of the NADP(H)-Binding Domain of Escherichia coli Transhydrogenase	851	X
4330	A Single-Chain T Cell Receptor	1303	X
4331	Backbone 1H, 13C, and 15N Resonance Assignments of Streptomyces Subtilisin Inhibitor	394	X
4332	1H and 15N Chemical Shift Assignments for Recombinant Bovine Alpha-Lactalbumin	350	X
4333	The Three-dimensional Solution Structure and Dynamic Properties of the Human FADD Death Domain	1157	X
4334	1H, 13C, 15N Resonance Assignments of ARID Domain of Dead-Ringer Protein.	1738	X
4335	NMR Assignments, Secondary Structure and Global Fold of Calerythrin, an EF-hand Calcium-binding Protein from Saccharopolyspora erythraea.	1799	X
4336	Backbone and Sequence-Specific Assignment of Three Forms of the Lipoate Containing H-protein of the Glycine Decarboxylase Complex.	1382	X
4337	Backbone and Sequence-Specific Assignment of Three Forms of the Lipoate-Containing H-protein of the Glycine Decarboxylase Complex.	238	X
4338	Backbone and Sequence-Specific Assignment of Three Forms of the Lipoate-Containing H-protein of the Glycine Decarboxylase Complex.	238	X
4339	1H, 13C, and 15N Chemical Shift Assignments for Yeast Ribosomal Protein L30 Free in Solution	1272	X
4340	Complete 1H, 15N and 13C Assignment of a Recombinant Mouse Major Urinary Protein	2106	X
4341	Assignment of the Backbone Resonances of Oxidized Fe-superoxide Dismutase, a 42 kDa Paramagnet-containing Enzyme	615	X
4342	Assignment of the 1H, 15N, and 13C Resonances of the C-terminal Domain of Frataxin, the Protein Involved in Friedreich Ataxia.	1463	X
4343	Resonance assignment and topology of a 22 kDa C-terminal fragment of the polypyrimidine tract binding protein (PTB) containing two RNA binding domains	1253	X
4344	1H and 15N Chemical Shift Assignments for Apo-CopZ	517	X
4345	1H, 13C, and 15N Chemical Shift Assignments for Yeast Ribosomal Protein L30 in Complex with Its mRNA in Solution	1795	X		X
4346	1H, 13C, and 15N Chemical Shift Assignments for the Regulatory mRNA of the Yeast Ribosomal Protein L30	472			X
4347	1H Chemical Shift Assignments and Interproton 3JHNHA Coupling Constants of Alpha2-D, a Nativelike de Novo Designed Four Helix Bundle	270	X
4348	1H, 15N and 13C Chemical Shift Assignments for NtrC-C-term-3Ala	788	X
4349	Backbone Resonance Assignments for the Fv Fragment of the Catalytic Antibody NPN43C9 with Bound p-nitrophenol	1144	X
4350	1H,15N Resonance Assignment of Escherichia coli Adenylate Kinase with Its Bi-Substrate Analog AP5A	832	X
4351	A 30-residue Fragment of the Carp Granulin-1 Protein Folds into a Stack of two Beta-hairpins Similar to that found in the Native Protein	234	X
4352	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Inhibitor-Bound DNase Domain of Colicin E9.	1048	X
4353	1H, 13C, and 15N Resonance Assignments of C-terminal Domain of MutY	865	X
4354	Solution NMR Studies of a 42kDa Escherichia coli Maltose Binding Protein/ Beta-Cyclodextrin Complex: Chemical Shift Assignments and Analysis	2280	X
4355	Backbone 1H, 13C, 15N Chemical Shift Assignments for the Asymmetric Strands of the Tetramerization Domain of the Mnt Repressor	797	X
4357	NMR studies of the Pbx1 TALE Homeodomain Protein free in Solution and bound to DNA : Proposal for a Mechanism of HoxB1-Pbx1-DNA Complex Assembly	165	X
4358	NMR studies of the Pbx1 TALE Homeodomain Protein free in Solution and bound to DNA : Proposal for a Mechanism of HoxB1-Pbx1-DNA Complex Assembly	215	X
4359	NMR studies of the Pbx1 TALE Homeodomain Protein free in Solution and bound to DNA : Proposal for a Mechanism of HoxB1-Pbx1-DNA Complex Assembly	219	X	X
4360	1H, 13C and 15N Chemical Shift Assignments for the C2B-domain of Rabphilin 3	1736	X
4361	Structure determination by restrained molecular dynamics using NMR pseudocontact shifts as experimentally determined constraints	239		X		X
4362	Structure determination by restrained molecular dynamics using NMR pseudocontact shifts as experimentally determined constraints	263		X		X
4363	NMR Structure of the Sea Urchin (Strongylocentrotus purpuratus) Metallothionein MTA	321	X
4364	Dynamics of Stromelysin/Inhibitor Interactions Studied by 15N NMR Relaxation Measurements: Comparison of Ligand Binding to the S1-S3 and S1-S3PSubsites	658	X
4367	Backbone assignments of a Borrelia OspA mutant containing an extended single-layer beta-sheet	1367	X
4368	Chemical Shift Assignments for A35T vnd/NK2 Mutant Homeodomain	890	X	X
4369	1H, 15N and 13C Assigned Chemical Shifts of S19 from Thermus thermophilus	695	X
4370	1H and 15N chemical shift assignments for HP-RNase	938	X
4371	Sequence-specific 1H, 13C and 15N Resonance Assignments of Recombinant Onconase/P-30 Protein	1518	X
4372	Solution Structure of a Quadraplex Forming DNA and Its Intermediate	117		X
4373	1H, 15N, and 13C Resonance Assignment of the PH Domain from C. elegans UNC-89	999	X
4374	Mutational and structural analyses of the ribonucleotide reductase inhibitor sml1 define its rnr1 interaction domain whose inactivation allows suppression of mec1 and rad53 lethality	1126	X
4375	1H, 13C and 15N Assignments of Ubiquitin Unfolded in 8M Urea, pH2 and Analysis of Chemical shift Dispersion in Unfolded Proteins	821	X
4376	Chemical shift assignments, 3JHNHA coupling constants, secondary structure and 15N{1H} Heteronuclear NOE values of the N-domain of VAT (VCP like ATPase of Thermoplasma). A group II AAA ATPase.	2287	X
4377	The Solution Structure of the Type X Cellulose Binding Domain from Pseudomonas xylanase A	308	X
4378	1H, 13C and 15N Resonance Assignment of un-myristoylated Ca2+-Frequenin, a Synaptic Efficacy Modulator	1978	X
4379	NMR Solution Structure of the Human Prion Protein Domain reveals Species Dependent Structural Disorder and Intramolecular Association with the Flexible Tail	1247	X
4380	1H, 15N and 13C Resonance Assignments and Monomeric Structure of the Amino-Terminal Extracellular Domain of Epithelial Cadherin	1369	X
4381	Letter to the Editor:Sequence-specific 1H, 13C, and 15N assignments for the third EH domain of Eps15 (EH3)	1250	X
4382	1H, 13C and 15N Assigned Chemical Shifts for a Eukaryotic Rubredoxin from Guillardia theta	749	X
4383	1H Chemicals Shift Assignments for Wheat ns-LTP Complexed with Prostaglandin B2.	593	X
4384	Solution Structure and Dynamics of the Rous Sarcoma Virus Capsid Protein and Comparison with Capsid Proteins ofOther Retroviruses	2903	X
4385	Rapid Fold and Sructure Determination of the Archaeal Translation Elongation Factor 1beta from Methanobacterium thermoautotrophicum	1010	X
4386	HIGH-RESOLUTION SOLUTION STRUCTURE OF FREE RGS4 BY NMR	1887	X
4387	Solution structure of thanatin, a potent bactericidal and fungicidal insect peptide, determined from 1H-2D NMR	166	X
4388	Backbone NMR Assignments of a High Molecular Weight Protein (47kD), Cyclic AMP Receptor Protein (apo-CRP)	961	X
4389	Backbone NMR Assignment and Secondary Structure of Ribosome Recycling Factor (RRF) from Pseudomonas aeruginosa	876	X
4391	Isolation, purification, 1H NMR assignments and secondary structure characterization of a neurotoxin from Bungarus candidus	659	X
4392	Binding of AR-1-144, a tri-imidazole DNA minor groove binder, to CCGG sequence analyzed by NMR spectroscopy	91		X
4393	1H, 15N, and 13C NMR Backbone Assignments of the N Terminal Region of Human Erythrocyte Alpha Spectrin Including One Repeating Unit.	748	X
4394	Translation initiation factor IF3 from Escherichia coli Ribosome binding domain (residues 84-180)	985	X
4395	RIBOSOMAL PROTEIN L25 FROM ESCHERICHIA COLI, NMR,	1178	X
4396	Anticoagulant protein from the nematode Ancylostoma caninum	618	X
4397	Solution Structure of the CX3C Chemokine Domain of Fractalkine	862	X
4398	Structure of a neuropeptide Y Y2 agonist	110	X
4399	Alpha-conotoxin ImI	66	X
4400	Structure and Mechanism of Formation of the H-y5 ismomer of an Intramolecular DNA Triple Helix.	247		X
4401	Structure and Interaction Site of the Regulatory Domain of Troponin-C when Complexed with the 96-148 Region of Troponin-I	954	X
4402	1H, 13C and 15N chemical shift assignment of human prion protein hPrP(23-230)	2157	X
4403	1H, 13C and 15N Resonance Assignment and Secondary Structure of the J Domain of Murine Polyomavirus T Antigens	1015	X
4404	Solution Structure of the Major alpha-amylase Inhibitor of the crop plant Amaranth	173	X
4405	C-TERMINAL KH DOMAIN OF HNRNP K (KH3)	1059	X
4406	The cyclic peptide contryphan-R from Conus radiatus	49	X
4407	NMR chemical shift assignment of human GAIP (Galpha Interacting Protein): A regulator of G protein signaling	1476	X
4408	Minor Form of the Cyclic Peptide Contryphan-R from Conus radiatus	34	X
4409	DNA DECAMER DUPLEX CONTAINING T-T DEWAR PHOTOPRODUCT	163		X
4410	Three dimensional structure of Selenocosmia huwena Lectin-I (SHL-I) from the venom of the spider Selenocosmia huwena by 2D-NMR	197	X
4411	Backbone 1H and 15N Chemical Shift Assignments for Transforming Growth Factor beta	286	X
4412	DNA DECAMER DUPLEX CONTAINING T5-T6 PHOTOADDUCT	169		X
4413	STRUCTURE OF THE C-TERMINAL DOMAIN OF P73	748	X
4414	NMR Solution Structure of Plastocyanin from the Photosynthetic Prokaryote, Prochlorothrix hollandica (minimized average structure)	666	X
4415	Solution-state structure of a DNA dodecamer duplex containing a cis-syn thymine cyclobutane dimer.	215		X
4416	Solution-State Structure of a DNA Dodecamer Duplex Containing a Cis-Syn Thymine Cyclobutane Dimer.	215		X
4417	1H, 13C and 15N Chemical Shift Assignments of the Birch Pollen Allergen Bet v 1	1649	X
4418	NMR structure with tightly bound water molecules of cytotoxin II (cardiotoxin) from Naja naja oxiana in aqueous solution (minor form)	443	X
4419	NMR structure with tightly bound water molecules of cytotoxin II (cardiotoxin) from Naja naja oxiana in aqueous solution (major form)	440	X
4420	NMR SOLUTION STRUCTURE OF ALPHA-CONOTOXIN IM1	66	X
4421	13C,15N and 1H Assigned Chemical Shifts for PhoB DNA-binding Domain.	1152	X
4422	NMR Solution Structure of Apis mellifera Chymotrypsin Inhibitor (AMCI).	350	X
4423	Solution structure of the N-terminal zinc finger of murine GATA-1	339	X
4424	NMR Structure of the N-terminal Domain of Saccharomyces cerevisiae RNase HI Reveals a Fold with a Strong Resemblance to the N-terminal Domain of Ribosomal Protein L9	593	X
4425	Solution structure of apo-biotinyl domain from acetyl coenzyme A carboxylase of Escherichia coli determined by triple-resonance NMR spectroscopy	906	X
4426	Solution Structure of Holo-biotinyl Domain from Acetyl Coenzyme A Carboxylase of Escherichia coli Determined by Triple-Resonance NMR Spectroscopy	883	X
4427	PI7, an orphan peptide isolated from the scorpion Pandinus Imperator: a 1H NMR analysis using a Nano-nmr probe.	249	X
4428	Solution Structure of the Headpiece Domain of Chicken Villin	525	X
4429	1H and 15N Chemical Shift Assignments for ribosomal protein L7	943	X
4430	High resolution solution structure of apo rabbit calcyclin	1057	X
4431	Structure of the Soluble Methane Monooxygenase Regulatory Protein B	1186	X
4432	1H-NMR Spectral Assignment of Second Transmembrane Segments of Human Glycine Receptor	262	X
4433	1H-NMR Spectral Assignment of Second Transmembrane Segments of Human Glycine Receptor	285	X
4434	NMR Solution Structure of the Human Prion Protein	1555	X
4435	Structural Basis for the Network of Functional Cooperativities in Cytochrome c(3) from Desulfovibrio gigas: Solution Structures of the Oxidised and Reduced states	698	X
4436	Proton Assignment of the Ferrocytochrome C3 from Desulfovibrio gigas.	728	X
4437	Solution structure of an EGF module pair from the Plasmodium falciparum merozoite surface protein 1	1051	X
4438	1H, 13C and 15N chemical Shift Assignments for SCP2	1180	X
4439	Hyperfine Cys Proton Signals from Oxidized Human Ferredoxin	12	X
4440	Hyperfine Cys Proton Signals from Reduced Human Ferredoxin	12	X
4441	Hyperfine Cys Proton Signals from Anabaena 7120 Vegetative Ferredoxin	12	X
4442	Hyperfine Cys Proton Signals from Reduced Anabaena 7120 Vegetative Ferredoxin	12	X
4443	NMR Solution Structure of Butantoxin	149	X
4444	1H, 13C and 15N chemical shift assignments and secondary structure of Halobacterium salinarum ferredoxin	1065	X
4445	1H, 13C, and 15N Chemical Shift Assignments and coupling constants for the HRDC domain from S. cerevisiae Sgs1 RecQ helicase	1534	X
4446	NMR solution structure of a novel thioredoxin from Bacillus acidocaldarius: possible determinants of protein stability.	747	X
4447	Backbone assignment of the 19kDa translationally controlled tumor-associated protein p23fyp from Schizosaccharomyces pombe	993	X
4448	1H, 13C and 15N backbone assignment and secondary structure of the 19 kDa diadenosine 5',5'''-P1,P4 tetraphosphate hydrolase from Lupinus angustifolius L.	1788	X
4449	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Intramolecular Dimer Antifreeze Protein RD	1372	X
4451	Structure of the CAD Domain of Caspase-activated DNase and Interaction with the CAD Domain of its Inhibitor	1083	X
4452	The Solution structure of Type II Antifreeze Protein Reveals a New Member of the Lectin Family	782	X
4453	Assignment of the 1H, 13C and 15N Resonances of the C-terminal EF-Hands of Alpha Actinin in a 14 kDa Complex with Z-Repeat 7 of Titin	814	X
4454	1H and 15N Chemical Shift Assignments for Titin Z-repeat 7 in the Complex with Alpha-actinin C-terminal EF-hands	205	X
4455	Glycan-free mutant adhesion domain of human CD58 (LFA-3)	1075	X
4456	1H Chemical Shift Assignments for the cytoplasmic domain of aIIb integrin	149	X
4457	Sequence-specific assignments and partial unfolding of extracellular domains II and III of E-cadherin.	820	X
4458	1H Chemical Shift Assignments and Interproton 3JNHHA Coupling Constants of Reduced Bacteriophage T4 Glutaredoxin	637	X
4459	1H Chemical Shift Assignments and Interproton 3JNHHA Coupling Constants of Oxidized Bacteriophage T4 Glutaredoxin	640	X
4460	1H, 15N and 13C Resonance Assignments for the C-terminal Protein Interaction Region of the 32 kDa Subunit of Human Replication Protein A	1012	X
4461	1H NMR Solution Structure of Cycloviolacin O1 - A Macro-cyclic Polypeptide Isolated from Viola odorat	152	X
4462	1H Chemical Shift Assignements for mouse [Cd7]-metallothionein-1	285	X
4463	Sequential NMR assignment of the Ras-binding domain of Byr2	911	X
4464	Chemical shifts of the major form of the cyclic peptide contryphan-Sm	51	X
4465	The Structural role of the Copper-coordinating and Surface-exposed Histidine Residue in the Blue Copper Protein Azurin	368	X
4466	Chemical Shift assignments for Cu(I) Pseudoazurin from Paracoccus pantotrophus	959	X
4467	Sequence-specific 1H, 13C, and 15N Assignments of the MAR-binding Domain of Chicken MeCP2/ARBP	659	X
4468	Chemical shifts of the minor form of the cyclic peptide contryphan-Sm	51	X
4469	Chemical shifts of the major form of the cyclic peptide Des[Gly1]-contryphan-R	46	X
4470	Solution Structure of ThiS and Implications for the Evolutionary Roots of Ubiquitin	625	X
4471	Complete 1H, 15N and 13C assignment of the functional domain of Paracoccus denitrificans cytochrome c552 in the reduced state	1221	X
4472	1H, 13C, and 15N signal assignments for BeFx-activated CheY from E. coli	1350	X
4473	The molecular basis for Protein Kinase A anchoring revealed by solution NMR	502	X
4475	Low Density Lipoprotein Receptor-Related protein complement repeat 8	413	X
4476	Control of K+ channel gating by protein phosphorylation: structural switches of the inactivation gate	217	X
4477	Control of K+ channel gating by protein phosphorylation: structural switches of the inactivation gate	217	X
4478	PKD domain 1 from Human polycystein-1	776	X
4483	Local interactions drive the formation of non-native structure in the denatured state of human alpha-lactalbumin: A high resolution structural characterization of a peptide model in aqueous solution	94	X
4486	METHANE MONOOXYGENASE COMPONENT B	1134	X
4487	Putative ancestral protein encoded by a single sequence repeat of the multidomain proteinase inhibitor from nicotiana alata	330	X
4488	DNA decamer duplex containing T-T (6-4) photoadduct	165		X
4490	Solution structure of the major alpha-amylase inhibitor of the crop plant Amaranth	62	X
4491	Solution structure of the apo EH1 domain of mouse Eps15	1399	X
4492	Unmyristoylated GCAP-2 with three calcium ions bound	1418	X
4493	Solution structure of the designed hydrophobic core mutant of ubiquitin, 1D7	919	X
4494	Solution Structure and Backbone Dynamics of Human Long-[Arg3]Insulin-Like Growth Factor 1	574	X
4496	Solution nmr structure of the mitochondrial protein import receptor Tom20 from rat in a complex with a presequence peptide derived from rat aldehyde dehydrogenase (ALDH)	1228	X
4497	High resolution solution structure of the Heat shock cognate -70 kd substrate binding domain obtained by multidimensional NMR techniques	1901	X
4498	Nucleocapsid Protein from Mason-Pfizer Monkey Virus (MPMV)	470	X
4500	w-conotoxin MVIIC from Conus magus	165	X
4503	Solution Structure of Alpha-conotoxin SI	118	X
4506	Solution structure of carnobacteriocin B2	191	X
4507	Solution Structure of Carnobacteriocin B2 and Implications for Structure- Activity Relationships Among Type IIa Bacteriocins from Lactic Acid Bacteria	160	X
4509	Automated 2D NOESY Assignment and Structure Calculation of crambin(S22/I25) with Self-Correcting Distance Geometry Based NOAH/DIAMOND Programs	256	X
4510	The Second Type II Module From Human Matrix Metalloproteinase 2	473	X
4514	NMR solution structure of complement-like repeat CR3 from the low density lipoprotein receptor-related protein (LRP). Evidence for specific binding to the receptor binding domain of human alpha-2 macroglobulin	329	X
4516	Solution Structure of the PDZ2 Domain from Human Phosphatase hPTP1E and its Interactions with C-terminal Peptides from the Fas Receptor	867	X
4519	HUMAN TRANSLATION INITIATION FACTOR EIF1A	1501	X
4524	Solution Structure of a Type-I Dockerin Domain, a Novel Prokaryotic, Extracellular Calcium-Binding Domain	510	X
4526	SOLUTION NMR STRUCTURE OF TUMOR SUPPRESSOR P16INK4A, 20 STRUCTURES	242	X
4527	1H, 13C, and 15N Chemical Shift Assignments for the N-terminal receiver domain of NtrC (unphosphorylated)	1344	X
4528	1H, 13C, and 15N Chemical Shift Assignments for the N-terminal receiver domain of NtrC (phosphorylated)	1226	X
4536	Structural basis for uracil DNA glycosylase interaction with uracil: NMR study	197		X
4540	Averaged NMR model of switch ARC, a double mutant of ARC repressor	469	X
4541	Solution Structure of the Potassium Channel Scorpion Toxin HsTX1	221	X
4542	Solution structure of a uracil containing hairpin DNA	206		X
4547	Solution structure of a DNA.RNA hybrid containing an alpha-anomeric thymidine and polarity reversals: d(ATGG-3'-3'-(alpha-T)-5'-5'-GCTC).r(gagcaccau)	184		X	X
4550	NMR structure of the palindromic DNA decamer d(GCGTTAACGC)2	83		X
4552	Structure of the Bovine Antimicrobial Peptide Indolicidin bound to Dodecylphosphocholine and Sodium Dodecyl Sulfate Micelles	244	X
4553	Assignment of 1H, 13C and 15N Resonances of the I-domain of Human Leukocyte Function Associated Antigen-1	2273	X
4554	Backbone HN, N, Ca, C' and Cb assignments of the 19 kDa DHFR/NADPH complex at 9C and pH 7.6	743	X
4555	31P NMR analysis of the DNA conformation induced by protein binding:SRY-DNA complexes	269		X
4556	31P NMR analysis of the DNA conformation induced by protein binding:SRY-DNA complexes	151		X
4557	Structure of the active domain of the herpes simplex virus protein ICP47 in water/sodium dodecyl sulfate solution determined by nuclear magnetic resonance spectroscop	179	X
4558	1H, 13C, and 15N Assignments for YopH-NT	1081	X
4559	The NMR structure of the nucleocapsid protein from the mouse mammary tumor virus reveals unusual folding of the C-terminal zinc knuckle	290	X
4560	Assignment of 1H, 13C and 15N signals of a recombinant effector protein (T4MOD) in Toluene-4-monooxygenase complex	1299	X
4561	Solution Structure of Imperatoxin A (IpTxa) from the scorpion P. imperator Determined by 1H-NMR Spectroscopy	337	X
4562	1H and 13C chemical shift assignments of native hen egg white lysozyme	1238	X
4563	NMR Structure of the Bovine Prion Protein	1274	X
4564	NMR Structure of the Bovine Prion Protein	1908	X
4565	1H, 13C and 15N resonance assignments for a truncated and inhibited catalytic domain of matrix metalloproteinase-2	1699	X
4566	Assignment of 1H,13C and 15N signals of Bovine Adrenodoxin	1097	X
4567	1H, 15N and 13C resonance assignments for the catalytic domain of the yeast E2, UBC1	1169	X
4568	Native and non-native secondary structure and dynamics in the pH 4 intermediate of apomyoglobin	864	X
4570	NMR Study of Sso7d Mutant (F31A) Minimized Average Structure	303	X
4571	Zinc-bundle Structure of the Essential RNA Polymerase Subunit RPB10 from Methanobacterium thermoautotrophicum	681	X
4572	Conformational changes in the PBX Homeodomain and C-terminal Extension upon Binding DNA and HOX-derived YPWM Peptides	764	X
4573	1HN,15N,13CO,13Ca,13Cb chemical shifts of 7,8-dihydroneopterin aldolase (DHNA) from Staphylococcus aureus	520	X
4574	CIDE-N Domain of Human CIDE-B	1238	X
4575	Letter to the Editor: Backbone resonance assignment of the N-terminal 24 kDa fragment of the gyrase B subunit from S. aureus complexed with novobiocin	1367	X
4576	Solution Structure of [d(CGC)r(aaa)d(TTTGCG)]2 Hybrid Junctions Flanked by DNA Duplexes	104		X
4577	1H, 13C, and 15N Chemical Shift Assignments for Ribosomal Protein S4 delta 41	1965	X
4578	1H, 13C and 15N NMR Assignment of the Hyperstable Quintuple Mutant of Pseudomonas aeruginosa Cytochrome c-551.	970	X
4579	Sequence-specific 1H, 15N and 13C resonance assignments of the EEA1 FYVE domain.	1039	X
4580	Backbone 1H,13C,and 15N assignments of the anti-dansyl antibody Fv fragment	664	X
4581	Site-site Communication in the EF-hand Ca2+ Binding Protein Calbindin D9k	550	X
4583	The C-terminal Domain of the RNA Polymerase Alpha Subunit from Thermus Thermophilus	814	X
4584	Solution Structure of the DNA-binding Domain of TraM	461	X
4585	Solution Structure of BmP02, a new Potassium channel Blocker from the Venom of the Chinese Scorpion Buthus martensi Karsch	162	X
4587	NMR STRUCTURAL DETERMINATION OF VISCOTOXIN A3 FROM VISCUM ALBUM L.	308	X
4588	Proton and nitrogen chemical shift assignments for the chitin-binding domain of Bacillus circulans WL-12 Chitinase A1	348	X
4589	NMR Solution Structure of the Last Unknown Module of the Cellulosomal Scaffoldin Protein CIPC of Clostridum cellulolyticum	611	X
4590	Solution structure of the human chemokine Eotaxin-2	789	X
4591	Solution structure of the syndecan-4 whole cytoplasmic domain	195	X
4592	Solution structure of the syndecan-4 whole cytoplasmic domain in the presence of phosphatidylinositol 4,5-bisphosphate	170	X
4593	Rous sarcoma virus capsid protein: C-terminal domain	886	X
4595	Cystic fibrosis transmembrane conductance regulator: solution structures of peptides based on the Phe508 region, the most common site of disease-causing DeltaF508 mutation -- P25	155	X
4596	Cystic fibrosis transmembrane conductance regulator: solution structures of peptides based on the Phe508 region, the most common site of disease-causing DeltaF508 mutation -- P26	170	X
4597	Cystic Fibrosis Transmembrane Conductance Regulator: Solution Structures of Peptides Based on the Phe508 Region, the Most Common Site of Disease-Causing DeltaF508 Mutation	172	X
4598	Cystic Fibrosis Transmembrane Conductance Regulator: Solution Structures of Peptides Based on the Phe508 Region, the Most Common Site of Disease-Causing DeltaF508 Mutation	151	X
4599	High-Resolution Solution Structure of the 18 kDa Substrate-Binding Domain of the Mammalian Chaperone Protein Hsc70	1789	X
4600	Nucleocapsid protein from Mason-Pfizer monkey virus (MPMV)	473	X
4601	Solution structure of the channel-former Zervamicin IIB (peptaibol antibiotic)	209	X
4602	Solution Structure of Oxidized Microsomal Rabbit Cytochrome b5. Factors Determining the Heterogeneous Binding of the Heme	608	X
4603	Tertiary structure of apo-D-alanyl carrier protein	1021	X
4604	NMR STRUCTURE OF THE PEPTAIBOL CHRYSOSPERMIN C BOUND TO DPC MICELLES	183	X
4607	Solution Structure Determination and Mutational Analysis of the Papillomavirus E6-interacting Peptide of E6AP	135	X
4609	NMR observation of T-tetrads in a parallel stranded DNA quadruplex formed by Saccharomyces cerevisiae telomere sequence	59		X
4610	NMR Observation of A-tetrad in a DNA Quadruplex	29		X
4612	NMR observation of a novel C-tetrad in a DNA quadruplex	62		X
4614	The G7(syn)-G4(anti) structure of r(GCAGGCGUGC)2	54			X
4615	Solution Structure of PAFP-S: A new Knottin-type Antifungal Peptide from the seeds of Phytolacca americana	203	X
4616	Light-harvesting complex 1 beta subunit from Rhodobacter sphaeroides	341	X
4617	Structure of hetero complex of non structural protein (NS) of hepatitis C virus (HCV) and synthetic peptidic compound	268	X
4618	The Solution Structure of [d(CGC)r(aaa)d(TTTGCG)]2: Hybrid Junctions Flanked by DNA Duplexes	104		X
4619	N-terminal zinc-binding HHCC domain of HIV-2 integrase	644	X
4620	Human prion protein variant R220K	1248	X
4621	N-terminal RING finger domain of human NOT-4	892	X
4622	Solution structure, Hydrodynamics and thermodynamics of the UvrB C-terminal domain	628	X
4623	Internal xylan binding domain from C. fimi Xyn10A, R262G mutant	614	X
4628	Heavy Chain Variable domain from LLama	679	X
4633	Solution Structure, Backbone Dynamics, and stability of a Double Mutant Single-Chain Monellin. Structural origin of sweetness	596	X
4636	Solution structure of the N-terminal domain of the TNFR1 associated protein, TRADD	1782	X
4637	SOLUTION STRUCTURE OF THE MATA1 HOMEODOMAIN	530	X
4638	SOLUTION STRUCTURE OF MNEI, A SWEET PROTEIN	706	X
4639	NMR structure of the hRap1 Myb motif reveals a canonical three helix bundle lacking the positive surface charge typical of Myb DNA binding domains	379	X
4640	Solution structure and activity of the four disulfide bond Mediterranean mussel defensin MGD-1	236	X
4641	Human Prion Protein Mutant E200K Fragment 90-231	1684	X
4642	SOLUTION STRUCTURE OF HUMAN BETA-DEFENSIN-2	285	X
4643	The solution structure of sheep myeloid antimicrobial peptide (smap29) and its relationship to biological function	203	X
4644	Solution structures of two CCHC zinc fingers from the FOG family protein U-shaped that mediate protein-protein interactions	247	X
4645	A Peptide Derived from the C-Terminal Part of a Plant Cysteine Protease Folds into a Stack of Two Beta-Hairpins, a Scaffold Present in the Emerging Family of Granulin-Like Growth Factors	206	X
4646	Structural NMR characterization of an 11-mer DNA Duplex Containing a 2'-deoxyaristeromycin 8-oxo-Guanine pair, nonhydrolyzable substrate analog for the DNA repair enzyme MutY	161		X
4647	HPRT Gene Mutation Hotspot with a BPDE2(10R) Adduct	195		X
4648	Solution Structure and Dynamics of an Open B-sheet, Glycolytic Enzyme-monomeric 23.7 kDa Phosphoglycerate Mutase from Schizosaccharomyces pombe	2018	X
4649	NMR Structure of N-terminal Domain of HTLV-I CA1-134	1219	X
4650	Sheep prion protein synthetic peptide spanning helix 1 and b strand 2 (residues 142 to 166) shows b hairpin structure in solution	201	X
4651	Helix 7 Bovine Rhodopsin	162	X
4652	Solution Structure of Amino Terminus of Bovine Rhodopsin (residues 1-40)	253	X
4653	Solution structure of third intradiskal loop of bovine rhodopsin (residues 268-293)	159	X
4654	Solution structure of 2nd intradiskal loop of bovine rhodopsin (residues 172-205)	200	X
4655	Solution Structure of Intradiskal Loop 1 of Bovine Rhodopsin (Rhodopsin Residues 93-123)	157	X
4656	Design and Solution Structure of a Well-folded Stack of Two Beta-hairpins Based on the Amino-terminal Fragment of Human Granulin A	192	X
4661	Solution structure of APAF-1 CARD	858	X
4663	Rotamer Strain as a Determinant of Protein Structural Specificity	928	X
4664	Sequence-Specific Resonance Assignments of Q83, a Lipocalin Highly Expressed in v-myc-Transformed Avian Fibroblasts	1050	X
4666	Biotin carboxyl carrier domain of transcarboxylase (TC 1.3S)	872	X
4668	Assignment of 1H, 13C and 15N Resonances of FKBP from Methanococcus thermolithotrophicus	1817	X
4669	Structural Analysis of the Immunodominant Antigenic Region of the Hepatitis C Virus Capsid Protein by NMR	317	X
4670	Sequence-specific 1H,13C and 15N chemical shift backbone NMR assignment and secondary structure of the Arabidopsis thaliana PIN1At	1144	X
4671	Sequence-specific 1H, 13C and 15N Resonance Assignments of the Major Cherry Allergen Pru a 1	1751	X
4673	Solution structure of Ileal Lipid Binding Protein in complex with glycocholate	901	X
4674	Structural Proteomics of M. thermoautotrophicum: A global survey of non-membrane protein expression, solubility and structure	761	X
4675	1H, 13C and 15N resonance assignments of the DNA binding domain of the human forkhead transcription factor AFX	1162	X
4676	Assignment of 1H, 13C and 15N Resonances in Unfolded Apomyoglobin at pH 2.3	886	X
4677	Solution Structure of the Cysteine-rich Domain of the Escherichia coli Chaperone Protein DnaJ	863	X
4678	Solution Structure of the RNA Polymerase Subunit RPB5 from Methanobacterium thermoautotrophicum	905	X
4679	1H, 15N, 13C, and 13CO Assignments and Secondary Structure Determination of Collagenase-3 (MMP-13) Complexed with a Hydroxamic acid Inhibitor	1703	X
4680	The Structure of a LysM Domain from E.coli Membrane-bound Lytic Murein Transglycosylase D (MltD)	679	X
4681	Backbone and side-chain 1H, 13C, and 15N Chemical Shift Assignments for apo-CRBPII	2543	X
4682	Backbone and side-chain 1H, 13C, and 15N Chemical Shift Assignments for holo-CRBP II	2319	X
4683	Multiple Modes of Peptide Recognition by the PTB Domain of the cell fate Determinant Numb	1864	X
4684	Three-Dimensional Solution Structure of the Isolated Cd4-alpha Domain of Metallothionein 2. Determination by Homonuclear and Heteronuclear Magnetic Resonance Spectroscopy	167	X
4685	Backbone and side-chain 1H chemical shifts for J-atracotoxin-Hv1c	209	X
4686	The Human CC Chemokine I-309, Structural Consequences of the Additional Disulfide Bond.	431	X
4687	1H chemical shift assignments of the dimeric form of d	88		X
4688	Assignment and secondary structure identification of the ribosomal protein L18 from Thermus thermophilus	1158	X
4689	NMR Studies of the Backbone Flexibility and Structure of Human Growth Hormone: a Comparison of High and Low pH Conformations	1149	X
4692	SOLUTION STRUCTURE OF A HUMAN TELOMERE FRAGMENT	266		X
4694	NMR structure of two cyclic oligonucleotides. A monomer-dimer equlilibrium between dumbbell and quadruplex structures.	89		X
4695	Effect of the single mutation His 64->Phe on the stability and folding of apomyoglobin	576	X
4696	A new fold in the scorpion toxin family, associated with an activity on ryanodine-sensitive calcium channel	254	X
4697	Structure of the fMet-tRNAfMet-binding domain of B. stearothermophilus initiation factor IF2	1101	X
4698	1H, 13C, and 15N backbone assignments of TGF-beta type II receptor ligand binding domain	553	X
4699	The transmembrane domains of hepatitis C virus envelope glycoproteins E1 and E2 play a major role in heterodimerisation	144	X
4700	Structure of Cdc42 bound to the GTPase Binding Domain of PAK	2515	X
4701	Tumor suppressor INK4: refinement of p16/INK4A structure and determination of p15/INK4B structure by comparative modeling and NMR data	1125	X
4702	Structure of the Negative Regulatory Domain of p53 bound to S100B	113	X
4703	1H sequential assignment and solution secondary structure of mouse MIP-3a chemokine	537	X
4704	Analysis of the dynamic properties of Bacillus circulans xylanase upon formation of a covalent glycosyl-enzyme intermediate	695	X
4706	Structure and Binding Specificity of the Second N-Terminal Cellulose-Binding Domain from Cellulomonas fimi Endoglucanase C	1609	X
4707	WT1-KTSs free	570	X
4708	WT1-KTS/DNA complex	443	X	X
4709	WT1+KTS/free	579	X
4710	WT1+KTS/DNA complex	416	X	X
4711	NMR backbone assignments of the cold-regulated RNA-binding protein, RbpA1, in the cyanobacterium, Anabaena variabilis M3	293	X
4712	1H, 15N and 13C Assignments and secondary structure of nFGF	1445	X
4713	Structural analysis of WW domains and design of a WW prototype	210	X
4714	Structural analysis of WW domains and design of a WW prototype	253	X
4715	Structural analysis of WW domains and design of a WW prototype	223	X
4716	1H, 15N, and 13C NMR Backbone Assignments and Secondary Structure of the C-terminal Recombinant Fragment of Auxilin Including the J-domain	1166	X
4717	1H, 15N, 13C, and 13CO Assignments for ZipA	1672	X
4718	Assignments of amide 1H, amide 15N, and Ca, CO, Cb 13C shifts for the replication terminator protein	587	X
4719	Backbone 1H, 13C and 15N chemical shift assignments of the Ras-binding domain (RBD) of AF6	1361	X
4720	Backbone 1H, 15N, and 13C Resonance Assignments of Inhibitor-2-- a Protein Inhibitor of Protein Phosphatase-1	1312	X
4721	Structure of the Central Core Domain of TFIIEbeta with a Novel Double-stranded DNA-binding Surface	944	X
4722	1H,13C and 15N resonance assignments of Aquifex aeolifex aeolicus shikimate kinase in complex with shikimate	2020	X
4723	Involvement of Electrostatic Interactions in the Mechanism of Peptide Folding Induced by Sodium Dodecyl Sulfate Binding	144	X
4724	Involvement of Electrostatic Interactions in the Mechanism of Peptide Folding Induced by Sodium Dodecyl Sulfate Binding	304	X
4725	Determination of the three dimensional structure and HN--S hydrogen bonding of the synthetic 113Cd3-beta-N domain of lobster MT-1 by Nuclear Magnetic Resonance	155	X
4726	Structure of a Conserved Domain Common to the Transcription Factors TFIIS, elongin A, and CRSP70	839	X
4727	Another piece of the Ribosome: Solution Structure of S16 and its Location in the 30S Subunit	979	X
4728	1H assignments of the EGF-like module 3 from vitamin K-dependent protein S	514	X
4729	1H, 15N, 13CA, 13CB, 13C' assignments of the EGF-like module pair 3-4 from vitamin K-dependent protein S	1521	X
4731	Sequence-specific 1H, 13C, and 15N Assignment of the Human Melanoma Inhibitory Activity (MIA) Protein	808	X
4732	HMG-D complexed to a bulge DNA: an NMR study	691	X
4733	HMG-D complexed to a bulge DNA: an NMR study	203		X
4734	HMG-D complexed to a bulge DNA: an NMR study	581	X	X
4735	Sequence-specific NMR resonance assignments for the backbone atoms of olfactory marker protein (OMP)	920	X
4736	1H, 13C, 15N Chemical Shift Assignment for the human prion protein variant M166V	1251	X
4737	The Structure of the Transcriptional Antiterminator NusB from Escherichia Coli	1579	X
4739	NMR solution structure of the calcium-bound C-terminal domain (W81-S161) of Calcium Vector Protein from Amphioxus	640	X
4740	Solution Structure of a 8.3 kDa Protein (gene MTH1184) from Methanobacterium thermoautotrophicum	526	X
4741	Structure and folding of Glucagon-like Peptide 1-7-(7-36)-amide in aqueous trifluoroethanol studied by NMR	1512	X
4742	Proton and nitrogen chemical shift assignments for the chitin-binding domain of Bacillus circulans WL-12 Chitinase A1	348	X
4743	1H Chemical Shift Assignments for fully reduced cytochrome c7 from Desulfuromonas acetoxidan	400	X
4744	1H Chemical Shift Assignments for fully oxidized cytochrome c7 from Desulfuromonas acetoxidans	357	X
4745	Solution Conformation of a Bulged Adenosine in an RNA Duplex by Relaxation Matrix Refinement	164			X
4746	Average solution structure of d(TTGGCCAA)2 bound to Chromomycin-A3 and cobalt	214		X		X
4747	Random Coil Chemical Shifts in Acidic 8 M Urea and Their Implementation into NMRView	327	X
4748	Three-Dimensional Solution Structure of Oryzacystatin-I, a Cysteine Proteinase Inhibitor of the Rice, Oryza sativa L. japonica	1343	X
4749	NMR structure of a DNA three-way junction	282		X
4750	NMR structure of the most conserved RNA motif in Srp RNA	214			X
4751	Assignment of 1H and 15N resonances of mouse lysozyme	836	X
4752	1H,13C,15N chemical shift assignments for the DNA binding domain of gpNu1	879	X
4753	Average solution structure of d(TTGGCCAA)2 bound to Chromomycin-A3 and zinc	238		X		X
4754	Determination of the three dimensional structure of the synthetic 113Cd3-beta-C domain of lobster MT-1 by Nuclear Magnetic Resonance	166	X
4755	Solution structure of HpTx2, a toxin from heteropoda venatoria spider that blocks Kv4.2 potassium channel	164	X
4757	1H, 13C, 15N Chemical Shift Assignment for the UBA(2) Domain of HHR23A	490	X
4758	A novel killer toxin-like protein, SKLP, is a member of the single-domain beta-gamma crystallin family proteins	776	X
4759	Backbone 1H, 15N and 13Calpha assigned chemical shifts for reduced Escherichia coli cytochrome b562	270	X
4760	Structural and Functional Differences of Two Toxins from the Scorpion Pandinus Imperator	225	X
4761	Magnetic Susceptibility Tensor and Heme Contact Shifts Determinations in the Rhodobacter capsulatus Ferricytochrome c': NMR and Magnetic Susceptibility Studies	855	X
4765	Backbone 1H,13C, and 15N resonance assignments of an 18.2kDa protein, E.Coli peptidyl-prolyl cis-trans isomerase b (EPPIb)	793	X
4766	Backbone and partial side chain resonance assignments of Vesl-1S	1378	X
4767	1Ha and 13Ca, 13Cb shifts of apocytochrome b562 at pH 5.1 (temperature 293 K)	411	X
4768	Structure of parvulin hPar14	636	X
4769	Backbone 1H, 13C and 15N assignments for yeast ubiquitin at pH 7.5	530	X
4770	Backbone 1HN, 15N and 13C shifts for GDP-loaded Cdc42 from Candida albicans	534	X
4771	Assignment of the 1H, 15N and 13C resonances of the C-terminal domain of the TolA protein of Escherichia coli, involved in the cell envelope integrity	1078	X
4772	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the N-terminal RNA-binding domain of human RNA-binding protein with multiple splicing	460	X
4773	Backbone assignments for OspA N-terminal fragment[27-163]	682	X
4774	Three-dimensional Structure of the Histidine-containing Phosphocarrier Protein (Hpr) from Enterococcus faecalis in Solution	609	X
4775	Solution structure of the spindle assembly checkpoint protein human MAD2	2013	X
4777	Complete 1H, 15N and 13C Assignment of the Functional Domain of Paracoccus denitrificans Cytochrome c552 in the Oxidized state	1204	X
4778	Backbone 1HN, 15N and 13C shifts for GMPPNP-loaded Cdc42 from Candida albicans	533	X
4779	Backbone sequential resonance assignments of the ligand binding domain of the human TGF-beta type II receptor	1259	X
4780	NMR Structure of Stem-loop SL2 of the HIV-1 Psi RNA Packaging Signal Reveals a Novel A-U-A Base-triple Platform	240			X
4781	NMR Structure of Stem-loop SL2 of the HIV-1 Psi RNA Packaging Signal Reveals a Novel A-U-A Base-triple Platform	786	X		X
4782	1H, 13C and 15N NMR assignments of the C-type lectin TC14	1198	X
4784	1H and 15N chemical shift assignments and interproton 3JHNHA coupling constants of the DNA-binding domain of the tyrosine repressor from Haemophilus influenzae, a transcription factor that belongs to the prokaryotic NtrC superfamily	470	X
4785	1H, 13C, and 15N assignment of a bleomycin resistance protein in its native form and in a complex with Zn(2+) ligated bleomycin	458	X
4786	1H, 13C, and 15N assignment of a bleomycin resistance protein in its native form and in a complex with Zn(2+) ligated bleomycin	1289	X
4787	Assignment of 1H, 13C and 15N resonances of domain III of the ectodomain of apical membrane antigen 1 from Plasmodium falciparum	1124	X
4788	1H,15N, and 13C NMR resonance assignments for the Eps15 Homology domain Resp1	1060	X
4789	Backbone 1H, 13C, and 15N Chemical Shift Assignments for TAZ2 domain of CBP	971	X
4790	1H, 13C and 15N Resonance Assignments of the SNT PTB Domain in Complex with FGFR1 Peptide	1305	X
4791	Sequence-specific 1H, 15N and 13C Resonance Assignments for an Engineered Arginine-rich Domain of the Hepatitis C Virus NS3 RNA Helicase	1662	X
4792	Backbone NMR Assignment and Secondary Structure of the Dimeric ParD Protein	856	X
4793	Structure-based Functional Classification of Hypothetical Protein MTH538 from Methanobacterium thermoautotrophicum	1217	X
4794	Chemical Shift Assignments for Human WT Gelsolin Domain 2	724	X
4795	Chemical Shift Assignments for Human D187N Gelsolin Domain 2	637	X
4796	Solution structure of hypothetical protein MTH1175 from Methanobacterium thermoautotrophicum	1191	X
4797	Sequence-specific resonance assignments of the potent cytolysin equinatoxin II	2031	X
4798	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Frq1	862	X
4799	Solution Structure of Human Immunodeficiency Virus Type 1 Vpr (13-33) Peptide in Micells	168	X
4800	Chemical shifts of 1H resonances of the heme protons and of the side chain protons of the two axial ligands, His69 and Met106, and of Trp109 of the isolated c domain of Paracoccus pantotrophus in the reduced state	31	X
4801	Chemical shifts of 1H resonances of the heme protons and of the side chain protons of the two axial ligands, His69 and Met106, of the isolated c domain of Paracoccus pantotrophus in the oxidized state	16	X
4802	1H, 13C, and 15N sequential assignment of the triple labelled N-terminal domain of the Histone like Nucleoid Structuring protein (H-NS) from Salmonella typhimurium (first 64 residues of the protein)	353	X
4803	1H,13C and 15N chemical shifts of bovine ferrous cytochrome b5	1039	X
4804	1H,13C and 15N chemical shifts of bovine ferrous cytochrome b5-N17D	1039	X
4805	1H, 13C and 15N chemical shifts of bovine ferric cytochrome b5 in complex with horse heart ferric cytochrome c	224	X
4806	1H, 13C and 15N chemical shifts of bovine ferric cytochrome b5	298	X
4807	1H, 13C and 15N chemical shifts of bovine ferric cytochrome b5-N17D	298	X
4808	1H, 13C and 15N chemical shifts of bovine ferrous cytochrome b5 in complex with horse heart ferrous cytochrome c	774	X
4809	1H, 13C and 15N chemical shifts of bovine ferrous cytochrome b5-N17D in complex with horse heart ferrous cytochrome c	773	X
4810	1H, 13C and 15N chemical shifts of bovine ferric cytochrome b5 in complex with horse heart ferric cytochrome c	220	X
4811	1H and 15N Chemical Shift Assignments for Apo-Recombinant Bovine alpha-Lactalbumin	332	X
4812	1H Chemical Shift Assignments for Weak Toxin WTX from Naja kaouthia venom	919	X
4813	NMR structure of lac repressor HP62-DNA complex	830	X	X
4814	Complete 1H, 15N, and 13C assignments of an exchangeable apolipoprotein, Locusta migratoria apolipophorin III	1581	X
4815	NMR structure of Cardiotoxin in DPC-micelle	435	X
4816	Structural Features of an Influenza Virus Promoter and their Implications for Viral RNA Synthesis	308			X
4817	Backbone and side chain 1H, 15N and 13C chemical shifts for Mj0307 from Methanococcus jannascii	853	X
4818	1H, 15N and 13C Resonance Assignments for the N-Terminal Domain of the MAPK Phosphatase MKP3	1568	X
4819	High precision NMR structure of YhhP, a novel Esherichia coli protein implicated in the cell division	1016	X
4820	1H and 13Ca Chemical Shift Assignments for the Pheromone Er-22	282	X
4821	Assignment of 1H, 13C, and 15N resonances to the sensory domain of membraneous two-component fumarate sensor (histidine protein kinase) DcuS of Escherichia coli	1649	X
4825	1H, 15N and 13C NMR Resonance Assignments of RC-RNase 2	1370	X
4827	Structural comparison between WT and P25S human cystatin A by NMR spectroscopy. Does this mutation affect the alpha-helix conformation? -- Part I wild type assignments	1028	X
4828	Structural comparison between WT and P25S human cystatin A by NMR spectroscopy. Does this mutation affect the alpha-helix conformation? -- Part II P25S	1020	X
4829	1H, 15N and 13C resonance assignments for the DNA-binding domain of interleukin enhancer binding factor	1015	X
4830	The Hairpin Structure of the (6)F1(1)F2(2)F2 Fragment from Human Fibronectin Enhances Gelatin Binding	1159	X
4831	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Lysozyme	511	X
4832	Insulin Like Growth Factor 1	375	X
4833	1H, 13C, and 15N assignments for the Antifungal protein from Streptomyces tendae Tu901	1070	X
4834	Backbone (1H, 15N, 13C) Resonance Assignments of a 21 kDa construct of S. aureus Peptide Deformylase	1307	X
4835	NMR Structure of the palindromic DNA decamer D(GCGTTAACGC)2	82		X
4836	Complete 1H, 13C and 15N Backbone Assignments for the Hepatitis A Virus 3C Protease	1235	X
4837	Solution Structure of Methylophilus methylotrophus Cytochrome C'': Insights into the Structural Basis of Heme-ligand Detachment	857	X
4838	NMR Mapping and Secondary Structure Determination of the Major Acetylcholine Receptor alpha-Subunit Determinant Interacting with alpha-Bungarotoxin	477	X
4839	Full assignments of RSVPR deltaLAM	1213	X
4840	1H, 13C and 15N resonance assignment and secondary structure of Mycobacterium tuberculosis adenylate kinase	1359	X
4841	1H, 15N and 13C chemical shift assignments for the PAH2 domain of mSin3B complexed to Mad1-SID	1369	X
4842	NMR solution structure of porcine peptide YY	213	X
4843	Secondary Structure and Backbone Resonance Assignments for Human Interleukin-13	1269	X
4844	Backbone HN, N , Ca, C' and Cb assignment of the 25 kDa peptide methionine sulfoxide reductase from Erwinia chrysanthemi	1008	X
4845	NMR solution structure of alpha-conotoxin Im1 point mutation variant R11E	65	X
4846	NMR solution structure of alpha-conotoxin Im1 point mutation variant R7L	72	X
4847	NMR solution structure of alpha-conotoxin Im1 point mutation variant D5N	74	X
4848	Conformational Changes in the Isolated N-terminal Domain of 5-Enolpyruvylshikimate-3-phosphate Synthase upon Shikimate-3-phosphate Binding	2670	X
4849	NMR Assignment of the A form of the Pheromone-binding Protein of Bombyx mori	1769	X
4850	Glutaredoxin 3 from Escherichia coli in the fully oxidized form	661	X
4851	CDC4P from Schizosaccharomyces pombe	1547	X
4852	1H and 15N chemical shift assignments for Herpersvirus-8 MIP-II	619	X
4853	1H Chemical Shift Assignment for the Major Conformer in Solution of the Alpha-like Scorpion Toxin LqhIII	406	X
4854	Chemical shift assignments for the isolated N-terminal domain of EPSP synthase	2472	X
4855	(14-38, 30-51) Double-disulphide intermediate in folding of Bovine Pancreatic Trypsin Inhibitor: A two-dimensional 1H nuclear magnetic resonance study	401	X
4856	Structural Insight into Human Zn(2+)-bound S100A2 from NMR and Homology Modeling	1406	X
4857	Solution structure and dynamic character of the histidine-containing phosphotransfer domain of anaerobic sensor kinase ArcB from Escherichia coli	1522	X
4858	SOLUTION STRUCTURE OF NUCLEOLIN RBD1	1107	X
4859	HIGH RESOLUTION SOLUTION STRUCTURE OF THE PROTEIN PART OF CU7 METALLOTHIONEIN	212	X
4860	1H, 13C, and 15N Chemical Shift Assignments for human lymphocyte specific kinase (Lck) unique and SH3 domain	1176	X
4862	[ALA31, AIB32]-NEUROPEPTIDE Y	258	X
4863	SOLUTION STRUCTURE OF NUCLEOLIN RBD2	936	X
4864	NMR Chemical shift mapping of the binding site of a protein proteinase inhibitor: changes in the 1H, 13C and 15N NMR chemical shifts of turkey ovomucoid third domain upon binding to bovine chymotrypsin Aa	188	X
4865	Backbone 1H, 13C, 15N Chemical shift Assignment for OMTKY3 bound to bovine Chymotrypsin Aa	176	X
4866	Backbone Resonance Assignment of Human UBC4	500	X
4867	SOLUTION STRUCTURE OF NUCLEOLIN RBD12 IN COMPLEX WITH SNRE RNA	2160	X		X
4868	Sequential 1H assignments for BPTI-R52 (= BPTI with Met to Arg mutation at position 52)	393	X
4869	HMG PROTEIN NHP6A FROM SACCHAROMYCES CEREVISIAE	880	X
4870	Sequence-specific 1H, 15N, and 13C resonance assignments for the whole region 4 of Escherichia coli RNA polymerase sigma70 subunit	1224	X
4871	1H, 13C and 15N Resonance Assignments and Secondary Structure of the c-Myc Binding Domain (MBD) and the SH3 Domain of the Tumor Suppressor Bin1	1469	X
4872	Interhelical Ion Pairing in Coiled Coils: Solution Structure of a Heterodimeric Leucine Zipper and Determination of pKa Values of Glu Side Chains	456	X
4873	Partially folded conformation of the (30-51) intermediate in the disulphide folding pathway of bovine pancreatic trypsin inhibitor. 1H and 15N resonance assignments and determination of backbone dynamics from 15N relaxation measurements	443	X
4874	Sequence-specific assignment of the PAH2 domain of Sin3B free and complexed to Mad1	500	X
4875	1H NMR Analysis of the partly-folded non-native two-disulphide intermediates (30-51, 5-14) and (30-51, 5-38) in the folding pathway of bovine pancreatic trypsin inhibitor	370	X
4876	1H,13C,15N assignment of Ca2+-bound state of Canine Milk Lysozyme at 30deg	629	X
4877	1H NMR Analysis of the partly-folded non-native two-disulphide intermediates (30-51, 5-14) and (30-51, 5-38) in the folding pathway of bovine pancreatic trypsin inhibitor	381	X
4878	Three-dimensional Structure Topology of the Calreticulin P-domain based on NMR Assignment	1088	X
4879	Assignment of the 1H, 13C and 15N Signals of Sortase	1755	X
4880	1H, 15N and 13C resonance assignments of the N-terminal region of calponin	1411	X
4881	Backbone 1H, 13C, 15N and 13CB and 1HB chemical shift assignments for Azotobacter vinelandii C69A holoflavodoxin	1369	X
4882	1H NMR Study on the Binding of Pin1 Trp-trp domain with Phosphothreonine Peptides	260	X
4883	1H,15N assignment of Ca2+-free state of Canine Milk Lysozyme at 20deg	252	X
4884	1st LIM domain of PINCH protein	679	X
4885	Backbone 1H, 15N and 13C Resonance Assignments of the NTPase Subdomain of the Hepatitis C Virus NS3 RNA Helicase	594	X
4886	Backbone 1H and 15N and 1HB chemical shift assignments for Azotobacter vinelandii C69A apoflavodoxin	670	X
4887	1H,15N assignment of Ca2+-bound state of Canine Milk Lysozyme at 20deg	252	X
4888	Backbone 1H and 15N Chemical Shift Assignment of c-Src SH3 in high salt solution	140	X
4889	Backbone 1H and 15N Chemical Shift Assignment of c-Src SH3 complexed with RLP2 ligand in high salt solution	140	X
4890	1H resonance assignments for the N-ter domain of the human TFIIH MAT1 subunit	424	X
4891	1H chemical shift assignments for cobrotoxin II	361	X
4892	1H, 13C, and 15N Chemical Shift Assignments for apo-Mts1 (S100A4)	754	X
4893	1H, 15N and 13C NMR Resonance Assignments of RC-RNase 4	1371	X
4894	RNA recognition by a staufen double-stranded RNA-binding domain	1223	X		X
4895	Solution NMR Structure of the Cold-shock Protein from the Hyperthermophilic Bacterium Thermotoga maritima	792	X
4896	Sequential Assignment and Secondary Structure of the 14kDa chemotactic Protein CheY2 from Sinorhizobium meliloti	915	X
4897	Sequential assignment, secondary structure and binding site of the carbohydrate-binding domain of papg from Uropathogenic E.coli	937	X
4898	Assignment of 1H, 13C, 15N and 31P resonances of the FYVE domain in the complex with phosphatidylinositol 3-phosphate.	1068	X
4899	SMN Tudor Domain Structure and its Interaction with the Sm Proteins	622	X
4900	1H and 15N chemical shift assignments of the C-terminal xylan binding module of C. fimi xylanase 11A	622	X
4901	1H, 15N, 13C assignments of the N-terminal domain of the human TFIIH p62 subunit	1153	X
4902	Complete sequence-specific 1H, 13C and 15N resonance assignments of a novel hPTK6 SH2 domain	1160	X
4905	1H, 13C and 15N Chemical Shift Assignments for Urea-denatured G88W-110 Fragment of Staphylococcal Nuclease	1119	X
4906	Solution Structure of a C-Terminal Coiled-Coil Domain from Bovine IF1 - the Inhibitor Protein of F1 ATPase	540	X
4907	NMR Solution Structure of Phospholamban	361	X
4908	Assignment of 1H, 13C and 15N resonances of the a'-domain of ERp57	805	X
4909	Assignment of 1H, 15N and 13C resonances of the carbohydrate recognition domain of human galectiin-3	1235	X
4910	1H and 15N chemical shift assignments for LEKTI domain one (HF6478)	737	X
4911	Structural Basis of Diverse Sequence-dependent Target Recognition by the 8kDa Dynein light chain	988	X
4912	Structural Basis of Diverse Sequence-dependent Target Recognition by the 8kDa Dynein light chain	960	X
4913	Backbone 1H, 15N, and 13C Resonance Assignments of ARPP-19	879	X
4914	Backbone 1H chemical shift assignments for vMIP-II	506	X
4915	Structure and Function of the C-terminal PABC Domain of Human Poly(A)-binding Protein	1463	X
4916	RECEPTOR-BOUND CONFORMATION OF PACAP21	148	X
4917	Solution structure of a lipid transfer protein extracted from rice seeds. Comparison with homologous proteins	1110	X
4918	Letter to the Editor: Assignments of 1H and 15N resonances of the Pseudomonas aeruginosa K122-4 pilin monomer.	756	X
4919	Thioredoxin fold as a Homodimerization Module in the Putative Chaperone ERp29: NMR Structures of the Domains and Experimental Model of the 51 kDa Dimer	1290	X
4920	Thioredoxin fold as a Homodimerization Module in the Putative Chaperone ERp29: NMR Structures of the Domains and Experimental Model of the 51 kDa Dimer	1189	X
4921	Solution structure of poneratoxin	199	X
4922	Backbone 1H, 13C and 15N chemical shift assignments for unfolded apoplastocyanin	666	X
4923	1H chemical shift assignments for omega-atracotoxin-Hv2a	280	X
4924	Interactions of a toxin from the scorpion Tityus serrulatus with a cloned K+ channel from squid (SqKv1A).	240	X
4925	Structural Basis for the Functional switch of the E. Coli Ada Protein	731	X
4926	1H and 15N Chemical Shifts of CI2 with a ten glutamine repeat between residues 59 and 60	621	X
4927	1H, 13C, 15N Resonance Assignments of a Circular Permuted Variant of CV-N (cpCV-N)	1171	X
4928	Structure of the PHD Zinc finger from human Williams-Beuren syndrome transcription factor	591	X
4929	The 1H, 15N and 13C resonance assignments for the Tctex1 dynein light chain from Chlamydomonas flagella	904	X
4930	1H and 15N Chemical Shift Assignments for the homodimer of human TFF1	445	X
4931	Solution structure of dynein light chain 8 (DLC8) and bim peptide complex	956	X
4932	NMR Structure of wheat nonspecific lipid transfer protein	597	X
4933	1H and 15N Chemical Shift Assignments for a Cys58Ser mutant of TFF1	445	X
4934	Structure and functionality of a designed p53 dimer	360	X
4935	Backbone Assignments for Af19	1202	X
4936	1H, 13C and 15N chemical shift assignments of the outer membrane protein OmpX from E.coli in DHPC micelles	687	X
4937	1H chemical shifts for 'Hairpinless' mutant of omega-atracotoxin-Hv1a	127	X
4938	Two Different Neurodegenerative Diseases Caused by Proteins with Similiar Structures	1685	X
4939	Solution Structures of Two CCHC Zinc Fingers from the FOG Family Protein U-shaped that Mediate Protein-Protein Interactions	244	X
4940	1H, 13C and 15N chemical shift assignment of the honeybee pheromone carrier protein ASP1	1175	X
4941	The Three-dimensional Structure of the C-terminal DNA-binding Domain of Human Ku70	974	X
4942	1H, 15N and 13C Resonance Assignments and Secondary Structure of the Liver Ribonuclease from Bullfrog Rana catesbeiana	1381	X
4943	1H Chemical shift Assignments for Lysozymes marketed by Seikagaku and Sigma companies at pH 3.8, 308K	964	X
4944	1H, 13C and 15N backbone resonance assignment of the arsenate reductase from Staphylococcus aureus in its reduced state.	724	X
4945	VAM3P N-TERMINAL DOMAIN SOLUTION STRUCTURE	1497	X
4946	Solution Structures of C-1027 Apoprotein and its Complex with the Aromatized Chromophore	646	X
4947	Solution Structures of C-1027 Apoprotein and its Complex with the Aromatized Chromophore	623	X
4948	1H Chemical Shift Assignments of a-bungarotoxin/ nicotinic acetilcholine receptor mimotope complex	525	X
4950	Structure of the Anchor-Domain of Myristoylated and Non-myristoylated HIV-1 Nef Protein	382	X
4951	Structure of the Anchor-Domain of Myristoylated and Non-myristoylated HIV-1 Nef Protein	410	X
4952	The UBX Domain: A Widespread Ubquitin-like Module	863	X
4953	Assignment of 1H, 13C and 15N resonances of the PPIase domain of the trigger factor from Mycoplasma genitalium	1161	X
4954	1H, 13C and 15N chemical shifts assignments for the N-terminal domain of riboflavin synthase of E. Coli with riboflavin as a bound ligand	1163	X
4955	NMR Structure of Cysteinyl-phosphorylated Enzyme IIB of the N,N'-diacetylchitobiose-specific Phosphoenolpyruvate-dependent Phosphotransferase System of Escherichia coli	1379	X
4956	1H, 13C and 15N resonance assignment of YajQ, a protein of unknown structure and function from Escherichia coli	1070	X
4957	Solution Structure of the Transcriptional Activation Domain of the Bacteriophage T4 Protein, MotA	1197	X
4958	1H, 13C and 15N Sequence-specific Resonance Assignment of the PSCD4 Domain of Diatom cell wall Protein Pleuralin-1	1074	X
4959	Solution structure of the epsin N-terminal homology (ENTH) domain of human epsin	1668	X
4960	Solution Conformation of the Met 61 to His 61 Mutant of Pseudomonas stutzeri substarin ZoBell Ferrocytochrome c-551	489	X
4961	1H, 15N and 13C assignments of the N-terminal domain of Yersinia outer protein H in its apo form and in complex with a phosphotyrosine peptide representing the putative binding site on host protein target p130Cas	1249	X
4963	Chemical Shift Assignments and Coupling Constants for the rat Nedd4 WWIII domain - rat ENaC bP2 Peptide Complex	804	X
4964	1H, 13C and 15N resonance assignment for barnase	1383	X
4965	1H, 15N, and 13C Assignments and Secondary Structure Identification for Full-length Ribosomal Protein L11 from Thermus thermophilus	1722	X
4966	1H and 13C Chemical Shift Assignments for Cardiotoxin A3 from Naja Atra at Neutral pH	491	X
4967	Letter to the Editor: Backbone resonance assignment of Mason-Pfizer Monkey Virus Protease	395	X
4968	Bovine Pancreatic Trypsin Inhibitor pH 5.8	529	X
4969	Backbone 1H, 13C and 15N chemical shift assignments for the Brucella D4.4 VH antibody fragment	1361	X
4971	NMR data for the Carp Granulin 1 3-30 subfragment	220	X
4972	1H, 13C, and 15N assignment of Crh, a protein involved in carbon catabolite repression in B. subtilis	1049	X
4973	Sequential Assignment and Secondary Structure of Saratin, an Inhibitor of von Willebrand factor-dependent Platelet Adhesion to Collagen	1215	X
4974	Rapid Protein fold Determination using Secondary Chemical Shifts and Cross- hydrogen bond 15N-13C' Scalar Couplings (3hbJNC')	827	X
4975	Assignment of selectively 13C-labeled cellopentaose synthesized using an engineered glycosynthase	13				X
4976	Antifungal and antibacterial mutant of heliomicin	273	X
4977	1H and 15N NMR assignments of the 7kd wheat lipid transfer protein	482	X
4978	NMR assignments for the Ca2+-bound B0 isoform of the C-terminal globular domain of agrin (agrin-G3)	1273	X
4979	1H and 13C chemical shift assignments for the pheromone Er-23 from Euplotes raikovi	318	X
4980	1H and 15N sequential assignment and secondary structure of the monomeric N67D mutant of bovine seminal ribonuclease	839	X
4981	Identification of the phospholipid binding site of human beta2-glycoprotein I domain V by heteronuclear magnetic resonance	1087	X
4982	1H, 13C and 15N NMR sequence-specific resonance assignments for bovine apo-S100A1(aa) in oxidized form	1145	X
4983	Backbone 1H, 15N, 13C and side chain 13C assignment of YUH1-Ub in a 35 kDa complex	1768	X
4984	The Solution Structure and Interactions of CheW from Thermotoga maritima	1712	X
4985	Letter to the Editor: 1H, 13C, and 15N assignment of the flavodoxin-like domain of the Escherichia coli sulfite reductase	1897	X
4986	Backbone 1H,13C and 15N chemical shift assignment for the ligand-free state of maltodextrin-binding protein	1691	X
4987	Backbone 1H,13C and 15N chemical shift assignment for the maltotriose-bound state of 2H,13C,15N-labeled maltodextrin-binding protein	1725	X
4988	Three Dimensional Solution Structure of Huwentoxin-II BY 2D 1H-NMR	267	X
4989	Solution Structure of B.subtilis Acyl Carrier Protein	904	X
4990	Solution structure of betacellulin, a new member of EGF-family ligands.	291	X
4991	Identification of a novel archaebacterial thioredoxin: Determination of function through structure.	664	X
4992	Assignment of 1H, 13C and 15N NMR signals from the toluene 4-monooxygenase Rieske ferredoxin	1081	X
4993	Spatial structure of Zervamicin IIB bound to DPC micelles.	199	X
4994	Structure of the C-domain of Human Cardiac Troponin C in Complex with the Ca2+ Sensitizing Drug EMD 57033	788	X
4995	Solution NMR Structure and Folding Dynamics of the N-terminus of a rat Non-muscle Alpha-tropomyosin in an Engineered Chimeric Protein	475	X
4996	NMR-Based Structure of the Conserved Protein MTH865 from the Archea Methanobacterium thermoautotrophicum	945	X
4997	1H, 13C Chemical Shift Assignment of PT-insulin in H2O and 35% TFE	655	X
4998	1H, 13C and 15N Chemical Shift Assignments for the HPV-18 E2 DNA-binding Domain	808	X
4999	Assignment of the 1H, 15N and 13C resonances of the nucleocapsid-binding domain of the Sendai virus Phosphoprotein	1234	X
5000	1H, 15N and 13C Resonance Assignments for the N-Terminal Domain of the MAPK Phosphatase PAC-1	1097	X
5004	1H, 13C, 13CO, and 15N Chemical Shift Assignments for human IL-13	1405	X
5005	Backbone Sequential Resonance Assignments of Yeast iso-2 Cytochrome c, Reduced and Oxidized forms	882	X
5006	1H Chemical Shift Assignments for alpha-Bungarotoxin	447	X
5007	SOLUTION STRUCTURE OF THE VS RIBOZYME SUBSTRATE STEM-LOOP	300			X
5008	Assignment of 1H,13C and 15N backbone resonances of p13suc1 proteins -- wild type	436	X
5009	Assignment of 1H,13C and 15N backbone resonances of p13suc1 proteins -- PA90	1466	X
5010	1H, 15N, and 13C chemical shift assignments for DNA polymerase X	2116	X
5011	Anabaena apoflavodoxin hydrogen exchange: on the stable exchange core of the alfa/beta(21345) flavodoxin-like family	1040	X
5012	Gelatin-binding Region of Human Matrix Metalloproteinase-2: Solution Structure, Dynamics, and Function of the COL-23 Two-domain Construct	499	X
5013	1H, 15N and 13C Assignments of the Catalytic Domain of E6-associated Protein (E6AP)	1357	X
5014	Sequence Specific Resonance Assignment of the Central Domain of Cardiac Myosin Binding Protein C (MyBP-C)	1365	X
5018	Solution Structure of the Tumor Necrosis Factor Receptor-1 Death Domain	1102	X
5019	1H, 13C and 15N Chemical Shift Assignments of the N-terminal PAS Domain of mNPAS2	864	X
5020	NMR Ensemble of Ion-Selective Ligand D18 for Platelet Integrin AlphaIIb-Beta3	31	X
5021	NMR Ensemble of Ion-Selective Ligand D18 for Platelet Integrin AlphaIIb-Beta3	32	X
5022	Converting a DNA Damage Checkpoint Effector (UmuD2C) into a Lesion Bypass Polymerase (UmuD'2C)	979	X
5023	Structural and thermodynamic studies on mutant RNA motifs that impair the specificity between a viral replicase and its promoter	10			X
5024	The NMR solution structure of alpha-bungarotoxin	298	X
5025	The Solution Structure of the Complex Formed between alpha-Bungarotoxin and an 18mer Cognate Peptide Derived from the alpha1 Subunit of the Nicotinic Acetylcholine Receptor from Torpedo californica	370	X
5026	Solution structure of cyanoferricytochrome C	690	X
5027	NMR Structure of Human Fibronectin EDA	1105	X
5028	Solution Structure of MCOTI-II, a Macrocyclic Trypsin Inhibitor	210	X
5029	Solution Structure of an Insect-specific Neurotoxin from the New World Scorpion Centruroides sculpturatus Ewing	384	X
5030	1H, 13C and 15N Chemical Shift Assignment of the Honeybee Odorant-binding Protein ASP2	946	X
5031	Sequence-specific 1H, 13C and 15N resonance assignments of the N-terminal, 135-residue domain of KaiA, a clock protein from Synechococcus elongatus	1702	X
5032	1H, 13C and 15N Resonance Assignments of the DNA Binding Domain of the Human Forkhead Transcription Factor AFX	297	X	X
5033	NMR Solution Structures of the Antifungal Heliomicin	275	X
5034	Solution structure of novispirin-2	148	X
5036	Solution Structure and Backbone Dynamics of the DNA-Binding Domain of Mouse Sox-5	556	X
5037	Solution structure of ovispirin-1	153	X
5038	Assignments for human ubiquitin-conjugating enzyme 2b (HsUbc2b)	1659	X
5039	Solution Structure of Ptu1, a Toxin from the Assassin bug Peirates turpis that blocks the Voltage-sensitive Calcium Channel N-type	169	X
5040	Backbone 1H, 15N, and 13C Resonance Assignments of Inhibitor-1--a Protein Inhibitor of Protein Phosphatase-1	1208	X
5041	Solution structure and backbone dynamics of human DNA ligase IIIalpha BRCT domain	885	X
5042	1H, 13C, and 15N Chemical Shift Assignments for Human Lymphotactin	1020	X
5043	LEM Domain of Human Inner Nuclear Membrane Protein LAP2	415	X
5044	1H, 13C, and 15N Chemical shift assignments for the third Immunoglobulin domain from the neural cell adhesion molecule, N-CAM	1156	X
5046	NMR Structure of HCV IRES RNA Domain IIIC	89			X
5047	NMR structure of the LCCL Domain and its Implications for DFNA9 Deafness Disorder	793	X
5048	1H and 15N assignments of rat apo cellular retinol-binding protein type I (CRBP-I)	1122	X
5049	Backbone 1H, 13C, and 15N data for the extracellular domain of human IFNAR2	1338	X
5050	Solution structure of Bungarus fasciatus IX, a Kunitz-type chymotrypsin inhibitor	429	X
5051	Backbone 1H, 13C, and 15N and Side-Chain 1H Chemical Shift Assignments for MTH1692	1625	X
5052	1H Assigned Chemical Shifts for Neurotoxin II	373	X
5053	Solution Structure of the Orphan PABC Domain from Saccharomyces cerevisiae Poly(A)-binding Protein	763	X
5054	The Structure of Ap4A Hydrolase Complexed with ATP-MgFx Reveals the Basis of Substrate Binding	2129	X
5055	Solution Structure of HI0257, a Bacterial Binding Protein	1173	X
5056	ATT an Arabidopsis thaliana Inhibitor of Trypsin and Chymotrypsin: Sequence-Specific Multinuclear Magnetic Resonance Assignments and Secondary Structure	676	X
5057	1H Chemical Shift Assignments for Alzheimer peptide Ab(1-40)	254	X
5058	Letter to the Editor: Sequence specific 1H, 13C and 15N resonance assignments of human GABA receptor associated protein	1476	X
5059	Chemical shift assignments for EC005 from E. coli	535	X
5060	1H, 15N, 13C NMR Assignments of TM006 Protein from Thermotoga maritima	791	X
5061	1H, 13C, and 15N Chemical Shift Assignments for DNA-binding domain of ADR6	1381	X
5062	Backbone 1H, 13C, and 15N Chemical Shift Assignment for Unfolded HIV-1 protease tethered dimer	950	X
5064	Backbone 1H, 13C, and 15N resonance assignments for a 14 kD protein, GABAA receptor associated protein (GABARAP)	875	X
5065	Quail Cysteine and Glycine-rich Protein, NMR, 15 Minimized Model Structures	623	X
5066	1H and 15N Chemical Shift Assignments for the Alpha-domain of Mouse Metallothionein-3	240	X
5067	Solution Structure of the Lipoyl Domain of the Chimeric Dihydrolipoyl Dehydrogenase P64K from Neisseria meningitidis	920	X
5068	Recombinant hen lysozyme containing the extra N-terminal Met as the standard reference for the study of hen lysozyme variants	788	X
5069	NMR Structural Study of Two-Disulfide Variant of hen Lysozyme: 2SS[6-127, 30-115]-A Disulfide Intermediate with a Partly Unfolded Structure	593	X
5070	Structure and dynamics of the anticodon-arm binding domain of Bacillus stearothermophilus tyrosyl-tRNA synthetase	1135	X
5071	Complex of the C-Domain of Troponin C with Residues 1-40 of Troponin I	753	X
5072	CD3 Epsilon and gamma Ectodomain Fragment Complex in Single-Chain Construct	1754	X
5073	Solution structure of the monomeric variant of the chemokine MIP-1beta	628	X
5074	LEM domain of human inner nuclear membrane protein emerin	345	X
5075	Solution Structure of Human Apolipoprotein(a) Kringle IV type 6	1110	X
5076	Resonance Assignment of the unfolded states of Cold Shock Domain of the human YB-1 protein	223	X
5077	1H, 15N, 13C NMR Assignments of M156R Protein from myxoma virus, NESG target OP2	1020	X
5078	Structure and Backbone Dynamics of a Lipoyl Domain from Human Mitochondrial Branched-Chain alpha-Ketoacid Dehydrogenase	970	X
5081	1H, 15N and 13C resonance assignments for the Gallium protoporphyrin IX-HasAsm hemophore complex	1052	X
5082	Solution Structure of a K(+)-Channel Blocker from the Scorpion Tityus cambridgei	155	X
5083	1H and 15N chemical shift assignments for human epidermal-type fatty acid-binding protein (E-FABP)	1118	X
5084	1H and 15N Chemical Shift Assignments for the Complex of C-terminal Domain of Human Poly(A)-Binding Protein and 22-residue Fragment of Paip1	605	X
5085	1H, 13C, and 15N Chemical Shift Assignments for the Complex of the C-terminal Domain of Human Poly(A)-binding Protein and C-terminal Fragment of Paip2	996	X
5086	Reduced recombinant Hydrogenobacter thermophilus cytochrome c-552 expressed in E. coli periplasm	493	X
5088	Characterization of Hydrogenobacter thermophilus Cytochromes c(552) Expressed in the Cytoplasm and Periplasm of Escherichia coli	399	X
5090	Letter to the Editor: 1H(N), 15N, 13CO, 13C[agr], 13C[bgr] Assignment and Secondary Structure of a 20 kDa [agr]-L-fucosidase from Pea using TROSY	817	X
5091	Solution structure of A67V mutant of rat ferro cytochrome B5	482	X
5092	1H chemical shift assignments for the cytoplasmic N-terminus of KCNMB2	324	X
5093	Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments for Ribosome-binding Factor A (RbfA)	1277	X
5094	Chemosensory Protein from Moth Mamestra brassicae. Expression and Secondary Structure from 1H and 15N NMR	840	X
5096	Solution Structure of a CCHH mutant of the ninth CCHC Zinc Finger of U-shaped	208	X
5097	1H Chemical Shift Assignments for Bucandin	412	X
5098	A Plant 4-kDa Peptide with Insulin-like Function	235	X
5099	Backbone and side chain 1H, 13C, and 15N Chemical Shift Assignments for N-TIMP-1 in N-TIMP-1/MMP-3(E202Q) Complex	928	X
5100	1H, 15N and 13C Assignments of FLIN2, an Intramolecular LMO2:ldb1 Complex	1775	X
5101	Structure and Properties of a Dimeric N-terminal Fragment of Human Ubiquitin	613	X
5102	A helical region in the C-terminus of small-conductance Ca2+-activated K+ channels controls assembly with apo-calmodulin	1556	X
5103	1H, 13C and 15N resonance assignments of the calcium binding protein S100P	957	X
5104	An NMR Approach to Structural Proteomics	1248	X
5105	An NMR Approach to Structural Proteomics	708	X
5106	An NMR Approach to Structural Proteomics	897	X
5107	Assignments of the 1H, 13C, and 15N resonances of the substrate-binding SSD domain from Lon protease	1180	X
5108	Solution structure of lactam analogue (DapE) of HIV gp41 600-612 loop	90	X
5109	Solution structure of a lactam analogue (DabD) of HIV gp41 600-612 loop	91	X
5110	Solution structure of beta3 analogue peptide (HCYS) of HIV gp41 600-612 loop	94	X
5111	Solution structure of HSER (ACE)IWGC(BSE)GKLICTTA analogue of HIV GP41 600-612 loop	94	X
5112	High-resolution Structures for the Psi-conotoxins Indicate Differences in Disulfide Bridge Dynamics	150	X
5113	High-resolution Structures for the Psi-conotoxins Indicate Differences in Disulfide Bridge Dynamics	142	X
5114	Refined Structure and Metal Binding site of the Kalata B1 Peptide	169	X
5115	Solution structure of Pyrobaculum aerophilum DsrC, an archaeal homologue of the gamma subunit of dissimilatory sulfite reductase	1180	X
5116	Solution Structure of Pyrobaculum Aerophilum DsrC/gamma subunit of dissimilatory sulfite reductase (reduced)	355	X
5117	Structural and Dynamic Differences of Rhodostomin, an RGD-containing Disintegrin, and its D51E mutant	448	X
5119	NMR Investigations of Subunit c of the ATP Synthase from Propionigenium modestum in Chloroform/methanol/water (4:4:1)	944	X
5120	1H Chemical Shift Assigments for the mEGF/TGFalpha44-50 chimeric growth factor	268	X
5121	In vivo Protein Cyclization Promoted by a Circularly Permuted Synechocystis sp. PCC6803 DnaB Mini-intein	774	X
5122	In vivo Protein Cyclization Promoted by a Circularly Permuted Synechocystis sp. PCC6803 DnaB Mini-intein	957	X
5123	Characterization of the Structure and Dynamics of Amyloidogenic Variants of Human Lysozyme by NMR Spectroscopy	246	X
5124	Characterization of the Structure and Dynamics of Amyloidogenic Variants of Human Lysozyme by NMR Spectroscopy	254	X
5125	Characterization of the Structure and Dynamics of Amyloidogenic Variants of Human Lysozyme by NMR Spectroscopy	250	X
5126	Complete 1H, 15N and 13C Assignment of the Carboxyl Terminal Domain of the Ciliary Neurotrophic Factor Receptor (CNTFR)	1303	X
5127	Letter to the Editor: Chemical shift assignment and chemical shift indexing of murine apo-Mts1	1082	X
5128	GABARAP, GABAA receptor associated protein	950	X
5129	1H, 13C, and 15N Chemical Shift Assignments for MTH1880	1041	X
5130	Assignment of 1H, 13C and 15N resonances of Human Lysozyme at 35 C	1107	X
5131	Structure, Dynamics and Binding Characteristics of the Second PDZ Domain of PTP-BL	1073	X
5132	1H and 15N assignments of ATTm+4, a truncated version of ATT, an trypsin/chymotrypsin inhibitor from Arabidopsis thaliana	274	X
5133	1H, 13C and 15N assignments of ATTm, a truncated version of ATT, an trypsin/chymotrypsin inhibitor from Arabidopsis thaliana	170	X
5134	Solution Structure of dAAUAA DNA Bulge	275		X
5135	Solution Structure of dAATAA DNA Bulge	267		X
5136	Solution structure of lactam analogue (EDap (Ace)IWGESGKLI(DAB)TTA) of HIV gp41 600-612 loop	86	X
5137	Solution structure of lactam analogue (DapD) of HIV gp41 600-612 loop	89	X
5138	Solution structure of lactam analogue (EDap (Ace)IWGESGKLI(DNP)TTA analogue of HIV GP41) of HIV gp41 600-612 loop	89	X
5139	Solution structure of lactam analogue (DDap) of HIV gp41 600-612 loop	84	X
5140	Solution structure of lactam analogue (DDab)of HIV gp41 600-612 loop	90	X
5141	Sequence-specific resonance assignments of the N-terminal, 105-residue KaiC-interacting domain of SasA, a protein necessary for a robust circadian rhythm in Synechococcus elongatus	1130	X
5142	Assignment of 1H, 13C and 15N resonances of Human Lysozyme at 4 C	1209	X
5143	NMR Structure of the Second Intracellular Loop of the alpha2A adrenergic receptor: evidence for a Novel Cytoplasmic Helix	219	X
5144	NMR Structure of the Second Intracellular Loop of the alpha2A adrenergic receptor: evidence for a Novel Cytoplasmic Helix	197	X
5145	NMR Structure of the human Doppel Protein	1454	X
5147	NMR structure of the Cyanobacterial Metallothionein SmtA	327	X
5148	NMR Structure of the [2Fe-2S] Ferredoxin Domain from Soluble Methane Monooxygenase Reductase and Interaction with its Hydroxylase	885	X
5149	NMR Structure of the Second Intracellular Loop of the alpha2A adrenergic receptor: evidence for a Novel Cytoplasmic Helix	241	X
5150	NMR Structure of the Second Intracellular Loop of the alpha2A adrenergic receptor: evidence for a Novel Cytoplasmic Helix (T3-I2-T4)	218	X
5151	Designed Protein G Core Variants Fold to Native-like Structures: Sequence Selection by ORBIT Tolerates Variation in Backbone Specification	378	X
5152	Designed Protein G Core Variants Fold to Native-like Structures: Sequence Selection by ORBIT Tolerates Variation in Backbone Specification	371	X
5155	NMR structure of the UBX domain from P47 (energy minimised average)	867	X
5156	Partial assignment of the calcium-bound calretinin I-II domain (residues 1-100): 1H, 13C and 15N backbone assignments (and partial sidechain assignment) for structured elements	1179	X
5157	Solution structure of a hydrophobic analogue of the winter flounder antifreeze protein	223	X
5158	Conformational and Dynamic Characterization of the Molten Globule state of an Apomyoglobin Mutant with an altered Folding Pathway	561	X
5159	Sequence-specific resonance assignment of the second Ran-binding domain of human RanBP2	1308	X
5160	Microcin from Escherichia coli	212	X
5161	Characterization of the ATP-binding Domain of the Sarco(endo)plasmic Reticulum Ca (2+) -ATPase: Probing Nucleotide Binding By Multidimensional NMR	891	X
5162	1H, 13C, and 15N resonance assignments and secondary structure of the PWI domain from SRm160 using Reduced Dimensionality NMR	1469	X
5163	Solution structure of desulfovibrio gigas zinc rubredoxin, NMR, 20 structures	282	X
5164	NMR Structure of a Parallel Stranded DNA Duplex at Atomic Resolution	232		X
5165	Solution Structure of Methanobacterium Thermoautotrophicum Protein 1598	1629	X
5166	Solution structure of hemolysin expression modulating protein Hha	754	X
5167	NMR Structure of an AT-Rich DNA with the GAA-Hairpin Loop	252		X
5169	NMR solution structure of the human beta2-microglobulin	631	X
5170	NMR Structure and Dynamics of the RNA Binding Site for the Histone mRNA Stem-Loop Binding Protein	281			X
5171	NMR Structure of BPTI Mutant G37A	321	X
5172	1H and 15N Chemical Shift Assignments of oxidized cytochrome c553 from B. pasteurii	518	X
5173	NMR structure of human Epiregulin	284	X
5174	Molecular structure of the GARP family of plant Myb-related DNA binding motifs of the Arabidopsis response regulators	834	X
5175	Backbone 1H, 13C, 15N and sidechain 1H Chemical shift of CPI-17	855	X
5176	SOLUTION STRUCTURE OF THE SQUASH TRYPSIN INHIBITOR MCoTI-II, NMR, 30 STRUCTURES.	305	X
5177	Backbone and side-chain 1H, 13C, and 15N chemical shift assignments for chick cofilin	2118	X
5178	Solution Structure of the Fibronectin type III Domain from Bacillus circulans WL-12 Chitinase A1	906	X
5179	Solution structure of N-terminal SH3 domain of Vav and the recognition site for Grb2 C-terminal SH3 domain	845	X
5180	Solution nmr structure of the dimerization domain of the yeast transcriptional activator Gal4 (residues 50-106)	223	X
5181	Virtually complete 1H, 13C and 15N resonance assignments of the second family 4 xylan binding module of Rhodothermus marinus xylanase 10A	2023	X
5182	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Extracellular Ligand-Binding Domain of Ionotropic Glutamate Receptor 2	1232	X
5183	BetaCore, a designed water soluble four-stranded antiparallel b-sheet protein	283	X
5184	1H Chemical Shift Assignments for toxin BeKm from the Scorpion Buthus eupeus	230	X
5185	1H, 13C, and 15N resonance assignment of the vascular endothelial growth factor receptor-binding domain in complex with a receptor-blocking peptide	1234	X
5186	1H, 13C, and 15N backbone assignment of the vascular endothelial growth factor receptor-binding domain	529	X
5187	Assignments of the 1H, 13C, and 15N resonances of TraR	1062	X
5188	Solution structure of paralytic peptide of the silkworm, Bombyx mori	123	X
5189	1H, 15N and 13C resonance assignments of rabbit apo-S100A11	1229	X
5190	Backbone NMR assignments of Ribosome Recycling Factors from Escherichia coli	716	X
5191	Backbone NMR assignments of Ribosome Recycling Factors from Thermotoga maritima	675	X
5192	The NMR-derived Conformation of Neuropeptide F from Moniezia expansa	294	X
5193	The solution structure of the mutant 5'AUG3' triloop in the RNA promoter region of the brome mosaic virus genomic (+)-RNA	18			X
5194	Three-dimensional Structure of the Synaptotagmin 1 C2B-domain: Synaptotagmin 1 as a Phospholipid Binding Machine	2026	X
5197	1H and 13CA chemical shift assignments of the polypeptide mPrP(143-158)	668	X
5198	1H, 13C, and 15N Chemical Shift Assignments for v107 in complex with vascular endothelial growth factor	222	X
5199	Assignment of the 1H and 15N resonances of the elicitor protein NIP1	434	X
5200	Sequence-specific 1H, 13C and 15N chemical shift assignment of DnaA domain IV	528	X
5201	NMR ensemble of ion-selective ligand A1 for platelet integrin alphaIIb-beta3	88	X
5202	Assignment of the 1H, 13C and 15N resonances of the catalytic domain of the rat 2',3'-cyclic nucleotide 3'-phosphodiesterase	1906	X
5203	1H, 13C, 15N chemical shift assignments for cysteine-rich domain of KSR	452	X
5204	1H, 13C and 15N chemical shift assignments for CRT(189-261)	834	X
5205	1H chemical shift assignemnts and coupling constants for CRT(221-256)	246	X
5206	Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments for Human S100B in Calcium-bound Form	948	X
5207	1H Chemical Shifts for the Apo State of the F36G + P43M Mutant of Calbindin D9k	518	X
5208	1H, 13C and 15N resonance assignments for the perdeuterated 22 kD palm-thumb domain of DNA polymerase B	1143	X
5209	1H, 13C and 15N resonance assignments for the perdeuterated 22 kD palm-thumb domain of DNA polymerase B in complex with the XRCC1 N-terminal domain	1001	X
5210	NMR Solution Structure of sTva47, the Viral-Binding Domain of Tva	424	X
5211	SAP/SH2D1A bound to peptide n-Y-c	1633	X
5212	SAP/SH2D1A bound to peptide n-pY	1619	X
5213	Copper Trafficking: The Solution Structure of Bacillus subtilis CopZ	534	X
5214	Y2 selective analogue-I of neuropeptide Y	337	X
5215	Y2 selective analogue-II of neuropeptide Y	107	X
5216	Y2 selective analogue-III of neuropeptide Y	112	X
5217	Solution Structure and DNA Binding Properties of the C-Terminal Domain of UvrC from E. coli	775	X
5218	Backbone 1H, 13C, 15N resonance assignments of the N-terminal 24 kDa fragment of the gyrase B subunit from E. coli	1150	X
5219	Base excision repair: NMR backbone assignments of Escherichia coli formamidopyrimidine-DNA glycosylase	893	X
5220	Solution Structure and dynamics of melanoma inhibitory activity protein	1265	X
5221	Backbone 1H, 13C, and 15N resonance assignments for the C-Terminal Region of Ku86 (Ku86CTR)	1065	X
5222	1H, 15N and 13C resonance assignments and secondary structure of Tryparedoxin-I from Crithidia fasciculata	1361	X
5223	SH3 domain of human Lck tyrosine kinase	676	X
5224	1H, 13C and 15N Chemical shifts assignments for the C-terminal domain (region 428-547) of human lamin A/C	1421	X
5225	Solution Structure of the Peptidyl-Prolyl-cis/trans-Isomerase Parvulin 10 of Escherichia coli	1118	X
5226	Letter to the Editor: 1H, 15N and 13C resonance assignments and secondary structure determination of the Ssh10b from Hyperthermphilic Archaeon Sulfolobus shibatae	1222	X
5227	Dissection of the Pathway of Molecular Recognition by Calmodulin	247	X
5228	Letter to the Editor: Assignment of a 15 kDa protein complex formed between the p160 coactivator ACTR and the CREB binding protein	1342	X
5231	Resonance assignments for stromelysin complexed with a beta-sulfonyl hydroxamate inhibitor	1093	X
5232	1H, 13C, and 15N resonance assignments of the DNA-binding domain of the essential protein Cdc13 complexed with single-stranded telomeric DNA	2245	X	X
5233	NMR assignment of human ASC2	1104	X
5234	Backbone resonance assignment of the 2H,13C,15N labelled 32KDa Central Domain of Escherichia coli TyrR	1165	X
5235	Resonance assignment and secondary structure determination of a C-terminal fragment of the Lupus Autoantigen (La) protein containing a putative RNA recognition motif (RRM)	1311	X
5236	1H and 15N Chemical Shift Assignments for the tandem inactivation domain of Kv1.4 (RCK4(1-75))	473	X
5237	Assignment of 1H, 13C, and 15N resonances of Type II R67 Dihydrofolate Reductase	577	X
5238	1H and 15N chemical shift assignments for the heparin-binding domain of vascular endothelial growth factor	414	X
5239	Sequential NMR assignment of the ferri-cytochrome c3 from Desulfovibrio vulgaris Hildenborough	560	X
5240	15N assignment of Alicyclobacillus acidocaldarius thermostable thioredoxin	111	X
5241	1H and 15N assignment and secondary structure of the double K18G/R82E mutant of Alicyclobacillus acidocaldarius thermostable thioredoxin	867	X
5242	Solution Structure of the Prohormone Convertase 1 (PC1) Pro-Domain From Mus Musculus	789	X
5243	Solution Structure of the 17mer TF1 Binding Site	363		X
5244	Backbone Assignment of Endonuclease V from Bacteriophage T4 with deuterium labeling	779	X
5245	Heteroduplex of chirally pure R-methylphosphonate/DNA duplex	122		X
5246	Chiral Mutagenesis of Insulin's Hidden Receptor-Binding Surface: Structure of an Allo-isoleucine A2 Analogue	569	X
5247	Letter to the Editor: Sequence-specific chemical shift assignment of calcium-loaded murine S100A4	962	X
5248	NMR Solution Structure of the Isolated Apo Pin1 WW Domain: Comparison to the X-Ray Crystal Structures of Pin 1	196	X
5249	Backbone 1H, 13C and 15N chemical shifts for [Zn(II)/Zn(II)]Dx	140	X
5250	1H, 13C and 15N resonance assignment of the RNA-binding domain dimer form Bacillus subtilis transcriptional antiterminator GlcT	854	X
5251	Complete backbone and partial side chain 1H, 15N and 13C assignments for human lymphotactin at 45 C	661	X
5252	Structural Differences in the NOE-derived Structure of G-T Mismatched DNA relative to Normal DNA are Correlated with Differences in (13)C Relaxation-based Internal Dynamics	82		X
5253	Structural Differences in the NOE-derived Structure of G-T Mismatched DNA relative to Normal DNA are Correlated with Differences in (13)C Relaxation-based Internal Dynamics	88		X
5254	1H and 13C assigned chemical shifts for chromogranin A, catestatin fragment	124	X
5255	Ancestral beta/gamma-crystallin precursor structure in a yeast killer toxin	512	X
5256	Solution Structure of the Unmodified Anticodon Stem-loop from E. coli tRNA(Phe)	290			X
5257	Thymosin beta-9	289	X
5259	Solution Structure of the modified Anticodon Stem-loop from E. coli tRNA(Phe)	260			X
5260	Pseudocontact chemical shifts for [Fe(II)/Fe(II)]Dx	63	X
5261	Nuclease A Inhibitor (NuiA) Assignments	1666	X
5262	Backbone 1H and 15N Chemical Shift Assignements for the first fibronectin type II module of MMP-2 (col-1)	459	X
5263	Backbone 1H, 13C, 15N chemical Shift assignments fo the CBM28	1139	X
5264	Solution Structure of Human beta-Defensin 3	279	X
5265	The solution structure of antibacterial peptide (Moricin) isolated from the silworm, Bombyx mori	325	X
5266	1H, 15N and 13C assignments of the focal adhesion targeting domain of focal adhesion kinase (FAT)	520	X
5267	1H, 13C, 15N NMR sequencespecific resonance assignment of a Clostridium thermocellum type II cohesin module	1778	X
5268	Structure of the Antimicrobial Peptide Tachystatin A	297	X
5269	Assignment of the 1H, 13C, and 15N signals of Synechocystis sp. PCC 6803 methemoglobin	1421	X
5270	Backbone 1H, 15N and 13C resonance assignments of YqgF, an Escherichia coli protein of unknown structure and function	664	X
5271	Pseudocontact chemical shifts for [Fe(II)/Zn(II)]Dx	199	X
5272	1H, 13C and 15N chemical shift assignments of Schistocerca gregaria chymotrypsin inhibitor	229	X
5273	1H chemical shift assignments for SGCI[L30R, K31M]	186	X
5274	1H Chemical shift assignments of Schistocerca gregaria trypsin inhibitor	164	X
5275	The rhesus rotavirus sialic acid binding domain without ligand	1771	X
5276	NMR Structure of the Domain-I of the Kazal-type Thrombin Inhibitor Dipetalin	539	X
5277	Solution NMR Structure of Surfactant Protein B (11-25) (SP-B11-25)	137	X
5278	PEMV-1 P1-P2 Frameshifting Pseudoknot Regularized Average Structure	275			X
5279	A Quick Solution Structure Determination of the Fully Oxidized Double Mutant K9-10A Cytochrome c7 from Desulfuromonas acetoxidans and Mechanistic Implications	363	X
5280	Assignments of the 1H, 13C, and 15N, resonances of the winged helix domain of the proto-oncoprotein c-Qin (FoxG1B)	1544	X
5281	A peptide mimetic of human interferon (IFN)-beta	104	X
5282	Refinement of d(GCGAAGC) Hairpin Structure Using One- and Two-Bonds Residual Dipolar Couplings	118		X
5283	Proton Chemical Shift Assignments for Vpr(34-51) Peptide	416	X
5284	1H and 15N Chemical Shift Assignments for Human A54 I-FABP	1103	X
5285	1H and 15N Chemical Shift Assignments for Human T54 I-FABP	1098	X
5286	Backbone 1H, 13C, and 15N Chemical shift assigments for [13C,15N]CaM:CaMKIp complex	718	X
5287	Backbone 1H and 15N Chemical shift assigments for [2H,15N]CaM:CaMKI(320) complex	288	X
5288	Assignment of Backbone 1H, 13C, and 15N Resonances of Human Grb7-SH2 Domain in Complex with a Phosphorylated Peptide Ligand	426	X
5289	Investigation of Penetratin Peptides. Part 1: The Environment Dependent Conformational Properties of Penetratin and two of its Derivatives	294	X
5290	Investigation of Penetratin Peptides. Part 1: The Environment Dependent Conformational Properties of Penetratin and two of its Derivatives	157	X
5291	Investigation of Penetratin Peptides. Part 1: The Environment Dependent Conformational Properties of Penetratin and two of its Derivatives	119	X
5292	1H Chemical Shift Assignments for TC5b	276	X
5293	NMR Identification and Characterization of the Flexible Regions in the 160 KD Molten Globule-like Aggregate of Barstar at Low pH	199	X
5294	Structure of the beta subunit of translation initiation factor 2 from the archaeon Methanococcus jannaschii: A representative of the eIF2beta/eIF5 family of proteins	769	X
5295	1H Resonance Assignments at 310K and pH 4.93 for E.coli recombinant Brazzein, an Intensely Sweet Protein	275	X
5296	1H Resonance Assignments at 310K and pH 4.90 for E.coli recombinant Brazzein variant brazzein-ins(R18a-I18b), an Non-Sweet variant of Brazzein	255	X
5297	1H, 13C, and 15N assignment of the N-terminal, DNA-binding domain of the replication initiation protein from a geminivirus	1419	X
5298	1H, 13C, and 15N Chemical Shift Assignments for the PPIase domain from E. coli trigger factor	821	X
5299	The Mad2 Spindle Checkpoint Protein Undergoes Similar Major Conformational Changes upon Binding to Either Mad1 or Cdc20	2145	X
5300	Backbone 1H, 13C, and 15N Resonance Assignments for the 20.8 KDa C.elegans gene product ORF C32E8.3. Northeast Structural Genomics Consortium Target WR33.	1002	X
5301	Principles of Mucin Architecture: Structural Studies on Synthetic Glycopeptides Bearing Clustered Mono-,Di, Tri-, and Hexasacchraride Glycodomains	44	X
5303	Solution structure and backbone dynamics of beryllofluoride-activated NTRC receiver domain	1292	X
5304	Solution Structure of a Mono-heme Ferrocytochrome c from Shewanella putrefaciens and Structural Analysis of Sequence-similar Proteins: Functional Implications	591	X
5305	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the peptidyl-prolyl cis-trans isomerase Pin1	929	X
5306	1H, 13C, and 15N Chemical Shift Assignments for the HIF-1alpha CTAD/p300 CH1 Complex	1508	X
5308	Solution Structure and Dynamics of the Human-Escherichia coli Thioredoxin Chimera: Insights into Thermodynamic Stability	1241	X
5309	1H, 15N and 13C assignments of FLIN4, an intramolecular LMO4:ldb1 complex	1202	X
5310	Backbone and Sidechain 1H, 13C and 15N resonance assignments for PLC-gamma 1 C-terminal SH2 domain complexed with a PDGFR-derived phosphopeptide	1374	X
5311	Letter to the Editor: 1H, 15N and 13C assignments of the Pseudomonas effector protein, AvrPto	1119	X
5312	1H, 13C and 15N chemical shift assignments of aIF2beta from Methanobacterium themoautotrophicum	936	X
5313	Sequence-specific resonance assignment of the rat Gap Junction 43 kDa carboxyl terminal domain	1261	X
5314	Assignment of 1H, 13C, and 15N Resonances of the SH2 Domain of Human Grb14 and Chemical Shift Changes upon Binding a phosphorylated decapeptide	1070	X
5315	1H, 13C and 15N chemical shift assignment for ribosome-associated factor Y	1437	X
5316	Structure of the N-terminal 283-Residue Fragment of the HIV-1 Gag Polyprotein	3047	X
5317	Solution structure of the DNA binding domain of human TRF1	735	X
5318	Backbone and Sidechain 1H, 13C and 15N resonance assignments for PLC-gamma 1 C-terminal SH2 domain	196	X
5319	1H and 15N assignments of rat holo cellular retinol-binding protein type I (CRBP-I)	1169	X
5320	1H and 15N Chemical Shift Assignments for Human B-FABP	1066	X
5321	NMR structure of a SRP19 binding domain in human SRP RNA	164			X
5322	Solution Structure of g-Bungarotoxin, an RGD-Containing Neurotoxin	436	X
5323	Solution Structure of the Tenebrio molitor Antifreeze Protein	505	X
5324	Letters to the Editor: 1H, 15N and 13C assignments of the regulatory domains of a calcium-dependent protein kinase (CDPK)	1611	X
5325	1H Chemical Shift Assignments for nsLTP2 from Rice	385	X
5326	Structure of ALA24/ASP61 to ASP24/ASN61 substituted subunit C of Escherichia coli ATP synthase. Implications for the mechanism of proton transport and rotary movement in the F0 complex	989	X
5327	Structural basis for Hif-1alpha/CBP recognition in the cellular hypoxic response	1560	X
5328	Solution NMR structure of the BRCT domain from Thermus thermophilus DNA ligase	1012	X
5329	Backbone and Side Chain 1H, 13C, and 15N chemical shift assignments for conserved eukaryotic protein ZK652.3 from C. elegans	977	X
5332	1H, 13C, and 15N Chemical Shift Assignments for E85Q recoverin	1233	X
5333	Redox-Coupled Conformational Alternations in Cytochrome c3 from D. vulgaris Miyazaki F on the Basis of its Reduced Solution Structure	817	X
5334	Backbone 1H, 13C, and 15N resonance assignments and secondary structure of the D54A mutant of HTLV-I capsid protein	912	X
5335	Backbone and side chain 1H, 13C, and 15N chemical shift assignments for E.coli protein YacG	702	X
5337	Complete assignments of 1H, 13C and 15N Chemical Shifts for Oxidized Human Adrenodoxin (4-114)	1044	X
5338	Integrin EGF-like module 3 from the beta-2 subunit	274	X
5339	NMR minimized average structure of d(CGTACG)2	45		X
5340	Solution Structure for BID, and Intracellular Amplifier of Apoptotic Signaling	880	X
5341	1H, 13C, and 15N backbone assignment of an extended N-terminal, DNA-binding domain construct of the replication initiation protein from a geminivirus	618	X
5342	1H Chemical Shift Assignments for Superman Zinc Finger Domain	254	X
5343	1H, 13C, 15N Assignment of Neocarzinostatin Apo-Protein	1147	X
5344	1H, 15N Assignment of Neocarzinostatin Apo-Protein Bound to a Synthetic Chromophore	665	X
5345	Assignment of lac repressor headpiece complexed of its natural operator	1803	X	X
5346	Solution Structure of a Novel Disintegrin, Salmosin from Agkistrondon halys Venom	391	X
5347	Solution Structure of the RNase H Domain of the HIV-1 Reverse Transcriptase in Presence of Magnesium	1603	X
5348	Solution structure of ascidian trypsin inhibitor determined by nuclear magnetic resonance spectroscopy	349	X
5349	PBX Homeodomain-DNA complex	1184	X	X
5350	1H, 15N, and 13C resonance assignments of low molecular weight human cytoplasmic protein tyrosine phosphatase-A (HCPTP-A)	647	X
5351	Backbone HN, N, Ca, Cb and CO assignments of unfolded ACBP	383	X
5352	1H, 13C and 15N resonance assignment of Bacillus agaradhaerens xylanase	2215	X
5353	1H, 15N and 13C resonance assignments of yeast Saccharomyces cerevisiae calmodulin in the Ca2+-free state	283	X
5354	Structure and Interactions of PAS kinase N-terminal PAS domain: Model for intramolecular kinase regulation	1430	X
5355	Backbone resonance assignments of the 25kD N-terminal ATPase domain from the Hsp90 chaperone	1158	X
5356	Backbone and sidechain chemical shift assignments for GS-a3W protein	893	X
5357	1H, 13C, and 15N Chemical Shift Assignments for tm1112	1093	X
5358	1H, 15N, 13C Backbone Chemical Shift Assignments for Trypsin-Bound Bovine Pancreatic Trypsin Inhibitor (BPTI) at pH 5.8 and 36 Degrees	255	X
5359	1H, 15N, 13C Backbone Chemical Shift Assignments for Free Bovine Pancreatic Trypsin Inhibitor (BPTI) at pH 5.8 and 36 Degrees	458	X
5360	PsaE sub-unit of the photosystem I of the cyanobacterium Synechocystis sp. PCC 6803	497	X
5361	Solution Structure of the DNA Complex of Human TRF1	908	X	X
5362	1H, 15N and 13C Backbone resonance assignments of the 40 kDa LicT-CAT-PRD1 protein	803	X
5363	1H, 13C, and 15N Chemical shifts for hERR2 Protein, 1H chemical shifts for DNA	1276	X	X
5364	Structure of the C-terminal FG-binding domain of human Tap	456	X
5365	1H, 15N, 13C resonance assignments for the DNA-binding domain of myocyte nuclear factor	934	X
5366	SOLUTION STRUCTURE OF THE VAM7P PX DOMAIN	1599	X
5368	Backbone 1H, 13C, and 15N Chemical Shift Assignments for hARF1	802	X
5369	A New Zinc Binding Fold Underlines the Versatility of Zinc Binding Modules in Protein Evolution	168	X
5370	Structure of a Beta-Alanine-Linked Polyamide Bound to a Full Helical Turn of Purine Tract DNA in the 1:1 Motif	217		X
5371	U6 RNA chemical shifts	266			X
5372	Solution Structure Of Reduced Horse Heart Cytochrome c in 30% Acetonitrile Solution	677	X
5373	Sequence-specific NMR resonance assignments for Human Interleukin-5	1359	X
5374	Assignment of 1H and 15N resonances and secondary structure of the recombinant RicC3 of 2S albumin storage protein from ricinus communis	955	X
5375	Structure of BPTI_8A mutant	368	X
5376	C-terminal peptide of alpha-subunit of transducin	127	X
5377	Assignments of 1H, 13C and 15N resonances of human Ca2+-S100B in complex with the TRTK-12 peptide	1183	X
5378	NMR Structure of a Variant Human Prion Protein with Two Disulfide Bridges	1221	X
5379	Bovine Pancreatic Polypeptide Bound to DPC Micelles	287	X
5381	Structure of BPTI_A16V mutant	404	X
5382	1H, 13C, and 15N backbone resonance assignment of the C-terminal domain of EPSP synthase	982	X
5383	The CXCR3 binding chemokine IP-10/CXCL10: Structure and receptor interactions	362	X
5384	Binding of the first ferric ion to glycine-extended gastrin is essential for biological activity	117	X
5385	Chemical shift assignments for the 8OG:G mismatched duplex	116		X
5386	1H, 13C, 15N Chemical Shift Assignments of cNTnC and cTnI(147-163) in the cNTnC-cTnI(147-163)-Bepridil Ternary complex	1007	X
5387	Complete 1H, 13C, and 15N chemical shifts for human recombinant ubiquitin in reverse micelles	998	X
5388	1H,13C and 15N resonance assignments of gads c-terminal SH3 domain in complex with a peptide of SLP76	1020	X
5389	1H, 13C and 15N assignments for the cold shock response protein Yfia	1416	X
5390	1H,13C and 15N Chemical Shifts Assignments for the Oligomerization Domain of H-NS	621	X
5391	The NMR Solution Structure of the RIP Death Domain and Characterization of the Interaction with TRADD	1124	X
5392	Solution structure of HMG box 5 in human upstream binding factor	989	X
5393	Sequence-specific (1H, 15N, 13C) resonance assignment of the N-terminal domain of the Cyclase-associated Protein (CAP) from Dictyostelium discoideum	1601	X
5394	Sculpting of the Eukaryotic Branch Site Recognition Motif by a Conserved Pseudouridine	95			X
5395	Chemical Shift Assignments for the Unmodified Branch Site Helix	93			X
5396	NMR-based solution structure of the complex of Lactobacillus casei dihydrofolate reductase with trimethoprim and NADPH	1256	X
5397	1H, 13C and 15N resonance assignment of an affibody-target complex	1486	X
5398	Backbone and side chain 1H, 13C, and 15N chemical shift assignments for 3-methyladenine DNA glycosylase I (TAG) from Escherichia coli	2194	X
5399	Conservation of chemical shift and secondary structure of the PNT/SAM domains from the Ets family of transcription factors	1215	X
5400	Selection of D-amino-acid peptides that bind to Alzheimer's disease amyloid peptide abeta 1-42 by mirror image phage display	278	X
5401	Conservation of chemical shift and secondary structure of the PNT/SAM domains from the Ets family of transcription factors	1146	X
5402	1H, 15N and 13C resonance assignments of the SH2 domain of Bruton's tyrosine kinase	1027	X
5403	Backbone resonance assignments of the 91 kDa oligomeric TRAP protein from Bacillus staerothermophilus in complex with L-tryptophan	260	X
5404	Backbone and Side Chain assignments of Peptide Deformylase complexed with Actinonin	1812	X
5405	STRUCTURE OF SYNTHETIC 26-MER PEPTIDE CONTAINING 145-169 SHEEP PRION PROTEIN SEGMENT AND C-TERMINAL CYSTEINE IN TFE SOLUTION	201	X
5406	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Human Cytochrome c	1042	X
5407	Solution structure and characterization of the heme chaperone CcmE	1256	X
5408	1H, 13C, and 15N Chemical Shift Assignments for DFF-C domain of DFF45/ICAD	400	X
5409	Backbone Chemical Shift Assignments for 2H, 13C, 15N-labeled Human PTB1 Protein	933	X
5410	Solution structure of novel non-RGD containing short disintegrin by high resolution NMR	220	X
5454	NMR solution structure and dynamics of motilin in isotropic phospholipid bicellar solution	141	X
5455	1H, 13C and 15N resonance assignments of the human phosphatase PRL-3	1648	X
5456	1H, 13C, and 15N resonances assignment for the von Willebrand factor A3 domain	732	X
5457	Complete 1H Chemical Shift Assignment of a 24-residue Sin Interacting Domain of hMad1	169	X
5458	Backbone 1H, 13C, and 15N assignments of the ribosome recycling factor from Thermus thermophillus	897	X
5459	High precision NMR structure of RING-H2 finger domain of EL5, a rice gene in response to N-acetylchitooligosaccahride elicitor	633	X
5461	Chemical shift assignments Itk SH2 domain, conformation corresponding to cis and trans proline 287	2441	X
5462	1H, 15N and 13C Backbone Assignment of MJ1267, an ATP-binding cassette	1129	X
5463	Human catestatin 21-mer	122	X
5464	Solution Structure of a CCHC Zinc Finger from MOZ	216	X
5465	NMR solution structure of human Saposin C	1072	X
5466	Structural model for an alkaline form of ferricytochrome c	486	X
5467	1H,15N and 13C resonance assignments of the SH3-like domain of the human ADAP protein	992	X
5468	Backbone 1H, 13C, 15N and Cb chemical shift assignments for 6-phosphogluconolactonase from Trypanosoma brucei	1454	X
5469	Inhibitory Specificity Change of Ovomucoid Third Domain of Silver Pheasant upon Introduction of an Engineered Cys14-Cys39 Bond	343	X
5470	Inhibitory Specificity Change of Ovomucoid Third Domain of Silver Pheasant upon Introduction of an Engineered Cys14-Cys39 Bond	341	X
5471	Backbone HN,13C,15N assignments for Malate Synthase G from E.coli	3354	X
5472	Solution Structures of the Two Stable Conformers of Turkey Ovomucoid that Coexist at Low pH	597	X
5473	Solution Structures of the Two Stable Conformers of Turkey Ovomucoid that Coexist at Low pH	589	X
5474	Backbone resonance assignment of the 298 amino acid catalytic domain of protein tyrosine phosphatase 1B (PTP1B)	1133	X
5475	Homology predicted structure and comparison with the secondary structure from NMR data for plastocyanin from the cyanobacterium synechocystis sp. PCC 6803	556	X
5476	Structures of phage-display peptides that bind to the malarial surface protein, apical membrane antigen 1, and block erythrocyte invasion	81	X
5477	Structures of phage-display peptides that bind to the malarial surface protein, apical membrane antigen 1, and block erythrocyte invasion	86	X
5478	Structures of phage-display peptides that bind to the malarial surface protein, apical membrane antigen 1, and block erythrocyte invasion	57	X
5479	Structures of phage-display peptides that bind to the malarial surface protein, apical membrane antigen 1, and block erythrocyte invasion	50	X
5480	1H,15N and 13C assigned Chemical Shifts for a complex of calmodulin with a peptide of the olfactory CNGC channel	1962	X
5481	Backbone and side chain 1H, 13C, and 15N chemical shift assignments for S. cerevisae Hub1	933	X
5482	Assignment of 1H, 13C and 15N resonances of the N-terminal microtubule-binding domain of human doublecortin	1268	X
5483	NMR structure of AmpD, an N-acetylmuramyl-L-alanine amidase.	2088	X
5484	Backbone NMR assignments of the metal-free UreE from Bacillus pasteurii	717	X
5485	Thermal stability and solution structure of the ribosomal protein L30e from hyperthermophile archaeon Thermococcus celer	1096	X
5486	Backbone and 1H assignments for Tachyplesin I, wild type	198	X
5487	Backbone and 1H assignments for Tachyplesin I, tyrosine mutant	209	X
5488	Backbone and 1H assignments for Tachyplesin I, phenylalanine mutant	72	X
5489	Backbone and 1H assignments for Tachyplesin I, alanine mutant	51	X
5490	Sequence-specific 1H, 13C, 15N Resonance Assigments of the Major Cherry Allergen Pru av 1 Mutant E45W	1731	X
5491	Structural basis for new pattern of the conserved amino acid residues related to chitin-binding in the antifungal peptide from the coconut rhinoceros beetle, Oryctes rhinoceros	310	X
5492	1H and 15N Chemical Shift Assignments for the charge reverse variant of Ribonuclease Sa "5K" (D1K, D17K, D25K, E41K, E74K)	578	X
5493	Letter to the Editor: Backbone 1H, 15N and 13C resonance assignments of the Staphylococcus aureus acyl carrier protein synthase (AcpS)	524	X
5494	NMR Structure of PW2 Bound to SDS Micelles: A Tryptophan-rich Anticocidial Peptide Selected from Phage Display Libraries	266	X
5495	1H chemical shift assignments for Psalmotoxin 1	194	X
5496	NMR structure of ubiquitin-like domain in Parkin: Gene product of familial Parkinson's disease	967	X
5497	1H, 15N, 13C resonance assignments of the carboxy-terminal domain of the transmembrane electron transfer protein DsbD	1309	X
5498	Backbone and Sidechain 1H, 13C, and 15N Chemical Shift Assigments for Complex between p67SH3(C) and p47 Tail Peptide	1136	X
5499	The PDZ7 of Glutamate Receptor Interacting Protein Binds to its Target via a Novel Hydrophobic Surface Area	1037	X
5500	Parkin binds the Rpn10 subunit of 26S proteasomes with the ubiquitin-like domain	436	X
5501	The Solution Structure of Human Hepcidin, a Peptide-Hormone with Antimicrobial Activity that is Involved in Iron Uptake and Hereditary Hemochromatosis	126	X
5502	Solution Structure of Hepcidin-20	123	X
5503	1H resonance assignment of the C-terminal domain of Human Centrin2 (LC-HsCen2: M84-Y172)	540	X
5504	1H, 13C and 15N chemical shift assignments of the SH2 domain of the Csk homologous kinase	1342	X
5505	Backbone Dynamics of Reduced Plastocyanin from the Cyanobacterium Anabaena variabilis: Regions Involved in Electron Transfer have Enhanched Mobility	1206	X
5506	Resonance assignments of the central complement control protein module pair of human decay accelerating factor	1203	X
5507	Native State Hydrogen Exchange Study of Suppressor and Pathogenic Variants of Transthyretin	370	X
5508	Native State Hydrogen Exchange Study of Suppressor and Pathogenic Variants of Transthyretin	370	X
5509	Native State Hydrogen Exchange Study of Suppressor and Pathogenic Variants of Transthyretin	370	X
5510	Native State Hydrogen Exchange Study of Suppressor and Pathogenic Variants of Transthyretin	357	X
5511	Backbone 1H, 13C, and 15N resonance assignments for the 21 kDa GTPase Rac1 complexed to GDP and Mg2+	537	X
5512	Solution structure of chicken liver basic type fatty acid binding protein	565	X
5513	NMR assignment and secondary structure identification of the ribosomal protein L11 from Thermotoga maritima	1731	X
5514	Backbone HN, N, Ca and Cb assignment of the GFPuv mutant, an 54 kDa protein	1039	X
5515	1H, 13C and 15N resonance assignment of the Dishevelled DIX domain	1000	X
5516	Assignment of the 1H, 13C and 15N resonances of the Coxsackievirus and Adenovirus receptor domain 1	1591	X
5517	NMR studies of the DNA-binding domain of B-Myb	1015	X	X
5518	Role of backbone dynamics and structure in controlling the hydrolysis constants of serine proteinase inhibitors	155	X
5519	Role of backbone dynamics and structure in controlling the hydrolysis constants of serine proteinase inhibitors	155	X
5520	Role of backbone dynamics and structure in controlling the hydrolysis constants of serine proteinase inhibitors	102	X
5521	Role of backbone dynamics and structure in controlling the hydrolysis constants of serine proteinase inhibitors	100	X
5522	Letter to Editor: 1H, 15N and 13C resonance assignments of the repeated domain of human beta ig-h3	751	X
5523	Conformational Features of Human Melanin-Concentrating Hormone: a NMR and Computational Analysis	286	X
5524	Resonance Assignment and Topology of a Clostridial Repetitive Oligopeptide (CROP) Region of Toxin A from Clostridium Difficile	1381	X
5525	NMR structure of the first Zinc Binding domain of Nup475/TTP/TIS11	292	X
5527	Three-Dimensional Solution Structure of Huwentoxin-Iv by 2D 1H-NMR	250	X
5528	Solution structure of the complementary RNA promoter of influenza a virus	232			X
5529	The structure of G16A MNEI monellin supports a new model of interaction of sweet proteins with the T1R2-T1R3 receptor	691	X
5530	Naturally occurring modifications reduces the anticodon domain conformational space of tRNA-PHE	124			X
5531	Naturally occurring modifications reduces the anticodon domain conformational space of tRNA-PHE	121			X
5532	Structure of the Tsg101 UEV Domain in Complex with a HIV-1 PTAP "Late Domain" Peptide	1852	X
5534	Global structure and dynamics of human apolipoprotein CII in complex with micelles: evidence for increased mobility of the helix involved in the activation of lipoprotein lipase	340	X
5535	NMR structure of R3H domain	505	X
5536	1H, 13C, and 15N Chemical Shift Assignments for G88W110 fragment of Staphylococcal Nuclease	1192	X
5537	Structure of an FF domain Human HYPA/FBP11	904	X
5538	1H, 13C, and 15N Chemical Shift Assignments for a PWWP domain from Sch. pombe	1255	X
5539	Solution Structure and Stability of the Full-Length Excisionase (Xis) from Bacteriophage HK022	922	X
5540	1H, 13C and 15N assignment of the hydroquinone form of flavodoxin from Desulfovibrio vulgaris (Hildenborough)	1548	X
5541	1H and 15N Chemical Shift Assignments of Lm-FABP	1088	X
5542	1H chemical shifts for Penetratin in phospolipid bicelles	74	X
5543	1H chemical shifts for Penetratin(W48F,W56F) in phospolipid bicelles and SDS micelles	110	X
5544	1H, 13C, and 15N resonance assignments for S100B(beta beta)-Ca2+-TRTK-12 peptide complex	1126	X
5545	NMR assignment of the C-terminal domain of insulin-like growth factor binding protein-6 (IGFBP-6)	1061	X
5547	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Streptopain	1209	X
5548	Bovine Pancreatic Polypeptide (bPP) undergoes significant changes in conformation and dynamics upon binding to DPC micelles	60	X
5549	Neuropeptide Y5-Receptor II: Solution Structure and Dynamics of [31Ala,32Pro]-NPY	279	X
5550	Structure and Dynamics of Micelle-bound Neuropeptide Y: Comparison with unligated NPY and Implications for Receptor Selection	354	X
5551	Homonuclear chemical shift assignment for LEKTI domain 6 (HF7665)	449	X
5552	Backbone 1H, 13C, and 15N Chemical Shift Assignments of the Catalytic Domain of Pac1	1124	X
5553	Solution structure of influenza A virus C4 promoter	260			X
5554	Structure of the N-WASP EVH1 Domain-WIP complex	1492	X
5555	Solution structure of the 2nd PHD domain from Mi2b	417	X
5556	PHD Fingers as Protein Scaffolds	311	X
5557	Solution NMR structure of the outer membrane enzyme PagP in DPC micelles	1471	X
5558	Sp100b SAND domain chemical shift assignments	878	X
5559	Partial 1H and 13C assignments for 3'-stem-loop of human U4 small nuclear RNA	184			X
5560	NMR assignment of the conserved hypothetical protein TM1290 of Thermotoga maritima	1290	X
5561	NMR solution structure of the activation domain of human procarboxipeptidase A2	686	X
5562	NMR conformational study of proposed quadruplex hexanucleotide d(CCGCGG)2 in solution	49		X
5563	Assignment of backbone 1H, 13C and 15N resonances of ParG, a protein required for active partition of bacterial plasmids	913	X
5564	1H, 13C and 15N resonance assignment of kinase-interacting FHA domain of Arabidopsis kinase associasted protein phosphatase	1525	X
5565	Backbone 1H, 13C, and 15N Chemical Shift Assignments for porcine MSP	1094	X
5566	1H, 15N and 13C Resonance Assignments for the PTB Domain of the Signaling Protein Shc	1497	X
5567	1H, 15N and 13C Resonance Assignments for a Histone H3 Lysine Methyltransferase from Paramecium Bursaria Chlorella Virus 1	1120	X
5568	A new member of the split bab fold: Solution structure of the protein encoded by the YML108W open reading frame from Saccharomyces cerevisiae	1218	X
5570	1H, 13C, and 15N NMR assignments of the hypothetical Nudix protein DR0079 from the extremely radiation-resistant bacterium Deinococcus radiodurans	1663	X
5571	1H, 13C and 15N assignment of the oxidized form of flavodoxin from Desulfovibrio vulgaris (Hildenborough)	1800	X
5572	Beta-helix structure and ice-binding properties of a hyperactive antifreeze protein from an insect	814	X
5573	Spruce budworm Antifreeze Protein: Changes in Structure and Dynamics at Low Temperature	865	X
5574	Lipid induced conformation of the tachykinin peptide Kassinin	69	X
5575	Solution Structure of the Tachykinin Peptide Eledoisin	69	X
5576	Sodium/potassium-transporting ATPase alpha-1 chain in complex with ATP	2176	X
5577	Sodium/potassium-transporting ATPase alpha-1 chain	2159	X
5578	Two Homologous Rat Cellular Retinol-binding Proteins Differ in Local Conformational Flexibility	1642	X
5579	Two Homologous Rat Cellular Retinol-binding Proteins Differ in Local Conformational Flexibility	1634	X
5580	NMR solution structure of type-B lantibiotics mersacidin bound to lipid II in DPC micelles	96	X
5581	NMR solution structure of type-B lantibiotics mersacidin in MeOH/H2O mixture	90	X
5582	NMR solution structure of type-B lantibiotics mersacidin in DPC micelles	108	X
5583	NMR structure of P41icf, a potent inhibitor of human cathepsin L	383	X
5584	13C Chemical Shift Assignments of Cu(II) plastocyanin from Synechocystis sp. PCC6803	224	X
5585	Isolation, structure and activity of GID, a novel alpha4/7-conotoxin with an extended N-terminal sequence	102	X
5586	Molecular Recognition in Purine-Rich Internal Loops: Thermodynamic, Structural, and Dynamic Consequences of Purine for Adenine Substitutions in 5'(rGGCAAGCCU)2	85			X
5587	Molecular Recognition in Purine-Rich Internal Loops: Thermodynamic, Structural, and Dynamic Consequences of Purine for Adenine Substitutions in 5'(rGGCAAGCCU)2	85			X
5588	Molecular Recognition in Purine-Rich Internal Loops: Thermodynamic, Structural, and Dynamic Consequences of Purine for Adenine Substitutions in 5'(rGGCAAGCCU)2	88			X
5589	Backbone and side chain 1H, 13C, and 15N chemical shift assignments for V. cholerae VC0424	1545	X
5590	1H, 13C and 15N resonance assignments of rice telomere binding domain from Oryza sativa	1067	X
5591	Sequence specific assignment of part of the myosin binding site of myosin binding protein C	997	X
5592	Backbone resonance assignments for the human GMEB-1 SAND domain	554	X
5593	Backbone resonance assignments for the rat GMEB-2 SAND domain	393	X
5594	Structural insights into the U-box, a domain associated with multi-ubiquitination	500	X
5595	Letter to the Editor: 1H, 13C, 15N backbone resonance assignments of apo-NosL, a novel 18.5 kDa copper(I) binding protein from the nitrous oxide reductase gene cluster of Achromobacter cycloclastes	1590	X
5596	Solution Structure of the hypothetical protein yggU from E. coli. Northeast Structural Genomics Consortium Target ER14.	1314	X
5597	Structure and dynamics of reduced Bacillus pasteurii cytochrome c: oxidation state dependent properties and implications for electron transfer processes	517	X
5598	1H, 13C and 15N backbone resonance assignments of domain 1 of receptor associated protein	1287	X
5599	The Tertiary Structure and Backbone Dynamics of Human Prolactin: Evidence for Reversible Oligomerization in Solution	1652	X
5600	Complete 1H,13C,15N assignments of zinc Clostridium pasteurianum rubredoxin	832	X
5601	Complete 1H,13C,15N assignments of zinc Pyrococcus furiosus rubredoxin	1239	X
5602	Complete resonance assignments for the nudix hydrolase DR2356 of Deinococcus radiodurans	1536	X
5603	Chemical shift assignment for human proguanylin	998	X
5604	Solution structure of the N-terminal domain of ZntA in the apo- and Zn(II) forms	478	X
5605	Sequence-specific 1H, 13C and 15N resonance assignments of SAM22, an allergenic stress-induced protein from soy bean	1863	X
5606	1H 13C and 15N chemical shift assignments for HI0719	1358	X
5607	NMR Structure of the Extended Second Transmembrane Domain of the Human Neuronal Glycine Receptor alpha1 Subunit in SDS Micelles	182	X
5608	Solution Structure of Contryphan-Vn	98	X
5609	NMR structure of [Ala1,15]kalata B1	152	X
5610	The Structure of the Carboxyl Terminus of Striated alpha-Tropomyosin in Solution Reveals an Unusual Parallel Arrangement of Interacting alpha-Helices	462	X
5613	A minimal beta-hairpin peptide scaffold for beta-turn display	72	X
5614	Sheared A(anti)-A(anti) Pairs in a Destabilizing 2x2 Internal Loop: The NMR Structure of 5'(rGGCAAGCCU)2	85			X
5615	1H/13C/15N assignment of the C-terminal domain of the E. amylovora response regulator RcsB	1099	X
5616	Chemical Shift Assignments of the Prp40 WW Domain Pair	882	X
5617	1H chemical shift assignments for the aticarcinogenic Bowman Birk inhibitor isolated from snail medic seeds (Medicago Scutellata)	378	X
5618	Backbone 1H, 13C, 15N and Side Chain 13C Chemical Shift Assignments for DFPase from Loligo vulgaris	2196	X
5619	Resonance assignments for the methionine sulfoxide reductase B from Bacillus subtilis, Northeast Structural Genomics Consortium target SR10	842	X
5620	Assignment for ribosomal protein S28E	822	X
5621	Assignment for yoag_ecoli	648	X
5622	Structural and Functional Characterization of a Thioredoxin-like Protein from methanobacterium thermoautotrophicum (Delta H)	903	X
5623	Assignments of 1H, 15N and 13C resonances of the proline-rich matrix protein of Moloney Murine Leukemia Virus (MA Mo-MuLV)	1552	X
5624	A Conserved Structural Motif at the N-terminal of Bacterial Translation Initiation Factor IF2	1234	X
5625	Sequential assignment of the ferricytochrome c3 from Desulfovibrio vulgaris Hildenborough	662	X
5626	1H 13C and 15N backbone resonance assignments of the N-terminal domain of Drosophila GCM protein	608	X
5627	1H, 15N, 13C Resonance Assignments of the LpxC Deacetylase from Aquifex aeolicus in Complex with the Substrate-Analog Inhibitor TU-514	3014	X
5628	1H, 15N and 13C resonance assignments of the highly conserved 19kDa C-terminal domain from human Elongation Factor 1Bgamma	1892	X
5629	1H, 13C, and 15N resonance assignments and topology of MTH187, a conserved protein from Methanobacterium thermoautotrophicum	1283	X
5630	1H 13C and 15N Assigned Chemical Shifts for ER75, an NESG target	1831	X
5631	ERBIN PDZ domain bound to a phage-derived peptide	1312	X
5632	Solution structure of the p2b hairpin from human telomerase RNA	488			X
5633	The solution structure of molt-inhibiting hormone from the kuruma prawn	1068	X
5634	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS1	167		X
5635	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS2	165		X
5636	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS3	167		X
5637	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS4	165		X
5638	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS5	163		X
5639	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS6	165		X
5640	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS7	163		X
5641	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS8	165		X
5642	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS9	167		X
5643	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS10	165		X
5644	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS11	167		X
5645	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS12	165		X
5646	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS13	163		X
5647	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS14	165		X
5648	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS15	163		X
5649	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS16	165		X
5650	NMR structure of the ribosomal protein L23 from Thermus Thermophilus	1230	X
5651	Txk SH3 domain backbone assignments	127	X
5652	1H Chemical Shift Assignments for CnErg1	233	X
5653	The solution structure of molt-inhibiting hormone from the kuruma prawn Marsupenaeus japonicus	964	X
5654	A Protein Contorsionist-Core Mutations Switch Monomeric Protein GB1 into an Intertwined Tetramer	667	X
5655	U80G U6 ISL RNA Chemical Shifts	356			X
5656	Resonance Assignments for the Z Domain of Staphylococcal Protein A using a 2H, 13C, 15N enriched, selective methyl protonated sample	486	X
5657	NMR structure for VT212	1345	X
5658	Sequence specific backbone assignment of 13C, 2H, 15N labeled ISG15	1091	X
5659	1H, 13C and 15N Backbone Assignments for the Human Rhinovirus-14 3C Protease	2005	X
5660	Partial proton resonance assignements for the different conformers of ferricytochrome c produced in 30% acetonitrile and 70% water solution	7	X
5661	Rapid backbone 1H, 13C, and 15N assignment of the V1 domain of human PKC iota using the new program IBIS	962	X
5662	Distinctive solution conformation of phosphatase inhibitor CPI-17 substituted with aspartate at the phosphorylation site threonine	817	X
5663	Distinctive solution conformation of phosphatase inhibitor CPI-17 substituted with aspartate at the phosphorylation site threonine	976	X
5664	Full 1H and 15N Chemical Shift Assignments for Oxytetracycline Acyl Carrier Protein	680	X
5665	ClpX Zinc Binding Domain	570	X
5666	1H, 15N and 13C backbone assignment of the Green Fluorescent Protein (GFP)	986	X
5667	Solution structure of the first zinc-finger domain from ZNF265	245	X
5668	Backbone and side chain 1H, 13C, and 15N chemical shift assignments for Zinc-containing 3-methyladenine DNA glycosylase I (TAG) from Escherichia coli	2221	X
5669	Structure and Ubiquitin Interactions of the Conserved NZF Domain of Npl4	303	X
5670	Structural Characterization of Hellethionins from helleborus purpurascens	291	X
5671	Overall structure and sugar dynamics of a DNA dodecamer from homo and heteronuclear dipolar couplings and 31P chemical shift anisotropy	22		X
5672	Automatic assignment of NOESY Cross peaks and determination of the protein structure of a new world scorpion neurotoxin Using NOAH/DIAMOD	363	X
5673	NMR Solution Structure of the Glucagon Antagonist [desHis1, desPhe6, Glu9]Glucagon Amide in the Presence of Perdeuterated Dodecylphosphocholine Micelles	162	X
5674	THREE DIMENSIONAL SOLUTION STRUCTURE OF HAINANTOXIN-IV BY 2D 1H-NMR	223	X
5675	THREE DIMENSIONAL SOLUTION STRUCTURE OF HAINANTOXIN-I BY 2D 1H-NMR	190	X
5676	1H chemical shifts of Pi4, a four disulfide bridged scorpion toxin active on potassium channels	446	X
5677	1H, 13C, and 15N assignment of the Focal Adhesion Targeting Domain of Focal Adhesion Kinase	1506	X
5678	1H, 15N, and 13C assigned Chemical shift for HNF-6a	1684	X
5679	1H, 13C and 15N chemical assignment of xylan-binding domain from Streptomyces olivaceoviridis E-86 beta-xylanase	1474	X
5680	Letter to the Editor: Sequence-specific assignment and secondary structure determination of the 195-residue complex formed by the Mycobacterium tuberculosis proteins CFP-10 and ESAT-6. Towards an understanding of their role in tuberculosis pathogenesis	1868	X
5681	DIMERIC SOLUTION STRUCTURE OF THE CYCLIC OCTAMER CD(CGCTCATT)	99		X
5682	Solution Structure of 30S Ribosomal Protein S27E from Archaeoglobus Fulgidus: RS27_ARCFU: a novel fold	705	X
5683	QR6 structure	1240	X
5684	1H and 15N Assigned Chemical Shifts for MTH1821	705	X
5685	1H, 15N, and 13C Assignments and CSI Analysis of a 18kDa Complex Formed by the Carboxyl-Terminal Domains of RAP74 and FCP1	1544	X
5686	Backbone 1H, 13C and 15N resonance assignments of the 50kD response regulator HP1043 from Helicobactor pylori	2602	X
5687	Stably folded de novo proteins from a designed combinatorial library	1251	X
5688	Backbone 1H, 13C, and 15N Chemical Shifts Assignment for the all-trans conformer of the cathelin-like domain of the protegrin-3 precursor	3976	X
5689	1H, 13C, and 15N backbone assignments of the pheromone binding protein from the silk moth Antheraea polyphemus (ApolPBP)	1634	X
5690	1H, 13C, and 15N Chemical Shift Assignments for Cobra Neurotoxin II	725	X
5691	Solution Structure of the 30S ribosomal protein S28E from Pyrococcus horikoshii. Northeast Structural Genomics Consortium target JR19	952	X
5692	Structural and functional insights into PINCH LIM4 domain-mediated integrin signaling	744	X
5693	Backbone chemical shift assignments of Grb2 complexed with ligand peptides for SH3 and SH2 domains	988	X
5694	10-residue folded peptide designed by segment statistics	57	X
5695	Solution Structure of the Product of the S. Cerevisiae YHR087W Gene, Northeast Structural Genomics Consortium target YTYst425	980	X
5696	1H, 15N and 13C resonance assignments of the PDZ domain of ZASP	1004	X
5697	1H and 15N resonance assignments of the PDZ domain of ZASP in complex with the EF hand domains of alpha-actinin-2	516	X
5698	Backbone and Side-chain 1H, and 15N Chemical Shift Assignments for TcPABC	546	X
5699	Structure of the N-terminal Extension of Human Aspartyl-tRNA Synthetase: Implications for its biological function	146	X
5700	Backbone 1H, 13C and 15N resonance assignments for the 25.8 kDa DNA binding domain of the human p63 protein	1178	X
5701	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the catalytic GEF domain of Salmonella SopE2	1857	X
5702	1H, 13C, and 15N Chemical Shift Assignments for Omega-atracotoxin-Hv1a at pH 6.0	377	X
5703	SP phosphorothioate U6 RNA ISL	271			X
5704	1H, 13C, and 15N assignment of mth677 protein from Methanobacterium Thermoautotrophicum	1124	X
5705	1H, 13C and 15N resonance assignment of an RNA UUCG Tetraloop	333			X
5706	Antibiotic binding domain of a TipA-class multidrug resistance transcriptional regulator	921	X
5707	Sequence-specific 1H, 13C and 15N resonance assignments of the birch pollen allergen Bet v 4	1016	X
5708	Solution structure of the N-terminal membrane anchor of E. coli enzyme IIA(Glucose)	191	X
5709	1H, 15N and 13C resonance assignments of the TPR domain of hSGT	831	X
5710	Structure and interactions of Mth11: A homologue of human RNase P protein Rpp29	955	X
5711	Solution Structure of HP0371, Biotin Carboxyl Carrier protein from Helocobacter pylori	719	X
5712	Backbone resonance assignment for human eIF4E in complex with m7GDP and a 17-amino acid peptide derived from human eIF4G	1000	X
5713	Influence of pH on NMR structure and stability of the human prion protein globular domain	1240	X
5714	1H Chemical shift assignments of the major conformation of a 11-mer DNA duplex containing an AG Mismatch	219		X
5716	CHEMICAL SHIFTS OF THE CK14 DNA DUPLEX: A PORTION OF THE KNOWN NF-kB SEQUENCE CK1	200		X
5717	NMR STRUCTURE OF THE CK14 DNA DUPLEX: A PORTION OF THE KNOWN NF-kB SEQUENCE CK1	100		X
5718	Chemical Shifts for the XBY2 DNA Duplex	198		X
5719	Resonance assignment and secondary structure of an N-terminal fragment of the human La protein	1287	X
5720	15N Relaxation Data of Escherichia coli Adenylate Kinase in Ligand-Free Form Obtained at Magnetic Fields of 14.10 and 18.79 T	382	X
5721	Backbone resonance assignment of a aminoglycoside-3'-phosphotransferase from Klebsiella pneumoniae	1391	X
5722	Chemical Shift Assignmens of Ca2+/C-terminal Domain of Caltractin (1H, 13C, and 15N) in Complex with the Cdc31p-Binding Domain from Kar1p (1H)	1082	X
5723	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Brazzein	150	X
5724	Backbone 1H, 13C, and 15N Chemical Shift Assignments for R43A Brazzein	149	X
5725	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Ala2ins Brazzein	150	X
5726	Backbone 1H, 13C, and 15N Chemical Shift Assignments for D50A Brazzein	149	X
5727	Backbone 1H, 13C, and 15N Chemical Shift Assignments for H31A Brazzein	149	X
5728	Backbone 1H, 13C, and 15N Chemical Shift Assignments for R33A Brazzein	149	X
5729	Solution Structure, Dynamics and Thermodynamics of the Native State Ensemble of the Sem-5 C-terminal SH3 Domain	800	X
5730	1H Chemical Shift Assignments for a DNA Duplex with N6-Deoxyadenosine Adduct of (9S,10R)-9,10-Epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene	220		X
5731	1H Chemical Shift Assignments for SCR3 peptide (18-34)	334	X
5732	1H Chemical Shift Assignments for SCR3 peptide (18-54)	459	X
5733	1H Chemical Shift Assignments for SCR3 peptide (34-54)	269	X
5734	1H Chemical Shift Assignments for SCR3 peptide (27-33)	97	X
5735	The Solution Structure of Rat Ab-(1-28) and its Interaction with Zinc: Insights into the Scarity of Amyloid Deposition in Aged Rat Brain	182	X
5736	Sequence specific resonance assignments of ICln, an ion channel cloned from epithelial cells	899	X
5737	Structure of the parallel-stranded DNA quadruplex d(TTAGGGA)4 containing the human telomeric repeat: evidence for A-tetrad formation from NMR and molecular dynamics simulation.	63		X
5738	The NMR Structure of a Bifunctional Rhodamine Labeled N-domain of Troponin C in Complex with the Regulatory 'Switch' Peptide from Troponin I	979	X
5739	Mispairing of the Deoxycytosine with Deoxyadenosine 5' to the 8, 9-Dihydro-8-(N7-guanyl)-9-Hydroxy-Aflatoxin B1 Adduct : Structural study based on NMR	191		X
5740	Backbone 1H, 13C and 15N Chemical shift assignments for the ternary DHFR:FOLATE:NADP+ complex	706	X
5741	Backbone 1NH, 13C and 15N Chemical shift assignments for the ternary DHFR:FOLATE:DHNADPH complex	1504	X
5742	Solution structure of soluble domain of Sco1 from Bacillus Subtilis	1669	X
5743	Backbone 1H, 13C and 15N Chemical Shift Assignments for the extracellular domain of b-dystroglycan (654-750)	342	X
5744	Backbone Assignments of folded alpha-synuclein	688	X
5745	NMR Structure of bovine cytochrome b5	898	X
5746	15N Relaxation Data of Escherichia coli Adenylate Kinase in Complex with Inhibitor Ap5A Obtained at Magnetic Fields of 14.10 and 18.79 T	404	X
5747	Solution structure of a four-helix bundle model, apo-DF1	389	X
5748	Assignment of 1H, 13C, and 15N Resonances of the ARID Domain of P270	1310	X
5749	Isolation, gene expression and solution structure of a novel moricin analogue, an antibacterial peptide from a lepidopteran insect, Spodoptera litura	315	X
5750	1H, 13C, and 15N Chemical Shift Assignments for the extracellular domain of BR3	535	X
5751	NMR structure of PCOLCE	1125	X
5752	1H, 13C and 15N backbone resonance assignment of the Integrin alpha2 I-domain	968	X
5753	Towards an Understanding of the Poliovirus Replication Complex: The Solution Structure of the Soluble Domain of the Poliovirus 3A Protein	710	X
5754	1H, 13C and 15N backbone resonance assignment of the VASP EVH1 domain	902	X
5755	Assignment of Human Phosphatase Regenerating Liver 2 (PRL-2)	1858	X
5756	Resonance Assignments for the 21 kDa engineered fluorescein-binding lipocalin FluA	2230	X
5757	13C, 15N solid state NMR chemical shift assignments for the microcrystallin Crh domain swapped dimer	450	X
5758	1H, 13C and 15N chemical shift assignments for YqgF	1370	X
5759	A model for effector activity in a highly specific biological electron transfer complex: The cytochrome P450cam-putidaredoxin couple	690	X
5760	1H, 13C, and 15N backbone assignment of the first two Ig domains Z1Z2 of the giant muscle protein titin	732	X
5761	1H, 13C and 15N Chemical Shift Assignments for Gamma-Adaptin Ear Domain	828	X
5762	The alternatively spliced PDZ2 domain of PTP-BL, PDZ2as	1076	X
5763	1H, 15N and 13C resonance assignments of the hypothetical protein SAV1595 from Staphylococcus aureus	1097	X
5764	1H, 13C and 15N Chemical Shift Assignments for the Nuclear Factor ALY RBD Domain	1229	X
5765	NMR studies of the fifth transmembrane segment of sarcoplasmic reticulum Ca2+-ATPase reveals a hinge close to the Ca2+ ligating residues	209	X
5766	Solution Structure of the Lyase Domain of Human DNA Polymerase Lambda	844	X
5767	1H NMR structure determination of Viscotoxin C1	278	X
5768	Solution structure of Copper-CopAS46V from Bacillus subtilis	544	X
5769	Solution structure of apo-CopAS46V from Bacillus subtilis	540	X
5770	Structural basis for simultaneous binding of two carboxy-terminal peptides of plant glutamate decarboxylase to calmodulin	2555	X
5771	Solution Structure of the disulphide-linked dimer of human intestinal trefoil factor (TFF3): the intermolecular orientation and interactions are markedly different from those of other dimeric trefoil proteins	367	X
5772	Backbone 1H, 13C and 15N chemical shifts of CBM13 from Streptomyces lividans	1167	X
5773	Solution structure of HIV-1 Stem Loop SL1	509			X
5774	Recognition of GU-rich polyadenylation regulatory elements by human CstF-64 protein	1100	X
5775	5'(dCCUCCUU)3':3'(rAGGAGGAAA)5'	147		X	X
5776	sPrODN1:RNA [5'-R(AAAGGAGGA)-3'/5'-D(CXXXXXX)-3']	152		X	X
5777	PODN:RNA [5'-R(AAAGGAGGA)-3'/5'-D(XXXXXXX)-3']	157		X	X
5778	1H, 15N and 13C chemical shift assignment of the Pleckstrin Homology domain of the Protein kinase B (PKB/Akt)	1039	X
5779	The Solution structure of HI1450	1310	X
5780	NMR structure of the PYRIN domain of human ASC	669	X
5781	The Solution Structure of a DNA.RNA Duplex Containing 5-Propynyl U and C Comparison with 5-Me Modifications	175		X	X
5782	1H chemical shift assignment for the truncated form of the human beta2-microglobulin lacking of the first 3 residues	716	X
5783	1H chemical shift assignments for a mutant of human beta2-microglobulin where ARG 3 is replaced by Ala	587	X
5784	1H assignment of a human variant of beta2-microglobulin where His 31 was replaced by a Tyr	541	X
5785	Global Orientation of Bound MMP-3 and N-TIMP-1 in Solution via Residual Dipolar Couplings	1362	X
5786	Solution Structure of Neural Cadherin Prodomain	1155	X
5787	1H, 13C and 15N resonance assignments and secondary structure of the cytotoxic protein RNase 3 from oocytes of bullfrog Rana catesbeiana	1346	X
5788	Structural basis for negative regulation of hypoxia-inducible factor-1alpha by CITED2	1532	X
5789	1H,15N, and 13C chemical shift assignments of the Escherichia coli nitrogen regulatory phosphocarrier IIANtr	1738	X
5791	Solution structure of a dimeric lactose DNA-binding domain complexed to a nonspecific DNA sequence	761	X	X
5792	Assignment of the 1H, 15N and 13C resonances of E. coli frataxin orthologue, CyaY	1241	X
5793	Backbone 1H, 15N, 13C and side chain 13Cb assignment of a 42 kDa RecR homodimer	903	X
5794	1H, 13C, 15N Chemical Shift Assignments for the SH3-SH2 domain pair of the tyrosin kinase Lck	1755	X
5795	The Solution Structure of a Novel Type of Antifungal Peptide Distinct With a Five-disulfide Motif from Eucommia ulmoides Oliv	602	X
5796	Solution Structure of a Putative Ribosome Binding-Protein from Mycoplasma pneumoniae and Comparison to a Distant Homolog	989	X
5797	Solution structure of the hypothetical protein TA1414 from Thermoplasma acidophilum	738	X
5798	Solution structure of Protein yrbA from Escherichia Coli: Northeast Structural Genomics Consortium target ER115	1139	X
5799	Protein Signal Assignments using Specific Labeling and Cell-free Synthesis	1362	X
5800	Sequence-specific 1H, 13C, 15N resonance assignments of the carboxyterminal domain of the transcription factor NusA from E.coli	1826	X
5801	Structural analysis of an EGF/TGF-alpha chimera with unique ErbB binding specificity	402	X
5802	1H, 13C and 15N Backbone Resonance assignments for the water soluble domain of ferric rat liver outer mitochondrial membrane cytochrome b5	721	X
5803	Three-disulfide variant of hen lysozyme: C64A/C80A	680	X
5804	Three-disulfide variant of hen lysozyme: C76A/C94A	782	X
5805	NMR Structure of an Archaeal Homologue of RNase P Protein Rpp29	1031	X
5806	Solution structure of the recombinant Penaeidin-3, a shrimp antimicrobial peptide	410	X
5807	Letter to the Editor: Assignments of 1H and 15N resonances of the bacteriophage lambda capsid stabilizing protein gpD	811	X
5808	Chemical shift assignments and relaxation parameters for the PAH2 domain of mSin3B bound to an extended SID of Mad1	911	X
5809	1H Chemical Shift Assignments for the cyanomet complex of the isolated alpha-chain from human hemoglobin A	904	X
5810	1H, 15N and 13C resonance assignment of staphostatin A, a specific Staphylococcus aureus cysteine proteinase inhibitor	661	X
5811	1H Chemical Shift Assignments for quasi-repetitive arginine/glycine/ tyrosine-rich domains within glycine-rich RNA binding proteins	47	X
5812	1H Chemical Shift Assignments for quasi-repetitive arginine/glycine/ tyrosine-rich domains within glycine-rich RNA binding proteins	47	X
5813	The solution structure of the whole N-terminal domain of the ATPase CopA from Bacillus Subtilis. Implications for the function	1655	X
5814	The C-terminal domain of Viral IAP associated factor (cVIAF) is a structural homolog of phosducin: Resonance assignments and secondary structure of the C-terminal domain of VIAF	1550	X
5815	Structure of the coat protein in fd filamentous bacteriophage particles	43	X
5816	Backbone 1H, 13C, and 15N Chemical Shift Assignment of The Dimer Yeast Peroxiredoxin YLR109w	843	X
5817	NMR Structure of a Prototype LNR Module from Human Notch1	299	X
5819	Complete 1H, 15N and 13C assignment of the soluble domain of the ba3 oxidase subunit II of Thermus thermophilus in the reduced state	1651	X
5820	Tertiary structure of thiopurine methyltransferase from Pseudomonas syringae, the bacterial orthologue of a polymorphic, drug-metabolizing enzyme	2157	X
5821	1H, 15N and 13C assignments of single-stranded DNA binding domains from the 70 kDa subunit of Human Replication Protein A	1400	X
5822	1H, 15N and 13C assignments of single-stranded DNA binding domains from the 70 kDa subunit of Human Replication Protein A	1506	X
5823	1H, 15N and 13C assignments of single-stranded DNA binding domains from the 70 kDa subunit of Human Replication Protein A	2918	X
5824	Sequence-specific 1H, 13C and 15N resonance assignments of the C-terminal domain of KaiA, a circadian clock protein (oxidized form)	1280	X
5825	Sequence-specific 1H, 13C and 15N resonance assignments of the C-terminal domain of KaiA, a circadian clock protein (reduced form)	367	X
5826	Nickel-binding property of Bacillus pasteurii UreE and the role of the C-terminal tail	628	X
5827	Backbone and sidechain heteronuclear resonance assignments and hyperfine nuclear magnetic resonance shifts in horse cytochrome c	1078	X
5828	Backbone and sidechain heteronuclear resonance assignments and hyperfine nuclear magnetic resonance shifts in horse cytochrome c	1051	X
5829	Backbone and sidechain heteronuclear resonance assignments and hyperfine nuclear magnetic resonance shifts in horse cytochrome c	196	X
5830	Backbone and sidechain heteronuclear resonance assignments and hyperfine nuclear magnetic resonance shifts in horse cytochrome c	196	X
5832	Function and solution structure of hainantoxin-III, a potent neuronal TTX-sensitive sodium channel antagonist from Chinese bird spider Selenocosmia hainana	217	X
5833	1H, 13C, and 15N Chemical Shift Assignments for Mob1	1735	X
5834	Solution structure of the HIV-1 frameshift inducing stem-loop RNA	245			X
5836	Backbone 1H, 13C, 15N chemical shifts and coupling constants of Yersinia pseudotuberculosis-derived mitogen	954	X
5837	Structure of a peptide derived from the voltage gated Na+ channel and its selective interaction with local anesthetic as determined by NMR spectroscopy	163	X
5838	Structural Model for Calcium Dependent Activation of Ndr Kinase by S100B	1246	X
5840	Chemical Shifts assignments for Frenatin 3 in both Triflouroethanol/water and water	365	X
5842	Backbone and side chain 1H, 13C, and 15N chemical shift assignments for Haemophilus influenza protein IR24	1287	X
5843	Solution Structure of At3g17210	1380	X
5844	ZR18 Structure determination	1089	X
5845	Backbone and side chain 1H, 13C, and 15N chemical shift assignments for S. aureus protein MW2441 / SACOL2532. Northeast Structural Genomics Target ZR31.	1183	X
5846	1H, 13C, and 15N Chemical Shift Assignments for Hypothetical protein NMA1147: the Northeast Structural Genomics Consortium Target MR19	1076	X
5847	Backbone and sidechain 1H, 13C, and 15N chemical shifts for Sda	603	X
5848	Solution structure of S8-SP11	282	X
5849	Solution structure of the PCI domain	931	X
5850	Kinetic and Structural Studies of the Low Moleuclar Weight Protein Tyrosine Phosphatase from Tritrichomonas foetus	1492	X
5851	Solution Stucture of the Third Zinc Finger from BKLF	246	X
5852	NMR Structure of the Active Conformation of the Varkud Satellite Ribozyme Cleavage Site	434			X
5853	Sequential 1H, 15N and 13C NMR assignment of human Calbindin D28k	1186	X
5854	1H, 13C, and 15N backbone assignments for the 60.8 kD dimer of the NAD+ synthetase from Bacillus subtilis	1259	X
5856	Backbone Resonances Assignments of Human Adult Hemoglobin in the Carbonmonoxy Form	1275	X
5857	NMR assignment of human Sip(7-50)	444	X
5858	Characterization of us-ms Dynamics of Proteins Using a Combined Analysis of 15N NMR Relaxation and Chemical Shift: Conformational Exchange in Plastocyanin Induced by Histidine Protonations	2624	X
5859	Structure of Antibacterial Peptide Microcin J25: A 21-Residue Lariat Protoknot	224	X
5860	Structure of Subtilosin A, an Antimicrobial Peptide from Bacillus subtilis with Unusual Post-translational Modifications Linking Cysteine Sulfurs to alpha-Carbons of Phenylalanine and Threonine	335	X
5861	Backbone resonance assignments of GTPase domain of E.coli MnmE	950	X
5862	Assignments of death domain of TRADD	1217	X
5863	Backbone HN, N, Ca, C and Cb chemical shift assignments and Secondary Structure of FkpA, a 245-residue peptidyl- prolyl cis/trans isomerase with chaperone activity	1123	X
5864	Neurokinin B	10	X
5865	Solution Structure of Bmkk 2, A Novel Potassium Channel Blocker from Scorpion Buthus martensi Karsch	191	X
5866	Solution Structure and NH Exchange Studies of the MutT Pyrophosphohydrolase Complexed with Mg(2+) and 8-oxo-dGMP, a Tightly-bound Product	1226	X
5867	Solution Structure of the third SH3 domain of human intersectin 2(KIAA1256)	748	X
5868	Solution structure of XPC binding domain of hHR23B	812	X
5869	Solution Conformation of alphaA-Conotoxin EIVA	164	X
5871	Sequence-specific 1H, 13C and 15N resonance assignments of Ara h 6, an allergenic 2S albumin from peanut	1141	X
5872	1H, 13C, and 15N resonance assignments of human RGSZ1	1262	X
5873	Backbone and side chains 1H, 13C, and 15N Chemical Shift Assignments for BlaI-NTD	940	X
5874	Complete backbone resonance assignments of p47: the 41kDa adaptor protein of the AAA ATPase p97	1181	X
5875	1H, 13C, and 15N Chemical Shift Assignments of the dimeric mutant of GB1	598	X
5876	Complete backbone resonance assignments of p47: the 41kDa adaptor protein of the AAA ATPase p97	1950	X
5877	Solid State NMR Structure of the Major Coat Protein in Bacteriophage Pf1	43	X
5878	1H, 13C and 15N NMR assignment of the region 1463-1617 of mouse p53 Binding Protein 1 (53BP1)	1861	X
5879	Structure of a Type IVb pilin from Salmonella typhi and its assembly into pilus	1598	X
5880	Solution structure of the retroviral Gag MA-like domain of RIKEN cDNA 3110009E22	1235	X
5881	Structural basis for tetrodotoxin-resistant sodium channel binding by mu-conotoxin SmIIIA	257	X
5882	Backbone chemical shift assignments for the C-terminal globular domain of EMILIN-1	717	X
5883	How C-Terminal Carboxyamidation Alters the Biological Activity of Peptides from the Venom of the Eumenine Solitary WasP	109	X
5884	Assignment of 1H, 13C and 15N resonances of the AXH domain of the transcription factor HBP1	1713	X
5885	CHEMICAL SHIFTS OF A FUSED DOCKING DOMAIN FROM THE ERYTHROMYCIN POLYKETIDE SYNTHASE (DEBS), A MODEL FOR THE INTERACTION BETWEEN DEBS 2 AND DEBS 3	1179	X
5886	Backbone 1H, 13C and 15N Chemical Shift Assignments for TF1 bata subunit	1554	X
5887	1H, 15N and 13C assignments for nuclear transport factor 2 (NTF2)	1227	X
5888	Backbone 1H, 15N, CA and CB assignments for the W7A mutant of rat nuclear transport factor 2 (NTF2)	502	X
5889	1H assignments for yeast nucleoporin Nsp1 residues 528-557	142	X
5890	The NMR-derived Solution Structure of a New Cationic Antimicrobial Peptide from the Skin Secretion of the Anuran Hyla punctata	95	X
5891	1H, 15N and 13C NMR Assignments and Secondary Structure of a Hyperthermophile DNA-binding Protein Predicted to contain an Extended Coiled Coil Domain	1180	X
5892	1H, 13C and 15N NMR Assignments of the Hyperthermophile Sulfolobus Protein Sso10b2 and its Predicted Secondary Structure	1104	X
5893	Unusual Ca2+-calmodulin binding interactions of the microtubule-associated protein F-STOP	605	X
5894	1H, 13C, and 15N resonance assignments for the N-terminal domain of Drosophila Stem-Loop Binding Protein	507	X
5895	1H, 13C, and 15N resonance assignments for Zn2+ and Ca2+ bound S100B	740	X
5896	Unusual Ca2+-calmodulin binding interactions of the microtubule-associated protein F-STOP	457	X
5897	Solution Structure of the BHRF1 Protein From Epstein-Barr Virus, a Homolog of Human Bcl-2	1700	X
5898	Backbone 1H, 13C and 15N resonance assignments for the 24.4 kDa human gankyrin protein	1287	X
5899	NMR Solution Structure of BeF3-Activated Spo0F, 20 conformers	1370	X
5900	NMR structure of 16th module of Immune Adherence Receptor, Cr1 (Cd35)	474	X
5901	Solution Strucure of a CCHHC Domain of Neural Zinc Finger Factor-1	256	X
5902	1H, 13C, and 15N Resonance Assignments of the Hath-Domain of Hepatoma-derived Growth Factor	1240	X
5903	1H,13C and 15N backbone resonance assignment of the Hyaluronan-binding domain of CD44	572	X
5904	NMR study of inhibitor-1a - a protein inhibitor of protein phosphatase-1	1026	X
5905	Backbone 15N and 1HN Chemical Shift Assignments for Sac7d	146	X
5906	1H, 15N, and 13C resonance Assignments of DARPP-32 (dopamine and cAMP-regulated phosphoprotein, Mr. 32,000) -A Protein Inhibitor of Protein Phosphatase-1	1084	X
5907	Assignment of 1H, 13C and 15N Resonances of the Human Ku80 C-terminal Domain	1733	X
5908	Backbone 1HN and 15N Chemical Shift Assignments for Sac7d V30I	133	X
5909	Backbone 1HN and 15N Chemical Shift Assignments for Sso7d	134	X
5910	Backbone 1HN and 15N Chemical Shift Assignments for Sso7d I30V	124	X
5911	NMR Solution Structure of a Peptide from the mdm-2 Binding Domain of the p53 Protein that is Selectively Cytotoxic to Cancer Cells	340	X
5912	The 3D solution structure of the C-terminal region of Ku86	1503	X
5914	NMR structure of Methionine-Enkephalin in fast tumbling Bicelles/DMPG	27	X
5915	NMR structure of Methionine-Enkephalin in fast tumbling DMPC/DHPC bicelles	27	X
5916	How C-Terminal Carboxyamidation Alters the Biological Activity of Peptides from the Venom of the Eumenine Solitary WasP	121	X
5917	Backbone 1HN, 13C, 15N Chemical Shift Assignments for human eIF2alpha	1122	X
5918	Multiple time-scale dynamics of homologous thermophilic and mesophilic ribonuclease HI enzymes	737	X
5919	The solution structure of the loop E region of the 5S rRNA from spinach chloroplasts	383			X
5920	1H, 13C and 15N backbone and side-chain chemical shift assignments of PrrA effector domain from R. sphaeroides	981	X
5921	NMR assignment of TM1442, a putative anti-sigma-factor antagonist from Thrmotoga maritima	1373	X
5922	Solution Structure of the HERG K+ channel S5-P extracellular linker	250	X
5923	Backbone 1H, 13C, and 15N Chemical Shift Assignments for T22G mutant of N-terminal SH3 domain of the Drosophila protein drk	153	X
5924	NMR Solution Structure of the Focal Adhesion Targeting Domain (FAT) of Focal Adhesion Kinase (FAK) in Complex with a Paxillin LD Peptide: Evidence for a Two Site Binding Model	1263	X
5925	Solution structure of the N-terminal SH3 domain of Drk (drkN SH3 domain)	168	X
5927	NMR Structure of a Cyclic Polyamide-DNA Complex	197		X
5928	NMR assignment of the hypothetical ENTH-VHS domain At3g16270 from Arabidopsis thaliana	1638	X
5929	NMR assignment of the hypothetical rhodanase domain At4g01050 from Arabidopsis thaliana	1609	X
5930	Backbone 1H, 15N, 13C Resonance Assignment of a-ADT	734	X
5931	Dynamics of the RNase H Domain of HIV-1 Reverse Transcriptase in the Presence of Magnesium and AMP	1717	X
5932	YNMG tetraloop formation by a dyskeratosis congenita mutation in human telomerase RNA	267			X
5933	Sequence-specific backbone and sidechain resonance assignments of the Ste50 binding domain of the MAPKKK Ste11	845	X
5934	13C and 15N Chemical Shift Assignments for f-MLF-OH	20	X
5935	Sequence-specific 1H, 13C and 15N resonance assignments of rat liver fructose-2,6-bisphosphatase domain	884	X
5936	Backbone 1H, 15N, 13C Resonance Assignment of b-ADT	605	X
5937	1H, 13C and 15N Chemical Sift Assignments for PDZ2b domain of PTP-Bas (hPTP1E)	1056	X
5938	Proton chemical shift assignments for CP-11	123	X
5939	Backbone and sidechain assignment of murine Spred2 EVH1 domain	1290	X
5940	1H, 15N and 13C backbone assignment of the carboxyl terminal domain of the cytokine binding module of the interleukin-6 receptor (IL-6R)	856	X
5941	Proton chemical shift assignments for cycloCP-11	142	X
5942	1H, 13C, 15N chemical shift assignment of hypothetical protein hi0004 from Haemophilus Influenzae	1831	X
5943	Letter to the Editor: 1H, 15N and 13C Resonance Assignments and Secondary Structure Determination of the D2 Domain of the Human Acidic Fibroblast Growth Factor Receptor	1156	X
5944	A Zinc Clasp Structure Tethers Lck to T Cell Coreceptors CD4 and CD8	609	X
5945	A Zinc Clasp Structure Tethers Lck to T Cell Coreceptors CD4 and CD8	457	X
5946	Complete Resonance assignments of a donor-strand complemented AfaD: the afimbrial invasin from Diffusely Adherent E. coli	1476	X
5947	Complete resonance assignments of a 'donor strand complemented' AfaE-III: the afimbrial adhesin from Diffusely Adherent E. coli	1565	X
5948	Structure Analysis of Integrin alpha IIb beta 3 - Specific Disintegrin with the AKGDWN Motif	439	X
5949	Structure Analysis of Integrin alpha IIb beta 3 - Specific Disintegrin with the AKGDWN Motif	437	X
5950	1H, 15N and 13C resonance assignment for the Escherichia coli cell division activator CedA	1123	X
5951	1H and 15N chemical shift assignment and secondary structure of human saposin C	596	X
5952	1H, 13C and 15N Chemical Shift Assignments for HPV-16 E2C	1038	X
5953	Sequential Resonance Assignments of the Extracellular Domain of the Human TGFB type II Receptor in Complex with Monomeric TGFB3	590	X
5954	Sequential Resonance Assignments of the Extracellular Domain of the Human TGFB type II Receptor in Complex woth Monomeric TGFB3	595	X
5955	Backbone and sidechain assignment of human VASP EVH2 domain	467	X
5956	NMR solution structure of Max in absence of DNA: Insight into the mechanism of DNA recognition by B-HLH-LZ transcription factors	700	X
5958	1H, 13C and 15N resonance assignments of human microtubule-associated protein light chain-3	586	X
5959	Structure of human Ki67 FHA domain and its binding to a phosphoprotein fragment from hNIFK reveal unique recognition sites and new views to the structural basis of FHA domain functions	1229	X
5960	1H, 13C, 15N- Chemical Shift Assignments for Myristoylated HIV-1 Matrix Protein	1352	X
5961	Binding site structure of one LRP/RAP complex - implications for a common ligand/receptor binding motif	516	X
5962	Chemical shifts assignments of domain 5 of the ai5gamma group II intron	410			X
5963	1H, 13C, 15N resonance assignment of hypothetical protein hi1723 from Haemophilus Influenzae	1219	X
5964	Solution structures of the C-terminal headpiece subdomains of human villin and advillin, evaluation of headpiece F-actin binding requirements	257	X
5965	Solution structures of the C-terminal headpiece subdomains of human villin and advillin, evaluation of headpiece F-actin binding requirements	252	X
5966	Solution structures of the C-terminal headpiece subdomains of human villin and advillin, evaluation of headpiece F-actin binding requirements	266	X
5967	Solution structure of the mature HIV-1 protease monomer	353	X
5968	NMR structure of the human dematin headpiece domain	851	X
5969	Solution Structure of holo-Neocarzinostatin	948	X
5970	Solution Structure of Ribosomal Protein L18 from Bacillus stearothermophilus	956	X
5971	Letter to the Editor: Backbone and side chain resonance assignments of domain III of tick-borne Langat flavivirus Envelope protein	1122	X
5972	Proton Chemical Shifts for E coli ProP 468-497 peptide	248	X
5973	Solution Structure of Dengue Virus Capsid Protein Reveals a New Fold	1116	X
5974	Assignment of the 1H, 13C and 15N resonances of the catalytic domain of guanine nucleotide exchange factor BopE from Burkholderia pseudomallei	1757	X
5975	1H and 15N chemical shift assignments for the N-domain of trout cardiac troponin C at 30 and 7 C	1578	X
5976	1H-, 13C- and 15N-NMR assignment of the conserved hypothetical protein TM0487 from Thermotoga maritima	1281	X
5977	NMR for Structural Proteomics of Thermotoga maritima: Screening and Sructure Determination	807	X
5978	Structure and function of the membrane domain of hepatitis C virus nonstructural protein 5A	939	X
5979	A parallel stranded DNA duplex with an A-G mismatch base-pair	229		X
5980	Structure Function Analysis of the Stemp Loop IIIc of HCV and GBV-B IRES	71			X
5981	1H, 15N and 13C resonance assignments of human dihydrofolate reductase in its complex with trimethoprim and NADPH	2020	X
5982	Complete 1H, 13C and 15N assignments of a monomeric, biologically active apolipoprotein E carboxyl-terminal domain	1115	X
5983	1H, 13C and 15N resonance assignments of human 5-10-methenyltetrahydrofolate synthetase	1910	X
5984	1H and 15N chemical shift assignments for FtsN 243-319	573	X
5985	Solution Conformation of alpha-Conotoxin GIC, a Novel Potent Antagonist of alpha3beta2 Nicotinic Acetylcholine Receptors	85	X
5986	Solution structure of paralytic peptide of the wild Silkmoth, Antheraea yamamai	126	X
5987	Interaction of the TAZ1 domain of CREB-binding protein with the activation domain of CITED2: Regulation by competition between intrinsically unstructured ligands for non-identical binding sites	1549	X
5988	1H Chemical Shift Assignments of alpha-bungarotoxin/nicotinic acetilcholine receptor mimotope complex	544	X
5989	Cytotoxin I from the venom of the Central Asian cobra Naja Oxiana, in aqueous solution	842	X
5991	Backbone and Sidechain 1H, 13C, and 15N Chemical Shift Assignments and Backbone 15N Relaxation Parameters for Murine Ets-1 deltaN301	1838	X
5992	1H, 13C and 15N resonance assignment and secondary structure of the C-terminal domain of the human centrin 2 in complex with a 17 residue peptide from Xeroderma Pigmentosum group C protein	947	X
5993	1H shifts for the DNA duplex containing 5-hydroxy Uracil lesion	118		X
5994	Solution structure of Human Orexin-A:Regulator of Appetite and Wakefulness	166	X
5995	Temperature Dependent Spectral Density Analysis Applied to Monitoring Backbone Dynamics of Major Urinary Protein-I Complexed with the Pheromone 2-sec-Butyl-4,5-dihyrothiazole	318	X
5996	Temperature Dependent Spectral Density Analysis Applied to Monitoring Backbone Dynamics of Major Urinary Protein-I Complexed with the Pheromone 2-sec-Butyl-4,5-dihyrothiazole	318	X
5997	Improving the Accuracy of NMR Structures of Large Proteins Using Pseudocontact Shifts as Long-range Restraints	542	X
5998	1H, 15N and 13C resonance assignments of the ApaG/CorD protein of the phytopathogen Xanthomonas axonopodis pv. citri	1436	X
5999	NMR Assignments of the Drosophila Argonaute 2 Paz domain	1499	X
6000	1H, 13C and 15N Resonance Assignments of the Drosophila Argonaute1 PAZ Domain	1693	X
6001	1H, 15N and 13C resonance assignments of the C345C domain of the complement component C5	1706	X
6002	Structure of the C-terminal domain of p63	925	X
6003	Complete Resonance Assignments of Bundlin (BfpA) from the Bundle- forming Pilus of Enteropathogenic Escherichia coli	1696	X
6004	1H, 13C, 15N assignments of human Cofilin	1864	X
6005	Structural Basis for Recognition of the mRNA Class II AU-Rich Element by the Tandem Zinc Finger Domain of TIS11d	835	X		X
6006	1H Chemical Shift Assignments for CCAP from the fruit fly Drosophila melanogaster	53	X
6007	1H, 13C and 15N resonance assignment of the Plasminogen Kringle 4 Binding Calcium Free Form of the C-type Lectin-like Domain of Tetranectin	1250	X
6008	1H, 13C and 15N resonance assignment of the Calcium Bound Form of the C-type Lectin-like Domain of Tetranectin	927	X
6009	NMR structure of the thrombin-binding DNA aptamer stabilized by Sr2+	176		X
6010	High-Resolution NMR Structure of the Conserved Hypothetical Protein TM0979 from Thermotoga maritima	1032	X
6011	Solution structure of a homodimeric hypothetical protein, At5g22580, a structural genomics target from Arabidopsis Thaliana	1240	X
6012	Human Sgt1 binds to HSP90 through the CS domain and not the TPR domain	1361	X
6013	1H, 13C and 15N resonance assignments of the third spectrin repeat of alpha-actinin-4	1531	X
6014	1H, 13C and 15N backbone resonance assignments of matrilysin (mmp7) complexed with a hydroxamic acid inhibitor	919	X
6015	Sequence specific assignment of C1 domain of human cardiac myosin binding protein C	1151	X
6016	Backbone resonance assignments of the 45.3 kDa catalytic domain of human BACE1	1560	X
6017	Study on structure-activity relationship of S100C/A11 protein	121	X
6018	Study on structure-activity relationship of S100C/A11 protein	121	X
6019	Solution structure of Archaeon DNA-binding protein ssh10b P62A mutant	1012	X
6020	Structure-activity relationships for the beta-hairpin cationic antimicrobial peptide polyphemusin I	139	X
6021	Backbone 1H, 15N and 13C assignments for the subunit a of the E.coli ATP Synthase	1241	X
6022	Second Metal Binding Domain of the Menkes ATPase	582	X
6023	1H, 15N, and 13C Resonance Assignments of Calmodulin Complexed with the Calmodulin-Binding Domain of Protein Phosphatase 2B	1544	X
6024	1H, 13C and 15N backbone resonance assignment for TEM-1, a 28.9 kDa beta-lactamase from E. coli	1257	X
6025	1H, 13C, 15N resonance assignments of the cytokine LECT2	664	X
6026	Chemical Shift Assignments for Oxidized Human Ferredoxin	1002	X
6028	Northeast Structural Genomics Consortium Target TT802 Ontario Center for Structural Proteomics Target Mth0803 assignment of ribosomal protein S17E	764	X
6029	1H, 13C and 15N resonance assignment of the nucleotide binding domain of KdpB from Escherichia coli	1656	X
6030	1H, 13C and 15N resonance assignment of the nucleotide binding domain of KdpB from Escherichia coli	1455	X
6031	1H, 13C, and 15N resonance assignments of human Notch-1 calcium binding EGF domains 11-13	1161	X
6032	Complete 1H, 13C and 15N resonance assignments of coactosin, a cytoskeletal regulatory protein	1797	X
6033	NMR characterisation shows that a b-type variant of Hydrogenobacter thermophilus cytochrome c552 retains its native fold	353	X
6034	1H, 15N, 13C resonance assignments and 15N-1H residual dipolar couplings in 27 kDa alpha-adaptin ear-domain	1069	X
6035	1H, 13C and 15N assignments for human DNA ligase III 1-117	1051	X
6037	Solution Structure of BmKX, a novel potassium channel blocker from the Chinese Scorpion Buthus martensi Karsch	183	X
6038	NMR Structure of CXC Chemokine CXCL11/ITAC	1065	X
6039	NMR Structure of a D,L-Alternating Dodecamer of Norleucine	84	X
6040	SP-B C-terminal peptide in SDS micelles	124	X
6041	Structure of the antimicrobial hexapeptide cyc-(RRWWRF) bound to DPC and SDS micelles	99	X
6043	1H, 13C and 15N resonance assignment of Cu(I)-Pseudoazurin from Alcaligenes faecalis S-6	1427	X
6044	Resonance assignment and secondary structure of the La motif	1283	X
6045	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Hypothetical protein PF0455	1512	X
6046	1H, 13C and 15N resonance assignments for domain III of the West Nile Virus envelope protein	1297	X
6047	1H, 15N, and 13C resonance assignment of the 23 kDa organomercurial lyase MerB in the free form	1802	X
6048	NEW STRUCTURAL FAMILY OF AN ANTIMICROBIAL PEPTIDE DERIVED FROM BOVINE HEMOGLOBIN	178	X
6049	Solution Structure of Human alpha-Parvalbumin (Minimized Average Structure)	1001	X
6050	Solution structure of Sso7d mutant (K12L), NMR, 4 structures	446	X
6051	1H, 13C and 15N resonance assignments for methionine sulfoxide reductase B from Neisseria gonorroeae	1296	X
6052	Backbone and side chain 1H, 13C, and 15N chemical shift assignments for Haemophilus human protein HR969	1652	X
6053	1H, 13C and 15N resonance assignments of the N-terminal 16kDa domain of Escherichia coli Ada Protein	1679	X
6054	1H, 13C and 15N resonance assignments of the methylated N-terminal 16kDa domain of Escherichia coli Ada Protein	1717	X
6055	1H, 13C, and 15N resonance assignment of the 23 kDa organomercurial lyase in its free and mercury-bound forms	1910	X
6056	Yeast oligosaccharyltransferase subunit Ost4p	226	X
6057	Sequence-specific resonance assignments of the tandem SH3 domains in autoinhibitory form of p47phox	909	X
6058	1H, 13C and 15N Assignments for the Hypothetical Archaeglobus fulgidis protein AF2095. Northeast Structural Genomics Consortium target GR4	1438	X
6059	Ras-induced losing of interaction between C1 and RBD domains of Nore1	494	X
6060	1H, 13C, and 15N Chemical Shift Assignments for a complex of PDZ2 from PTP-BL with the C-terminus of APC (adenomatous polyposis coli)	1010	X
6061	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the N-terminal 69 Amino Acid Residues of the ColE9 T1-61-DNase Fusion Protein	497	X
6062	Assignments for the Negative Regulator of Splicing from Rous Sarcoma Virus residues 907 to 929	383			X
6063	E6-binding zinc finger (E6apc2)	165	X
6064	E6-binding zinc finger (E6apc1)	166	X
6066	Structure-Activity Relationships in a Sodium Channels Inhibitor Hainantoxin-Iv	218	X
6067	Structure-Activity Relationships in a Sodium Channels Inhibitor Hainantoxin-Iv	219	X
6068	Solution structure of porcine peptide YY (pPYY) in solution and bound to DPC micelles	530	X
6069	Chemical Shift Assignments for Precarnobacteriocin B2	623	X
6070	Solution Structure of Endothelin-1 with its C-terminal Folding	137	X
6071	1H, 13C and 15N Resonance Assignments and Secondary Structure of Human Coactosin Like Protein D123N	1685	X
6072	Solution structure of human p53 binding domain of PIAS-1	807	X
6073	A functional SOD-like protein in Bacillus subtilis	1608	X
6074	Backbone 1H, 13C and 15N resonance assignments for the 29kD Pseudomonas aeruginosa dimethylarginine dimethylaminohydrolase involved in nitric oxide synthase regulation	1224	X
6075	Backbone and side chain assignment of arsenate reductase from Bacillus Subtilis	1532	X
6076	Loop B RNAs from the Stem-Loop IV domain of the Enterovirus Internal Ribosome Entry Site with a Six-nucleotide Bulge AUCCCU	666			X
6077	Loop B RNAs from the Stem-Loop IV domain of the Enterovirus Internal Ribosome Entry Site with a Six-nucleotide Bulge AUUCCU	496			X
6078	IA3, an Aspartic Proteinase Inhibitor for Saccharomyces cerevisiae, Is Intrinsically Unstructured in Solution	273	X
6079	1H, 13C and 15N resonance assignment of the reduced form of thioredoxin h1 from Poplar, a plant CPPC active site variant	1238	X
6080	1H, 15N, 13C resonance assignments of the human protein tyrosine phosphatase PRL-1	1116	X
6081	1H, 13C and 15N chemical shift assignment of fly troponin C	1664	X
6082	Structure in solution of SFA8, a Albumin 2S from Sunflower seeds	636	X
6083	Specific recognition between surface loop 2 (132-143) and helix 1 (144-154) within sheep prion protein from in vitro studies of synthetic peptides	143	X
6084	NMR structure of a variant 434 repressor DNA-binding domain devoid of hydroxyl groups	492	X
6085	Solution Structure of hybrid white striped bass hepcidin	181	X
6086	1H, 13C and 15N assignments of the tandem WW domains of human MAGI-1/BAP-1	1085	X
6087	Conformation and Ion-Channeling activity of the hepatitis C virus p7 polypeptide	639	X
6088	E6-bind Trp-cage (E6apn1)	151	X
6089	1H Chemical Shift Assignments of non-specific Lipid Transfer Protein 1 Isolated from Seeds of Mung Bean	584	X
6090	1H, 13C and 15N resonance assignement of the reduced form of methionine sulfoxide reductase A from Escherichia coli	1630	X
6091	1H, 13C, and 15N Chemical Shift Assignments for a complex of PDZ2 from PTP-BL with the C-terminus of p75 (NTR)	709	X
6092	1H, 13C, and 15N Chemical Shift Assignments for a complex of PDZ2 from PTP-BL with the C-terminus of RIL (reversion induced LIM)	1005	X
6093	SOLUTION STRUCTURE OF THE HYALURONAN BINDING DOMAIN OF HUMAN CD44	1432	X
6094	NMR structure of the 101 nucleotide core encapsidation signal of the moloney murine leukemia virus	1296			X
6095	Solution structure of the KIX domain of CBP bound to the transactivation domain of c-Myb	1266	X
6096	The solution structure of the pH-induced monomer of dynein light chain LC8 from Drosophila	1020	X
6097	Proton chemical shift assignments for human spliceosomal protein U1C zinc finger domain	377	X
6098	Backbone 1H, 13C, and 15N chemical shift assignments for the amino terminal domain of the transcriptional cofactor PC4	868	X
6099	Backbone 1H, 13C, and 15N chemical shift assignments for the activation domain of the transcriptional activator VP16	591	X
6100	Backbone 1H, 13C and 15N chemical shift assignents of the 18.5kDa isoform of murine myelin basic protein (MBP)	1106	X
6101	Solution Structure of a D,L-Alternating Oligonorleucine as a Model of Double-Stranded Antiparallel beta-helix	100	X
6102	Solution structure of conserved protein YbeD from E. coli	669	X
6103	Unexpected structure of the Ca2+-regulatory region from soybean calcium-dependent protein kinase-alpha	719	X
6104	Unexpected structure of the Ca2+-regulatory region from soybean calcium-dependent protein kinase-alpha	1579	X
6105	Conformational and structural analysis of the equilibrium between single and double-strand beta-helix of a D,L-alternating oligonorleucine	70	X
6106	NMR structure of cross-reactive peptides from Homo sapiens	61	X
6107	NMR structure of cross-reactive peptides from L. braziliensis	58	X
6108	Solution structure of GlgS protein from E. coli	675	X
6109	Chemical shifts of assigned proton resonances of BmKK4 at 303K and pH=3.66	176	X
6110	solution structure of a chimeric LEKTI-domain	340	X
6111	1H, 13C and 15N resonance assignments of the antifreeze protein cfAFP-501 from spruce budworm at different temperatures	1794	X
6112	Backbone 1H, 13C and 15N Chemical Shift Assignments for p27-KID in Solution	230	X
6113	1H, 13C and 15N assignment of the second PDZ domain of the neuronal adaptor protein X11alpha	996	X
6114	1H, 13C and 15N resonance assignment of the C-terminal BRCT domain from human BRCA1	1317	X
6115	Structural and Functional Analysis of a picornaviral Internal cis-acting replication element	268			X
6116	Backbone 1H, 13C and 15N resonance assignment of the N-terminal domain of human eRF1	543	X
6117	1H,13C,15N assignments for ChaB	833	X
6118	1H, 13C and 15N assignments of poplar phloem glutaredoxin	993	X
6120	Backbone 1H, 13C, and 15N Chemical Shift Assignments for NESG target CcR19	1705	X
6121	1H, 15N, and 13C chemical shift assignments of CUG binding protein-CUGBP	2122	X
6122	1H/13C/15N assignment of the S1 domain of RNase E of E. coli	1125	X
6123	1H chemical shift assignments for truncated hevein of 32 aa bound to N,N',N''-triacetylchitotriose	179	X
6125	1H, 13C, 15N chemical shift assignments of an enolase-phosphatase E1 from Klebsiella oxytoca	2335	X
6126	NMR Structure of the CRIB-PDZ module of Par-6	1489	X
6127	Solution structure of the E. coli bacteriophage P1 encoded HOT protein: a homologue of the theta subunit of E. coli DNA polymerase III	894	X
6128	Structure of At3g01050.1, a ubiquitin-fold protein from Arabidopsis thaliana	1287	X
6129	Solution structure and backbone dynamics of the Cu(I) and apo-forms of the second metal-binding domain of the Menkes protein ATP7A	855	X
6130	Solution structure and backbone dynamics of the Cu(I) and apo-forms of the second metal-binding domain of the Menkes protein ATP7A	921	X
6131	Solution structure of oxidized bovine microsomal cytochrome B5 Mutant V45H	462	X
6132	Letter to the Editor: 1H, 13C and 15N NMR assignment of the homodimeric poplar phloem peroxiredoxin	1650	X
6133	1H, 13C, and 15N Chemical Shift Assignments for YojN-HPt	1429	X
6134	THE NMR STRUCTURE OF A STABLE AND COMPACT ALL-beta-SHEET VARIANT OF INTESTINAL FATTY ACID-BINDING PROTEIN	1091	X
6135	Solution structure of conotoxin MrVIB	174	X
6136	Backbone Resonance Assignment of the L-Arabinose Binding Protein in Complex with D-Galactose	1358	X
6137	NMR solution structure of proBnIb of 2S albumin stortage proton from Brassica napus	674	X
6138	Hypothetical protein At2g24940.1 from Arabidopsis thaliana has a cytochrome b5 like fold	1119	X
6139	Solution Structure of Ole e 6, an allergen from olive tree pollen	666	X
6140	1H, 13C and 15N backbone assignment of a 32 kDa hypothetical protein from Arabidopsis thaliana, At3g16450.1	1703	X
6141	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Cyclophilin D	697	X
6142	1H 13C and 15N resonance assignments for peptide deformylase-actinonin complex	1459	X
6143	1H and 15N assignments for human apolipoprotein C-II in DPC micelles	339	X
6144	The pyrophosphate cage: the structure of the nisin/lipid II complex provides a blueprint for novel antibiotics	305	X
6145	The pyrophosphate cage: the structure of the nisin/lipid II complex provides a blueprint for novel antibiotics	64	X
6146	The pyrophosphate cage: the structure of the nisin/lipid II complex provides a blueprint for novel antibiotics	373	X
6147	1H, 15N, and 13C chemical shift assignments of the Vibrio Harveyi histidine phosphotransferase protein LuxU	1250	X
6148	Resonance Assignments and Secondary Structure of hPrxVI, a 25 kDa 1-Cys Human Peroxiredoxin Enzyme	2166	X
6149	1H, 15N and 13C resonance assignments of complement control protein module pair 2-3 from the C4b-binding site of complement receptor type 1	1513	X
6150	1H, 15N and 13C resonance assignments of the Apo Sm14-M20(C62V) protein from Schistosoma mansoni	1439	X
6151	Structure of Transportan in phospholipid bicellar solution	201	X
6152	Solution structure of TIP-B1	1105	X
6154	1H Assigned Chemical Shifts for FMBP-1 tandem repeat 3	166	X
6155	1H Assigned Chemical Shifts for FMBP-1 tandem repeat 4	161	X
6156	1H Assigned Chemical Shifts for FMBP-1 tandem repeat 1 in 30% (v/v) TFE and water solution	296	X
6157	1H Assigned Chemical Shifts for FMBP-1 tandem repeat 2	167	X
6158	NMR solution structure of human Saposin C in the presence of detergent micelles	1001	X
6159	1H, 13C and 15N resonance assignments of Ca2+-free DdCAD-1, a cell-cell adhesion molecule	2204	X
6160	Structural and biochemical evidence for disulfide bond heterogeneity in active forms of the somatomedin B domain of human vitronectin	357	X
6161	Full 1H, 13C and 15N Chemical Shift Assignments for the GI Domain of the yeast Linker Histone, Hho1p	1090	X
6162	Full 1H, 13C and 15N Chemical Shift Assignments for the GII Domain of the yeast Linker Histone, Hho1p	1008	X
6163	Backbone 1H, 13C, 15N assignment of the bHLHZip domain of the oncogenic transcription factor v-myc in complex with its authentic binding partner max	271	X
6165	Solution structure of the PSI domain from the Met receptor	252	X
6166	Solution structure of the second complement control protein (CCP) module of the GABA(B)R1a receptor, Pro-119 cis conformer	761	X
6167	Structural studies on the Ca-binding domain of human nucleobindin (CALNUC)	1152	X
6168	Structures of antimicrobial hexapeptides bound to DPC micelles	52	X
6169	Structures of antimicrobial hexapeptides bound to DPC micelles	52	X
6170	Structures of antimicrobial hexapeptides bound to DPC micelles	51	X
6171	Solution structure of the second complement control protein (CCP) module of the GABA(B)R1a receptor, Pro-119 trans conformer	761	X
6172	Solution structure of a cyanobacterial copper metallochaperone, ScAtx1	477	X
6173	PfR48 final project	1145	X
6174	Backbone and sidechain 1H, 13C and 15N chemical shift assignments of the ThKaiA180C-CIIABD complex	1606	X
6175	1H, 13C, and 15N assignments for the first TSR domain of F-spondin	687	X
6176	Solution structure of a ubiquitin-like domain of tubulin-folding cofactor B	1398	X
6177	N-terminal Domain of the Polypyrimidine Tract Binding Protein Contains a New RRM Variant That Contributes to High-Affinity RNA Binding	1380	X
6178	N-terminal Domain of the Polypyrimidine Tract Binding Protein Contains a New RRM Variant That Contributes to High-Affinity RNA Binding	1159	X
6179	Solution Structure of the structured part of the 15th domain of LEKTI	409	X
6180	Solution structure of the 15th domain of LEKTI	502	X
6181	Resonance Assignments for the Endosomal Adaptor Protein P14	1132	X
6182	Backbone assignments and 15N spin-relaxation rates of Holo-FluA(R95K)	862	X
6183	Backbone 1H, 13C, and 15N Chemical Shift Assignments for cAMP-dependent protein kinase	961	X
6184	Model for the Catalytic Domain of the Proofreading Epsilon Subunit of E.coli DNA Polymerase III Based on NMR Structural Data	1052	X
6185	Solution structure of P22 Cro	721	X
6186	Structure of DNA sequence d-TGATCA by two-dimensional nuclear magnetic resonance spec and restrained molecular dynamics	47		X
6187	BACKBONE SOLUTION STRUCTURE OF MIXED ALPHA/BETA PROTEIN PF1061	276	X
6188	Solution structure of Acyl Coenzyme A Binding Protein from yeast	833	X
6189	Solution structure of SEP domain from human p47	1026	X
6190	Solution Structure of apoCox11	1344	X
6191	Structure of the C-Terminal Domain of the SecA ATPase	140	X
6192	1H, 13C, and 15N Chemical Shift Assignments for Omega-atracotoxin-Hv1a at pH 3.6	377	X
6193	1H, 13C, 15N PSD-95 PDZ3 NMR Assignments, pH 7, 20C	1026	X
6194	1H, 13C, and 15N Chemical Shift Assignments for Omega-atracotoxin-Hv1a at pH 6.0	388	X
6195	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Arath;CDC25; a dual-specificity tyrosine phosphatase from Arabidopsis thaliana	1146	X
6196	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Arath;CDC25; a dual-specificity tyrosine phosphatase from Arabidopsis thaliana	1095	X
6197	1H, 15N and 13C assigned chemical shifts for the Myosin type I SH3 domain (Myo3) from saccharomyces cerevisiae	804	X
6198	Backbone 1H, 13C, and 15N Chemical Shift Assignments for TM1816	1281	X
6199	Backbone and side chain 1H, 13C, and 15N chemical shift assignments for 5,10-methenyltetrahydrofolate synthetase	2042	X
6200	Assignment of the minicollagen 1 cysteine rich domain	264	X
6201	Sequence specific 1H and 15N resonance assignment of domain 1 of rat CD2 with the designed calcium binding site	1274	X
6202	Assignment of the 1H, 15N and 13C resonances of the Class II E2 Conjugating Enzyme, Ubc1	2301	X
6203	1H chemical shift assignments for ThrB12-DKP-insulin	329	X
6204	1H chemical shift assignments for AlaB12-DKP-insulin	654	X
6205	1H chemical shift assignments for AbaB12-DKP-insulin	327	X
6207	The NMR Solution structure of the NESGC taget protein EC0510	1193	X
6208	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Diacylglycerol kinase alpha	1376	X
6209	Solution Structure of a Calmodulin-Like Calcium-Binding Domain from Arabidopsis thaliana	725	X
6210	Backbone 1H, 13C, and 15N Chemical Shift Assignments for NESGC target hr2106	1180	X
6211	Chemical Shift Assignments for Carnobacteriocin B2 immunity protein	1330	X
6212	Solution structure of subunit F6 from the peripheral stalk region of ATP synthase from bovine heart mitochondria	906	X
6214	Signal assignments and chemical-shift structural analysis of uniformly 13C, 15N-labeled peptide, mastoparan-X, by multidimensional solid-state NMR under magic-angle spinning	95	X
6216	Solution structure of the third zinc finger domain of FOG-1	220	X
6219	Antibiotic Activity and Structural Analysis of a Scorpion-derived Antimicrobial peptide IsCT and Its Analogs	89	X
6220	Antibiotic Activity and Structural Analysis of a Scorpion-derived Antimicrobial peptide IsCT and Its Analogs	87	X
6221	Backbone 1H, 13C, and 15N Chemical Shift Assignments of the Resuscitation Promoting Factor (Rpf) domain of M. tuberculosis	1101	X
6222	Solution Structure of Kurtoxin	432	X
6223	Sequential resonance assignment of yeast cytosine deaminase in complex with a transition state analogue	877	X
6224	Assignment of the 1H, 15N and 13C resonances of SufA from E. coli	1119	X
6225	1H, 15N, and 13C Resonance Assignment of the Amino-terminal Domain of Tfb1 subunit of yeast TFIIH	1428	X
6226	1H, 13C, and 15N Chemical Shift Assignments for the C-terminal domain of EW29	1635	X
6227	Native and non-native conformational preferences in the urea-unfolded state of barstar	435	X
6228	The Solution Structure of the FATC Domain of the Protein Kinase TOR Suggest a Redox Regulatory Mechanism	438	X
6229	Backbone 1H, 13C, and 15N Chemical Shift assignments for the Nucleotide-binding domain of Thermus Thermophilus DnaK	1669	X
6230	1H Chemical Shift Assignments for the cyanomet complex of the isolated, tetrameric beta-chain from human adult hemoglobin	966	X
6231	1H, 13C and 15N resonance assignments and secondary structure of human pancreatitis-associated protein (hPAP)	1549	X
6232	TM1442-PO4	476	X
6233	(poly)ubiquitin-binding region of S5a	1170	X
6234	Chemical shifts of PagP in CYFOS-7 detergent	466	X
6235	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the SNARE complex	708	X
6236	Backbone 1H, 13C, and 15N Chemical Shift Assignments for CAPPD*, an Independently Folded Extracellular Domain of Human Amyloid-beta Precursor Protein	1571	X
6237	Solution Structure of alpha-Conotoxin OmIA	89	X
6238	Complete 1H, 15N amd 13C Chemical Shift Assignments of the murine CBP ZZ domain (a.a. 1700-1751)	631	X
6239	Chemical shifts assignments for stem-loop VI of the VS ribozyme.	323			X
6240	Solution structure of At5g66040, a putative protein from Arabidopsis Thaliana	1133	X
6241	Assignment of the 1H, 13C, and 15N resonances of the josephin domain of ataxin-3	2350	X
6242	1H, 13C and 15N sequence-specific resonance assignments of the two-domain Thrombin inhibitor Dipetalin	1040	X
6244	Novel all alpha-helical fold for gene target gi3844938 from Mycoplasma genitalium	1501	X
6245	Solution Structure of GIP(1-30)amide in TFE/Water	97	X
6246	Structural transitions as determinants of the action of the calcium-dependent antibiotic daptomycin	67	X
6247	Solution structure of C-terminal domain of NifU-like protein from Oryza sativa	971	X
6248	NMR Structure of a Complex Between MDM2 and a Small Molecule Inhibitor	1247	X
6249	Backbone 1H, 13C, and 15N Chemical Shift Assignments for BD37	1664	X
6250	Backbone Chemical Shift Assignments for G88W121 fragment of Staphylococcal Nuclease	590	X
6251	Backbone Chemical Shift Assignments for V66W121 fragment of Staphylococcal Nuclease	418	X
6252	1H, 13C, 15N Resonance Assignments of the EscJ Protein, a Structural Component of the Type III Secretion System of Enteropathogenic E. coli (EPEC)	882	X
6253	1H, 13C and 15N resonance assignment of human gamma S-crystallin, a 21-kDa eye-lens protein	2013	X
6254	1H, 13C, and 15N Chemical Shift Assignments for I14A mutant of histidine-containing phosphocarrier protein from Staphylococcus carnosus	960	X
6255	Chemical Shift Assignments of Ribosomal Protein L16 from Thermus thermophilus HB8	1718	X
6256	Chemical Shift Assignments of TM1509	1828	X
6257	Alzheimer's Abeta40 Studied by NMR at Low pH Reveals That DSS Binds and Promotes beta-ball Oligomerization	376	X
6258	Backbone 1H, 13C, 15N and Cb chemical shift assignments for TolAIII in complex with g3pN1	385	X
6259	1H, 13C, and 15N chemical shift assignments for GatB (backbone + side chains)	1125	X
6260	NMR solution Structure of a Highly Stable de novo Heterodimeric Coiled-Coil	282	X
6261	NMR STRUCTURE OF THE SH3 DOMAIN OF HUMAN LYN TYROSINE KINASE	837	X
6262	NMR structure of WW domains (WW3-4) from Suppressor of Deltex	467	X
6263	Solution Structure of a Loop Truncated Mutant from D. gigas Rubredoxin, NMR	219	X
6264	Solution structure of cryptdin-4, the most potent alpha-defensin from mouse Paneth cells	233	X
6265	Structure and Biochemical Function of a Prototypical Arabidopsis U-box Domain	817	X
6266	Solution structure of Cu(I) HAH1	486	X
6267	1H, 13C and 15N resonance assignments of the phosphorylated enzyme IIB (C31S) of the mannitol-specific phosphoenolpyruvate-dependent phosphotransferase system of Escherichia coli	1310	X
6268	CBP TAZ1 Domain	941	X
6269	1H, 13C, and 15N Chemical Shift Assignments for chPrP(128-242)	1294	X
6270	1H, 13C, and 15N Chemical Shift Assignments for chPrP(25-242)	718	X
6271	1H, 13C and 15N assignments of the ligand binding domain of LasR	817	X
6272	NMR ASSIGNMENT OF MTH0776 FROM METHANOBACTERIUM THERMOAUTOTROPHICUM STRAIN H	1402	X
6273	1H and 31P chemical shift assignments for the triloop DNA hairpin 5'- GTTCACAGAAC - 3'	111		X
6274	1H chemical shift assignments for the triloop DNA hairpin 5'- GTACACAGTAC - 3'	101		X
6275	1H, 13C and 15N resonance assignments for the six-zinc finger domain of the MTF-1 metalloregulatory protein in the free state	1949	X
6276	1H, 13C and 15N resonance assignments for the six-zinc finger domain of the MTF-1 metalloregulatory protein in the DNA bound state	769	X	X
6277	NMR solution structure of the ubiquitin conjugating enzyme UbcH5B	1563	X
6278	Backbone 1H, 13C, and 15N Chemical Shift Assignments for yeast Sed5p	567	X
6279	1H, 13C and 15N resonance assignments and secondary structure of the murine angiogenin 4	1316	X
6280	Resonance assignment of the double-stranded RNA-binding domains of adenosine deaminase acting on RNA	2107	X
6281	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Complexin/SNARE complex	455	X
6282	NMR assignment of the turtle prion protein fragments tPrP(121-225)	1134	X
6283	1H and 15N Chemical Shift Assignments for CLP	1150	X
6284	1H, 13C, and 15N Chemical Shift Assignments for DnaG-C	2335	X
6285	15N, 13C, 1H NMR assignment of a 14kDa construct of the focal adhesion protein Talin	1525	X
6286	1H and 15N assignment of SMRT DAD	476	X
6287	Diversity in structure and function of the Ets family pointed domains	1163	X
6288	SOLUTION NMR STRUCTURE OF NTX-1, A LONG NEUROTOXIN FROM THE VENOM OF THE ASIAN COBRA, 20 STRUCTURES	428	X
6289	NMR Structure of the Free Zinc Binding C-terminal Domain of SecA	186	X
6290	Solution Structure of Cu6Metallothionein from the fungus Neurospora crassa	95	X
6291	Assignment of hypothetical membrane protein ta0354_69_121	591	X
6292	1H, 15N and 13C sidechain and backbone assignments of the alkaline proteinase inhibitor APRin from Pseudomonas aeruginosa	1123	X
6293	1H Assigned Chemical Shifts for FMBP-1 tandem repeat 2 in 30% (v/v) TFE solution	164	X
6294	1H Assigned Chemical Shifts for FMBP-1 tandem repeat 4 in 30% (v/v) TFE solution	163	X
6295	NMR Structure of the Flavin Domain from Soluble Methane Monooxygenase Reductase from Methylococcus capsulatus (Bath)	2550	X
6296	1H Assigned Chemical Shifts for FMBP-1 tandem repeat 3 in 30% (v/v) TFE solution	166	X
6297	Solution structure of the RWD domain of the mouse GCN2 protein	1642	X
6298	NMR STRUCTURE OF HUMAN HISTONE CHAPERONE, ASF1A	1925	X
6299	Structure of a Chordin-like Cysteine-rich Repeat (VWC module) from Collagen IIA	656	X
6300	Solution structure of rat Kalirin N-terminal SH3 domain	894	X
6301	NMR solution structure of a designed heterodimeric leucine zipper	539	X
6302	Solution structure of a diiron protein model: Due DF2-TURN_MUTANTturn mutant	402	X
6303	Solution structure of a diiron protein model	363	X
6304	Amide chemical shifts of mature human SUMO-1	186	X
6305	Mainchain proton, carbon and nitrogen chemical shifts for the C-domain of human RanGAP1	763	X
6306	Mainchain proton and nitrogen chemical shifts for the C-domain of human RanGAP1 linked via an isopeptide at Lys524 to Gly97 of human Sumo-1	310	X
6307	The Solution Structure of d(G3T4G4)2	178		X
6308	Structure of the domain a of the glycoprotein chaperone ERp57	1150	X
6309	1H, 13C, and 15N Chemical Shift Assignments for domain III of the omsk hemorrhagic fever envelope protein	1076	X
6310	1H,13C ans 15N assigned chemical shifts and secondary structures for hPPIL1 (peptidylprolyl isomerase -like 1)	1684	X
6311	Sequence-specific backbone 1H, 13C and 15N assignments of the 25 kDa SPRY domain-containing SOCS box protein 2 (SSB-2)	945	X
6312	Solution Structure of Fasciclin-Like Protein From Rhodobacter sphaeroides	1582	X
6313	1H,13C,and 15N NMR assignments of the Bombyx mori Pheromone-binding Protein fragment BmPBP(1-128) at pH 6.5.	1602	X
6314	NMR assignment for cold-shock protein ribosome-binding factor A (RbfA) from Thermotoga maritima	1132	X
6315	1H, 13C and 15N chemical shift assignments for TcUBP1 (GQ) (backbone + side chains)	1366	X
6317	1H, 15N and 13C resonance assigment of the transcription factor CylR2 from Enterococcus faecalis	922	X
6318	Solution structure of thioredoxin h1 from Arabidopsis thaliana	1464	X
6319	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Nkx2.5 Homeodomain plus NK2 Specific Domain in the DNA Bound State	558	X	X
6320	1H, 13C, 15N chemical shift assignments for extended 3' internal stem-loop RNA from S. cerevisiae U6 snRNA	475			X
6321	Chemical Shift assignment of the Ground-State of Delta25-PYP	809	X
6322	Chemical Shift assignment of the blue shifted inetrmediate state of Delta25-PYP	771	X
6324	Solution structure of the hypothetical protein Tm0979 from Thermotoga maritima	962	X
6325	Assessment of the robustness of a serendipitous zinc-binding fold: mutagenesis and protein grafting	150	X
6326	Assessment of the robustness of a serendipitous zinc-binding fold: mutagenesis and protein grafting	148	X
6327	Assessment of the robustness of a serendipitous zinc-binding fold: mutagenesis and protein grafting	137	X
6328	Assessment of the robustness of a serendipitous zinc-binding fold: mutagenesis and protein grafting	134	X
6329	Assessment of the robustness of a serendipitous zinc-binding fold: mutagenesis and protein grafting	140	X
6330	Solution structure of human AP4A hydrolase	1810	X
6331	NMR assignment of the SH2 domain from the human feline sarcoma oncogene FES	1400	X
6332	1H, 13C and 15N resonance assignments of MLC (myosin light chain)from Saccharomyces cerevisiae	1829	X
6333	1H, 13C, and 15N chenical shift assignments for ABA-1A with oleic acid bound	1429	X
6334	1H, 13C, 15N backbone and sidechain resonance assignment of Mip(77-213) the PPIase domain of the Legionella pneumophila Mip protein	1595	X
6335	Near complete chemical shift assignments for the zinc-bound redox switch domain of the E. coli Hsp33	697	X
6336	Assignment of human AP4A hydrolase in complex with ATP	1896	X
6337	Solution Structure of Ubiquitin like protein from Mus musculus	1240	X
6338	NMR solution structure of At1g77540	987	X
6339	Solution structure of AT1g01470 from Arabidopsis Thaliana	1663	X
6340	Solution structure of AT3g03773 from Arabidopsis Thaliana	1673	X
6341	Solution structure of At3g04780.1, an Arabidopsis ortholog of the C-terminal domain of human thioredoxin-like protein	1785	X
6342	Backbone 1H, 13C, and 15N Chemical Shift Assignments for human survivin	1221	X
6343	Backbone and side chain 1H, 13C, and 15N chemical shift assignments of PA1324 (21-170): Northeast Structural Genomics Consortium Target PaP1	1714	X
6344	1H, 13C, and 15N Chemical Shift Assignments for human protein HSPCO34	1803	X
6345	Solution Structure of YKR049C	1369	X
6346	1H, 15N and 13C Resonance Assignments and Secondary Structure Determination Reveal that the Minimal Rac1 GTPase Binding Domain of Plexin-B1 Has a Ubiquitin Fold	1480	X
6347	Evidence for domain-specific recognition of SK and Kv channels by MTX and HsTx1 scorpion toxins	158	X
6348	13C, 15N solid state NMR chemical shift assignments for the intrinsic transmembrane light-harvesting 2 protein complex	391	X
6349	1H, 13C and 15N Chemical Shift Assignments for the LH1 Alfa Polypeptide of Rhodospirillum rubrum	407	X
6350	1H, 13C and 15N Chemical Shift Assignments for the LH1 Beta Polypeptide of Rhodospirillum rubrum	537	X
6351	13C, 15N solid-state NMR chemical shift assignments for Kaliotoxin	127	X
6352	Isolation and characterization of epilancin 15X, a novel lantibiotic from a clinical strain of Staphylococcus epidermidis	365	X
6353	1H, 15N and 13C resonance assignments of the BRCT Region of the large subunit of human Replication Factor C	1182	X	X
6354	1H, 13C and 15N resonance assignments and 15N-1H residual dipolar couplings for NECAP1 protein	1267	X
6355	Solution Structure Of The Staphylococcus Epidermis Protein SE0936. Northest Strucutral Genomics Consortium Target SeR8.	1003	X
6356	Yeast frataxin solution structure	1369	X
6357	Backbone Resonance Assignments of Wild-Type TEM-1 Beta-lactamase from E. coli	1223	X
6358	1H, 13C, and 15N Chemical Shift Assignments for a bacterial BolA-like protein XC975	879	X
6359	Assigned chemical shift for YGGX	1001	X
6360	IDENTIFICATION OF MINIMAL PEPTIDE SEQUENCE IN THE AMIDATED FRAGMENT 33-61 OF BOVINE a-HEMOGLBIN	124	X
6361	Resonance Assignments for the SAP domain of the human protein DEK	1266	X
6362	Solution structure of Iron-Sulfur cluster assembly protein IscU from Bacillus subtilis, with Zinc bound at the active site. Northeast Structural Genomics Consortium Target SR17	765	X
6363	1H, 13C, 15N Chemical Shift Assignment of Protein XCC2852, Northeast Structural Genomics Target Protein XcR50	869	X
6364	1H, 13C 15N chemical shift assignment of Pyrococcus furiosus Protein PF0470: The Northeast Structural Genomics Consortium Target PfR14	1320	X
6365	1H, 13C 15N chemical shift assignment of B. cereus protein BC4709, Northeast Structural Genomics Target Protein BcR68	1690	X
6366	1H, 13C, and 15N Chemical Shift Assignments of Bacillus subtilis Protein yqbG: The Northeast Structural Genomics Consortium Target SR215	1579	X
6367	1H, 13C, and 15N Chemical Shift Assignments of E.Coli Protein yhgG: The Northeast Structural Genomics Consortium Target ET95	934	X
6368	1H, 13C, and 15N Chemical Shift Assignments of Methanosarcina mazei Protein RPS24E: The Northeast Structural Genomics Consortium Target MaR11	1240	X
6369	1H, 13C 15N chemical shift assignment Bacillus halodurans Protein BH1534: The Northeast Structural Genomics Consortium Target BhR29	1637	X
6370	1H assignment of APETx1	236	X
6371	1H, 13C, and 15N resonance assignments of Sin3a associated polypeptide 18 (SAP-18)	1694	X
6372	1H and 15N Assigned Chemical Shifts for SARS N-Protein N-Terminate	1787	X
6373	1H, 13C and 15N backbone resonance assignments of LexA catalytic domain with the L89P/Q92W/D150H/E152A/K156A mutations	627	X
6374	NMR STRUCTURE OF THE FIRST PHD FINGER OF AUTOIMMUNE REGULATOR PROTEIN (AIRE1): INSIGHTS INTO APECED	911	X
6375	Full 1H, 13C, and 15N Chemical Shift Assignments for Escherichia coli TonB 151-239	1093	X
6376	Complete resonance assignment of the C-terminal domain from TgMIC1	1506	X
6377	Backbone 1H, 13C, and 15N Chemical Shift Assignments for feline prion protein	1230	X
6378	canine prion protein	1259	X
6379	Backbone HN, N, C', CA, CB assignments of Escherichia coli SdiA1-171	778	X
6380	1H, 13C, and 15N Chemical Shift Assignments for pig prion protein	1146	X
6381	NMR solution structures of mammalian prion proteins	1291	X
6382	1H, 13C, and 15N Chemical Shift Assignments for Xenopus prion protein.	1474	X
6383	NMR solution structure of the recombinant elk and mouse/elk variant prion proteins	1257	X
6384	Solution Structure of TACI_D2	465	X
6385	Backbone 1H, 13C, and 15N Chemical Shift Assignments for pleckstrin human DEP domain	1527	X
6386	Structural and Functional Study of Anemonia Elastase Inhibitor, a "Non-classical" Kazal-type Inhibitor from Anemonia sulcata	321	X
6387	Structural and Functional Study of Anemonia Elastase Inhibitor, a "Non-classical" Kazal-type Inhibitor from Anemonia sulcata	317	X
6388	NMR structure of the synthetic penaeidin 4	316	X
6389	Acting on the Number of Molecular Contacts between Maurotoxin and Kv1.2 Channel Impacts Ligand Affinity	208	X
6390	NMR assignment of the R-module from the Azotobacter vinelandii mannuronan C5-epimerase AlgE4	1661	X
6391	1H, 13C, and 15N chemical shift assignments for the catalytic domain of MMP-12	1812	X
6392	Refined solution structure of the human TSG-6 Link module	1192	X
6393	Refined solution structure of the human TSG-6 Link module	1221	X			X
6395	1H, 13C, and 15N Chemical Shift Assignments for the Cis and Trans Isomer of the Beta Domain of Bacillus stearothermophilus DivIB	2907	X
6396	Chemical shift Assignment for mouse Roadblock/LC7 domain BC029172	1150	X
6398	Sulfolobus Solfataricus Acylphosphatase 1H chemical shift assignment	646	X
6399	1H, 13C and 15N resonance assignments for the 24 kDa TPR domain in p67phox	1347	X
6400	1H, 13C, and 15N Chemical Shift Assignments for the Wild-Type Matrix Protein of Mason-Pfizer Monkey Virus (M-PMV)	1035	X
6401	NMR assignment of R55F mutant of Mason-Pfizer monkey virus matrix protein	939	X
6402	Solution structure of the carbon storage regulator CsrA from E. coli	445	X
6403	Ovine Prion Protein Variant R168	1292	X
6404	HN, N, CA, CB Chemical Shift Assignments for the CID domain of Pcf11	518	X
6405	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the first cadherin domain of Cadherin-related neuronal receptor(CNR)/ Protocadherin alpha	1046	X
6406	Backbone and side chain chemical shift assignments of a TRAV14-3 mouse T cell receptor domain	1369	X
6407	1H, 15N resonance assignment of the C-terminal domain of Human Papillomavirus Oncoprotein E6	591	X
6408	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Two C-terminal C2H2 Zinc Fingers (F5-6) of MTF-1	258	X
6409	Backbone 1H, 13C, and 15N and 13CB Chemical Shift Assignments for Four N-terminal C2H2 Zinc Fingers (F1-4) of MTF-1	537	X
6410	1H, 15N, and 13C resonance assignments of reduced form of poplar glutaredoxin CxxC1 from Populus tremula tremuloides	1458	X
6411	FRAGMENT 33-61 OF BOVINE alpha-HEMOGLBIN: THE EFFECT OF C-TERMINAL AMIDATION AND IDENTIFICATION OF THE MINIMAL PORTION WITH ANTIFUNGAL ACTIVITY	70	X
6412	FRAGMENT 33-61 OF BOVINE alpha-HEMOGLBIN: THE EFFECT OF C-TERMINAL AMIDATION AND IDENTIFICATION OF THE MINIMAL PORTION WITH ANTIFUNGAL ACTIVITY	83	X
6413	FRAGMENT 33-61 OF BOVINE alpha-HEMOGLBIN: THE EFFECT OF C-TERMINAL AMIDATION AND IDENTIFICATION OF THE MINIMAL PORTION WITH ANTIFUNGAL ACTIVITY	113	X
6414	FRAGMENT 33-61 OF BOVINE alpha-HEMOGLBIN: THE EFFECT OF C-TERMINAL AMIDATION AND IDENTIFICATION OF THE MINIMAL PORTION WITH ANTIFUNGAL ACTIVITY	115	X
6415	Three-disulfide variant of hen lysozyme: C30A/C115A	752	X
6416	Backbone 1H, 13C, and 15N assignments of a 56 kDa E. coli nickel binding protein NikA	2067	X
6418	Backbone 1H, 13C and 15N resonance assignments for the Mg2+-bound form of the Ca2+-binding photoprotein aequorin	898	X
6419	Structure of the C-terminal Domain from Trypanosoma brucei Variant Surface Glycoprotein MITat1.2	743	X
6420	Daptomycin NMR Structure	62	X
6421	Solution structure of sst1-selective somatostatin (SRIF) (analog 5)	74	X
6422	NMR strcutre of sst1-selective somatostatin (SRIF) analog 1	76	X
6423	NMR strcutre of sst1-selective somatostatin (SRIF) analog 1	82	X
6424	NMR strcutre of sst1-selective somatostatin (SRIF) analog 1	69	X
6425	NMR strcutre of sst1-selective somatostatin (SRIF) analog 1	72	X
6426	NMR strcutre of sst1-selective somatostatin (SRIF) analog 1	72	X
6427	Solution structure of a recombinant type I sculpin antifreeze protein	660	X
6428	Probing the pH-dependent structural features of a-KTx12.1, a potassium channel blocker from the scorpion Tityus serrulatus	700	X
6429	Backbone 1H, 15N and 13C chemical shift assignments for human retinoid X receptor ligand-binding domain with and without 9-cis retinoic acid	996	X
6430	1H and 31P chemical shift assignments for HIV-1 integrase inhibitor 93del	163		X
6431	1H, 13C and 15N assignments for the II-III loop region of the skeletal dyhydropyridine receptor	1433	X
6432	NMR solution Structure of a partially diordered protein from Arabdopsis Thaliana At2g23090	807	X
6433	Sequence specific 1HN, 13C and 15N resonance assignments of a novel calcium binding protein from Entamoeba histolytica	1073	X
6434	Backbone and Sidechain Assignments of the Lambda Bacteriophage Tail Assembly Protein gpU	1537	X
6436	1H, 15N, and 13C resonance assignments of a natively unfolded protein XC4149 from the plant pathogen Xanthomonas campestris pv. campestris 17	966	X
6437	Structural origin of endotoxin neutralization and antimicrobial activity of a lactoferrin-based peptide	299	X
6438	Sequence-specific resonance assignments of the C-terminal, 137-residue pseudo-receiver domain of circadian input kinase (CikA) that resets the circadian clock in Synechococcus elongatus	1614	X
6439	Backbone 1H, 15N and 13C and side-chain 1H and 13C assignments of the rice phytochrome B PAS1 domain	1327	X
6440	1H, 15N and 13C backbone assignments of 28kD phytochrome B PAS1-PAS2 domain	1234	X
6441	Chemical shift assignments for human Orexin-A	300	X
6442	1H, 13C, and 15N sequence-specific resonance assignment and secondary structure of Plasmodium falciparum thioredoxin	1266	X
6443	Assignments of At5g01610, an Arabidopsis thaliana protein containign DUF583 domain	1354	X
6444	1H, 13C, and 15N Chemical Shift Assignments for MMP12	1384	X
6445	Backbone 1H, 13C, and 15N and 13CB Chemical Shift Assignments for Six C2H2 Zinc Fingers (F1-6) of MTF-1 in the DNA Bound State (22 bp)	820	X	X
6446	Structural and Functional Characterization of Transmembrane Segment IV of the NHE1 Isoform of the Na+/H+ Exchanger	242	X
6447	Solution structure of a two-repeat fragment of major vault protein	956	X
6448	Solution structure of the hypothetical protein ytfP from Escherichia coli. Northeast Structural Genomics target ER111.	1432	X
6449	Backbone 1H, 15N and 13C chemical shift assignments for human retinoid X receptor ligand-binding domain with and without 9-cis retinoic acid	640	X
6451	1H, 15N and 13C resonance assigment of the chaperone CesT from enteropathogenic Escherichia coli	748	X
6452	1H, 13C and 15N resonance assignments of the PDZ domain of CLP-36	973	X
6453	The solution structure of YggX from Escherichia coli	1056	X
6454	SdiA	1867	X
6455	1H, 13C, and 15N Chemical shift Assignments for crambin in acetone-water (3:1) mixed solvent	483	X
6456	NMR STRUCTURE OF THE SH3 DOMAIN OF HUMAN LYN TYROSINE KINASE	1047	X
6457	Validation of Protein Structure from Anisotropic Carbonyl Chemical Shifts in a Dilute Liquid Crystalline Phase	922	X
6458	Two-Dimensional 1H NMR Study of Human Ubiquitin	488	X
6459	Chemical Shift Assignment for Itch E3 WW3 domain	546	X
6460	NMR assignments of a low molecular weight phosphotyrosine phosphatase from Bacillus subtilis	1691	X
6462	The structure of a lactoferricinB derivative bound to micelles (LfcinB4-14)	83	X
6463	The structure of a lactoferricinB derivative bound to micelles	99	X
6464	Structure of the hypothetical Arabidopsis thaliana protein At1g16640.1	1083	X
6465	1H, 13C, and 15N chemical shift assignments for PAL	1471	X
6466	Internal Dynamics of Human Ubiquitin Revealed by 13C-Relaxation Studies of Randomly Fractionally Labeled Protein	928	X
6467	Solution structure of APETx2, a specific peptide inhibitor of ASIC3 proton-gated channels	217	X
6468	1H, 13C and 15N backbone resonance assignment of p38 mitogen-activated protein kinase	1122	X
6469	1H, 13C, and 15N Chemical Shift Assignments for the HMG-box domain in the SSRP1 subunit of FACT	920	X
6473	Structural and dynamic characteristics of the acid-unfolded state of hUBF HMG Box 1 provide clues for the early events in protien folding	578	X
6475	1H, 13C and 15N Chemical Shift assignments for Man5C-CBM35 from C. japonicus	1492	X
6476	Full 1H, 13C and 15N Chemical Shift Assignments for the GII loop mutant domain (GII-L) of the yeast linker histone, Hho1p	1127	X
6477	Solution structure of the P2b-P3 pseudoknot from human telomerase RNA	682			X
6478	The N-domain of the transcription factor AbrB	683	X
6479	The Structure of the Excisionase (Xis) Protein from Conjugative Transposon Tn916 Provides Insights into the Regulation of Heterobivalent Tyrosine Recombinases	845	X
6480	The loss of stability of a naturally occurring ATP7A mutant is the cause of Menkes disease	539	X
6481	The loss of stability of a naturally occurring ATP7A mutant is the cause of Menkes disease	523	X
6482	The loss of stability of a naturally occurring ATP7A mutant is the cause of Menkes disease	546	X
6483	The loss of stability of a naturally occurring ATP7A mutant is the cause of Menkes disease	522	X
6484	Backbone 1H, 13C, and 15N Chemical Shift Assignments for S100A13	1213	X
6485	A novel RNA pentaloop fold involved in targeting ADAR2	405			X
6489	Chemical shift assignments for subunit c of the F1Fo ATP Synthase from Bacillus PS3	881	X
6493	Assignment of the 1H, 13C, and 15N resonances of URNdesign, a computationally redisgned RRM protein	1264	X
6494	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Chorismate Mutase	717	X
6495	Backbone 1H, 13C, and 15N Chemical Shift Assignments and relaxation data for Chorismate Mutase from Bacillus subtilis in complex with inhibitor	583	X
6496	Backbone 1H and 15N Chemical Shift Assignments for Chorismate Mutase from Bacillus subtilis in complex with prephenate	338	X
6498	Backbone and side-chain 1H, 13C, and 15N Chemical Shift Assignments for SIP (1-77)	973	X
6499	NMR structure of antimicrobial peptide distinctin in water	413	X
6500	Backbone 1H, 13C, and 15N Chemical Shift Assignments for SIP (74-178)	465	X
6501	Backbone 1H, 15N, 13Ca and sidechain 13Cb chemical shift assignments of SARS-CoV Nsp9	383	X
6502	DNA binding domain in XPF/ERCC-1 complex	1879	X
6503	1H, 13C, and 15N complete chemical shift assignments for the apo v-Src SH2 domain	1278	X
6504	1H, 13C, and 15N Chemical shift Assignments for crambin in DPC micelles	489	X
6505	Solution Structure of the Conserved Protein from the Gene Locus Mm1357 of Methanosarcina Mazei. Northeast Structural Genomics Target Mar30	850	X
6506	Conkunitzin-S1 is the first member of a new Kunitz-type neurotoxin family - Structural and functional characterization	566	X
6507	Complex structure of PCAF bromodomain with small chemical ligand NP2	1261	X
6508	complex structure of PCAF bromodomain with small chemical ligand NP1	1273	X
6509	Solution Structure of the ScYLV P1-P2 Frameshifting Pseudoknot	604			X
6510	Structure and inter-domain interactions of domain II from the blood stage malarial protein, apical membrane antigen 1	1325	X
6511	NMR structure of peptide SD	58	X
6512	1H, 15N, and 13C resonance assignments of Vaccinia Virus Envelope protein, A27L	1175	X
6513	NMR Structure of the nonstructural Protein 7 (nsP7) from the SARS Corona Virus	902	X
6514	1H, 13C, and 15N Chemical Shift Assignments for Psuedomonas Aeruginosa protein PA4608	1389	X
6515	Chemical Shift Assignments for At2g46140.1	1739	X
6516	NMR assignment of the holo-acyl carrier protein (PfACP) from malaria parasite Plasmodium falciparum	1035	X
6517	NMR structure of P. aeruginosa protein PA4738: Northeast Structural Genomics Consortium target PaP2	786	X
6518	H,C,N chemical shift assignments for Allochromatium DsrC: Northeast Structural Genomics Consortium target OP4	1361	X
6519	Chemical shift assignments of Calsensin	763	X
6520	1H, 15N Chemical shift assignments for recombinant elicitor protein PcF from the oomycete pathogen P. cactorum	370	X
6521	Characterization of an amyloid fibril intermediate	300	X
6522	Characterization of an amyloid fibril intermediate	295	X
6524	ApoE N-terminal domain	698	X
6525	Backbone 1H Chemical Shift Assignments for Mungbean Defensin, VrD1	281	X
6526	Solution structure of the KH-QUA2 region of the Xenopus STAR/GSG Quaking protein.	1221	X
6527	1H, 13C and 15N Chemical Shift Assignments for km23 dimer	1248	X
6528	1H, 15N and 13C Assignments for the R2 Domain of Choline Binding Protein A (CbpA)	1544	X
6529	Assignment of 1H, 13C and 15N resonances of the 2S albumin Ber e 1 from Brazilian nut	1369	X
6530	CC45, An Artificial WW Domain Designed Using Statistical Coupling Analysis	304	X
6531	Solution structure of Calcium-S100A13 (minimized mean structure)	1137	X
6532	Solution structure of apo-S100A13	970	X
6533	1H, 13C, and 15N Chemical Shift Assignments for the DNA binding domain of STPA from E. coli	555	X
6535	'Backbone 1H and 15N Chemical Shift Assignments for T antigen origin binding domain in the presence of RPA32C'	444	X
6536	1H,15N,13C backbone and sidechain assignment for human ADAP hSH3-1 domain in reduced form	803	X
6537	Small Molecule Ligand Induces Nucleotide Flipping in (CAG)n Trinucleotide Repeats	164		X
6538	1H, 13C, and 15N Chemical Shift Assignments for 2B4	1176	X
6539	1H,15N,13C backbone and sidechain assignment for human ADAP hSH3-1 domain in oxidized form	783	X
6540	Sequence-specific 1H, 13C and 15N resonance assignments of the winged-helix domain of the human Werner syndrome protein	1535	X
6541	1H, 13C and 15N chemical shift assignments for stereo array isotope labeled (SAIL) calmodulin	1500	X
6542	Main Chain 1H, 13C, and 15N chemical shift assignments for arginine kinase	1318	X
6543	HIV-1 frameshift inducing element RNA	423			X
6546	1H, 13C, and 15N Chemical Shift Assignments for Human Protein CGI-126(HSPC155): the Northeast Structural Genomics Consortium Target HR41	2007	X
6547	structure-function relationships of the polyhistidine-rich peptide LAH4 in micellar environments; pH dependent mode of antibiotic action & DNA transfection	338	X
6549	Sequential Backbone Assignment and Secondary Structure of Peroxisome Proliferator-Activated Receptor g Ligand Binding Domain	1142	X
6551	Solution structure of the C-terminal domain of ERCC1 complexed with the C-terminal domain of XPF	1924	X
6552	A Protein Folding Pathway with Multiple Folding Intermediates at Atomic Resolution	1113	X
6553	Specific non-native hydrophobic interactions in a hidden folding intermediate: implication for protein folding	1100	X
6554	Experimental evidence for a reversible alfa to beta transition of Abeta-(1-42) in aqueous media: a step by step conformational analysis pinpoints the location of the beta conformation seeding	284	X
6555	Solution structure of YBL071w-A from Saccharomyces cerevisiae	838	X
6556	Solution structure of 1-26 fragment of human programmed cell death 5 protein	218	X
6557	Solution Conformation of adr subtype HBV Pre-S2 Epitope	152	X
6558	Structure of the FBP11WW1 domain	568	X
6559	Structure of the FBP11WW1 domain complexed to the peptide APPTPPPLPP	647	X
6560	The NMR solution structure of a redesigned apocytochrome b562:Rd-apocyt b562	1154	X
6561	NMR structure of plantaricin a in dpc micelles, 20 structures	179	X
6562	A novel cGUUAg tetraloop structure with a conserved yYNMGg-type backbone conformation from cloverleaf 1 of bovine enterovirus 1 RNA	568			X
6563	Backbone 1H, 13C, and 15N Chemical Shift Assignments for oxidized ArsC	1621	X
6564	Chemical Shift Assignment for OSCP-NT (1-120)	1417	X
6565	Assignment of 1H, 13C and 15N resonances of barnacle cement protein Mrcp-20k	1699	X
6566	Measles virus N protein (amino acids 477-505)	292	X
6567	Measles virus N protein (amino acids 477-505) bound to the Measles virus P protein (amino acids 457-507).	262	X
6568	Measles virus P protein (amino acids 457-407)	97	X
6569	Measles virus P protein (amino acids 457-507) bound to the Measles virus N protein (amino acids 477-505)	98	X
6570	NMR Assignments of the F-actin binding domain of human Bcr-Abl/c-Abl	1399	X
6571	Chemical Shift Assignments for the theta subunit of DNA polymerase III from E. coli	736	X
6572	Backbone Amide Assignments of the Cytochrome c3 in Fully Oxidized State from D. vulgaris Miyazaki F	202	X
6573	NMR Structure of VPS4A MIT Domain	1402	X
6574	MrR5	856	X
6575	Backbone and side-chain chemical shift assignments for Human Nck2 SH2 domain	979	X
6576	Backbone and sidechain 1H assignments of Crotamine	510	X
6577	Solution structure of the C1-subdomain of Bacillus stearothermophilus translation initiation factor IF2	1230	X
6578	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Bcl-xl/Bad BH3 peptide complex	1777	X
6579	A structural Model for the Membrane-Bound Form of the Juxtamembrane Domain of the Epidermal Growth Factor Receptor	677	X
6580	assignment of mouse socs3 by NMR	1379	X
6581	Sequence-specific 1H, 13C and 15N resonance assignments of hemopoietic cell kinase SH3 domains in complex with a synthetic peptide	1033	X
6582	Sequential resonance assignment of the human BMP type II receptor extracellular domain	1293	X
6583	1H, 13C, and 15N NMR Sequence-specific Resonance Assignments for Rat Ca2+-S100A1	966	X
6584	Backbone assignment of the E2 ubiquitin conjugating enzyme UbcH5alpha	546	X
6585	Resonance assignment of the At1g24000.1 protein from Arabidopsis Thaliana	1222	X
6586	1H, 13C and 15N backbone resonance assignment of the Hsp90 binding domain of human Cdc37	980	X
6587	1H, 13C and 15N backbone resonance assignments of apolipoprotein A-I in lipid-mimetic solution	1147	X
6588	1H, 13C and 15N backbone resonance assignments of apolipoprotein A-I(1-186) in ipid-mimetic solution	867	X
6589	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Chromo Domain of cpSRP43	388	X
6590	1H, 13C, and 15N Chemical Shifts Assignments for Human Sulfiredoxin (srx)	1339	X
6591	On the Importance of Carbohydrate-Aromatic Interactions for the Molecular Recognition of Chitooligosaccharides by Hevein Domains. NMR Studies of the Structure and Binding Affinity of AcAMP2-Like Peptides with non Natural Napthyl and Fluoroaromatic Residues	148	X
6592	Chromo 2 domain of cpSRP43	382	X
6593	Chromo 3 domain of cpSRP43	316	X
6594	Elucidation of the high-resolution solution structure of a trypanosomatid FYVE domain	902	X
6596	NMR solution structure of a leaf-specific-expressed cyclotide vhl-1	200	X
6597	Human ARNT C-terminal PAS domain	1540	X
6598	Mouse Doppel 1-30 peptide	75	X
6599	Solution Structure of Bacillus subtilis s-BCCP holo-form	920	X
6600	Solution Structure of Bacillus subtilis s-BCCP apo-form	935	X
6601	1H, 13C, and 15N chemical shift assignments for B. subtilis PrsA PPIase	1145	X
6602	1H, 13C, and 15N Chemical Shift Assignments for the GAF A Domain of Phosphodiesterase 5	597	X
6603	NMR assignments of a thioredoxin-like protein ykuV from Bacillus subtilis	1711	X
6604	1H, 13C, and 15N complete chemical shift assignments for v-Src SH2 domain complexed with PQpYEEIPI ligand.	1348	X
6605	E. Coli Ada in a complex with DNA	1273	X	X
6606	backbone and side chain assignment for RPA70A from S.cerevisiae	1178	X
6607	1H, 13C and 15N resonance assignments of AT-Rich Interaction Domain (ARID) of Jumonji	1415	X
6608	Proton assignments for PV5	125	X
6609	Solution structure of the ubiquitin-like domain of human DC-UBP from dendritic cells	610	X
6610	apg8a.title	565	X
6611	1H, 13C, and 15N chemical shift assignments for the receiver domain (residues 1-121) of NtrC4 from Aquifex aeolicus	1215	X
6612	NMR structure of unliagnded MDM2	1142	X
6613	Structure and dynamics of coxsackievirus B4 2A proteinase, an enzyme involved in the aetiology of heart disease	1546	X
6615	Backbone 1H, 13C, and 15N Chemical Shift Assignments for SSD domain of Bacillus subtilis Lon protease	1481	X
6616	1H chemical shift assignments for peptide P5	162	X
6617	Backbone 1H,15N assignment of the C-terminal haemopexin-like domain of matrix metalloproteinase MMP-13 (collagenase-3)	736	X
6618	1H chemical shift assignments for peptide P6	201	X
6619	1H chemical shift assignments for peptide P7	153	X
6620	1H, 13C, and 15N Chemical Shift Assignments for murine p22HBP	1563	X
6621	1H, 15N, and 13C Resonance Assignments of Human Interleukin-2	1558	X
6622	Backbone 1H, 13C, and 15N Chemical Shift Assignments for HEWL-SMe	874	X
6623	Chemical Shift Assignments for Proinsulin C-Peptide	602	X
6624	Backbone 1H, 13C, and 15N Resonance Assignments for the 13kD Ras Association Domain 1 (RA1) from Phospholipase C (epsilon)	1128	X
6625	1H, 13C and 15N assignments of a New Phosphohistidine Phosphatase Protein PHPT1 from Homo sapiens	1293	X
6626	'Complete 1H, 13C, and 15N Chemical Shift Assignments for plant Tom20 mitochondrial import receptor cytosolic domain (isoform 3) from Arabidopsis thaliana'	1818	X
6627	Structure of cyclotide Kalata B1 in DPC micelles solution	414	X
6628	Specificity and Mechanism of the Histone Methyltransferase Pr-Set7	776	X
6629	Solution Structure of the type 1 pilus assembly platform FimD(25-139)	1235	X
6631	Solution structure of a human ubiquitin-like domain in SF3A1	1043	X
6633	Structure of the RNA signal essential for translational frameshifting in HIV-1	642			X
6634	Chemical shift assignments for the K45Q-mutated ferricytochrome c3 from Desulfovibrio vulgaris Hildenborough	581	X
6635	Backbone 1H, 13C, and 15N Resonance Assignments for the 13kD Ras Association Domain 2 (RA2) from Phospholipase C (epsilon)	1279	X
6636	NMR Structure of PcFK1	229	X
6637	On the Importance of Carbohydrate-Aromatic Interactions for the Molecular Recognition of Chitooligosaccharides by Hevein Domains. NMR Studies of the Structure and Binding Affinity of AcAMP2-Like Peptides with non Natural Napthyl and Fluoroaromatic Residues	160	X
6638	1H, 15N, and 13C assignments of N-terminal domain of Epstein-Barr Virus Latent Membrane Protein 2A	923	X
6639	On the Importance of Carbohydrate-Aromatic Interactions for the Molecular Recognition of Chitooligosaccharides by Hevein Domains. NMR Studies of the Structure and Binding Affinity of AcAMP2-Like Peptides with non Natural Napthyl and Fluoroaromatic Residues	152	X
6640	1H, 13C, and 15N Chemical Shift Assignments for JHP1348	1208	X
6642	Backbone 1H, 13C and 15N Chemical Shift Assignments for apo chicken liver bile acid binding protein	552	X
6643	Solution structure of human prolactin	1941	X
6644	1H, 13C, and 15N NMR assignments for AlgH, a putative transcriptional regulator from Pseudomonas aeruginosa	2279	X
6645	1H, 13C and 15N backbone and side chain resonance assignments of Haloferax volcanii DHFR1	1694	X
6646	1H, 15N and 13C backbone assignment of the firefly luciferase C-terminal 14.3 kDa domain	721	X
6647	On the Importance of Carbohydrate-Aromatic Interactions for the Molecular Recognition of Chitooligosaccharides by Hevein Domains. NMR Studies of the Structure and Binding Affinity of AcAMP2-Like Peptides with non Natural Napthyl and Fluoroaromatic Residue	160	X
6648	Solution Structure of a Zap1 Zinc-Responsive Domain Provides Insights into Metalloregulatory Transcriptional Repression in Saccharomyces cerevisiae	757	X
6649	Solution structure of the peptidoglycan binding domain of B. subtilis cell wall lytic enzyme CwlC: Characterization of the sporulation-related repeats by NMR	728	X
6650	1H Chemical Shift Assignments for fragments of Sticholysin protein	182	X
6651	1H Chemical Shift Assignments for fragments of Sticholysin protein	143	X
6652	RNA helical packing in solution: NMR structure of a 30 kDa GAAA tetraloop receptor complex	350			X
6653	Solution Structure of a Zap1 Zinc-Responsive Domain Provides Insights into Metalloregulatory Transcriptional Repression in Saccharomyces cerevisiae	141	X
6654	Solution structure of Jingzhaotoxin-VII	201	X
6655	Solution Structure of the N-terminal Zinc Fingers of the Xenopus laevis double stranded RNA binding protein ZFa	1494	X
6656	On the Importance of Carbohydrate-Aromatic Interactions for the Molecular Recognition of Chitooligosaccharides by Hevein Domains. NMR Studies of the Structure and Binding Affinity of AcAMP2-Like Peptides with non Natural Napthyl and Fluoroaromatic Residues	148	X
6657	On the Importance of Carbohydrate-Aromatic Interactions for the Molecular Recognition of Chitooligosaccharides by Hevein Domains. NMR Studies of the Structure and Binding Affinity of AcAMP2-Like Peptides with non Natural Napthyl and Fluoroaromatic Residues	144	X
6658	NMR Solution Structure of a ldb1-LID:Lhx3-LIM complex	1983	X
6659	15N hyperfine shifts assignment for wild-type rubredoxin from Clostridium pasteurianum in the oxidized state	12	X
6660	15N hyperfine shifts assignment for rubredoxin (V8A) from Clostridium pasteurianum in the oxidized state	12	X
6661	15N hyperfine shifts assignment for rubredoxin (V8A) from Clostridium pasteurianum in the reduced state	12	X
6662	15N hyperfine shifts assignment for wild-type rubredoxin from Clostridium pasteurianum in the reduced state	12	X
6663	15N hyperfine shifts assignment for rubredoxin (V8G)from Clostridium pasteurianum in the oxidized state	12	X
6664	15N hyperfine shifts assignment for rubredoxin (V8G)from Clostridium pasteurianum in the reduced state	12	X
6665	15N hyperfine shifts assignment for rubredoxin (V8G/V44G) from Clostridium pasteurianum in the oxidized state	12	X
6666	15N hyperfine shifts assignment for rubredoxin (V8G/V44G) from Clostridium pasteurianum in the reduced state	12	X
6667	15N hyperfine shifts assignment for rubredoxin (V8I) from Clostridium pasteurianum in the oxidized state	12	X
6668	15N hyperfine shifts assignment for rubredoxin (V8I) from Clostridium pasteurianum in the oxidized state	12	X
6669	15N hyperfine shifts assignment for rubredoxin (V8L) from Clostridium pasteurianum in the oxidized state	12	X
6670	15N hyperfine shifts assignment for rubredoxin (V8L) from Clostridium pasteurianum in the reduced state	12	X
6671	15N hyperfine shifts assignment for rubredoxin (V44A) from Clostridium pasteurianum in the oxidized state	12	X
6672	15N hyperfine shifts assignment for rubredoxin (V44A) from Clostridium pasteurianum in the reduced state	12	X
6673	15N hyperfine shifts assignment for rubredoxin (V44G)from Clostridium pasteurianum in the oxidized state	12	X
6674	15N hyperfine shifts assignment for rubredoxin (V44G)from Clostridium pasteurianum in the reduced state	12	X
6675	15N hyperfine shifts assignment for rubredoxin (V44I)from Clostridium pasteurianum in the oxidized state	12	X
6676	15N hyperfine shifts assignment for rubredoxin (V44I)from Clostridium pasteurianum in the reduced state	12	X
6677	15N hyperfine shifts assignment for rubredoxin (V44L) from Clostridium pasteurianum in the oxidized state	12	X
6678	15N hyperfine shifts assignment for rubredoxin (V44L) from Clostridium pasteurianum in the reduced state	12	X
6679	G311	641	X
6680	Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments for A219.	646	X
6681	Solution Structure Of GIP In TFE/Water	277	X
6682	Solution Structure of a Human C2H2-type Zinc Finger Protein	750	X
6683	Backbone Resonance Assignments of Human Normal Adult Hemoglobin in the Deoxy Form	1138	X
6685	NMR Structure of AlkB	1520	X
6686	1H NMR assignments of the Ce2-TR1C complex at 298 K	422	X
6687	Solution structure of the N-terminal domain (M1-S98) of human centrin 2	638	X
6688	NMR chemical shift entry for protein Rv1980c (MPT64) from M. tuberculosis	2238	X
6689	1H and 15N Chemical Shift Assignments for N-terminal domain of human centrin 1	615	X
6690	Partial 1H, 13C, and 15N Chemical Shift Assignments for PSI AB box region in complex with U1-70k protein proline-rich peptide	451	X
6691	Partial 1H, 13C, and 15N Chemical Shift Assignments for PSI AB box region in complex with U1-70k protein proline-rich peptide	392	X
6692	1H, 13C, and 15N Chemical Shift Assignments for AppA 5-125	1245	X
6693	Structure Determination of the Northeast Structural Genomics Consortium Target BoR11	1603	X
6695	Backbone 1H, 13C and 15N Chemical Shift Assignments for Ferredoxin-NADP+ Reductase	1448	X
6696	G83N TPR domain of Ppp5	1634	X
6698	The structured core of a largely unstructured protein, malarial merozoite surface protein 2 (MSP2), is amyloidogenic	145	X
6699	Backbone 1H, 13C, 15N and heavy atoms Chemical Shift Assignments for La3+ monosubstituted calbindin D9k	492	X
6700	Resonance Assignments of 30 kDa complexes of TFIID subunit TAF1 with TATA-binding protein	1451	X
6702	Resonance assignments of 30 kDa complexes of TFIID subunit TAF1 with TATA-binding protein	926	X
6705	human beta-parvalbumin	1391	X
6707	NMR assignments for apo- and Ca2+ saturated paramecium calmodulin	712	X
6709	1H, 15N, 13C resonance assignment of the N-terminal domain of PilB from Neisseria meningitidis	1252	X
6710	Backbone 1H, 13C, and 15N Chemical Shift Assignments for PB1 domain of P67phox	432	X
6711	NMR assignment of Human Ubiquitin Conjugating Enzyme (Ubc7)	1715	X
6712	Solution structure of the two N-terminal CCP modules of C4b-binding protein (C4BP) alpha-chain	1526	X
6713	Backbone 1H, 13C, and 15N Chemical Shift Assignments for PB1 domain of P40phox	440	X
6714	Solution structure of CSP1	144	X
6715	Solution NMR Structure of the Membrane Protein Stannin	418	X
6716	Solution structure of the helicase-interaction domain of the primase DnaG: a model for helicase activation	1613	X
6717	Solution NMR structure of the UPF0213 protein BH0048 from Bacillus halodurans. Northeast Structural Genomics target BhR2.	1202	X
6718	NMR structure of the human dematin headpiece S74E mutant	881	X
6719	Complex structure of the first WW domain of FBP11/HYPA and a -Pro-Pro-Leu-Pro- ligand reveals mechanism of Pro-rich ligand recognition by Group-II/III WW domains	349	X
6720	Solution Conformation of alpha-conotoxin PIA	90	X
6721	Solution structure of the first WW domain of FBP11	315	X
6722	Backbone NMR Assignment of low-molecular-weight Protein Tryosin Phosphatase (MPtpA) from Mycobacterium tuberculosis	738	X
6723	NMR structure of the heme chaperone CcmE reveals a novel functional motif	1372	X
6724	Nuclear Magnetic Resonance Structure-Based Epitope Mapping and Modulation of Dust Mite Group 13 Allergen as a Hypoallergen	1268	X
6725	1H, 13C and 15N resonance assignments for domain III of the Dengue Virus envelope protein	1259	X
6726	Solution structure of self-sacrificing resistance protein CalC from Micromonospora echinospora	1689	X
6727	1H, 13C and 15N resonance assignments of telomeric repeat-binding domain of Arabidopsis thaliana	1114	X
6728	NMR STRUCTURAL STUDIES OF A POTASSIUM CHANNEL/CHARYBDOTOXIN COMPLEX	188	X
6729	1H Chemical Shift Assignments for Diapause-Specific Peptide from the Leaf Beetle	236	X
6730	Chemical shift assignments for Filamin a domain 17	1065	X
6731	Backbone 1H, 13C, and 15N Chemical Shift Assignments for BOFC	1715	X
6732	The structure of human CD23 and its interactions with IgE and CD21	2502	X
6733	The structure of human CD23 and its interactions with IgE and CD21	251	X
6734	The structure of human CD23 and its interactions with IgE and CD21	248	X
6735	The structure of human CD23 and its interactions with IgE and CD21	248	X
6736	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Pseudomonas Aeruginosa Protein Pa2021. The Northeast Structural Genomics Consortium Target Pat85.	766	X
6737	Curvacin A	297	X
6738	Solution structure of Sep15 from Drosophila melanogaster	1427	X
6739	Solution structure of SelM from Mus musculus	1531	X
6740	NMR solution structure of the Crisp domain of Tpx-1	429	X
6741	NMR Structure of Mini-B, an N-terminal - C-terminal construct from Surfactant Protein B (SP-B), in Sodium Dodecyl Sulfate (SDS) and Hexafluoroisopropanol (HFIP)	554	X
6742	De-ubiquitinating function of ataxin-3: insights from the solution structure of the Josephin domain	2232	X
6743	1H, 13C, 15N Chemical Shift Assignments for CcdA Conformer a, b, and c	1879	X
6744	1H, 13C and 15N resonance assignments of the C-terminal domain of RP2	1473	X
6745	Backbone 1H, 13C, and 15N chemical shift assignments of human HnRNP F	1870	X
6746	Assignment of phnA-like protein rp4479	907	X
6747	Assignment of 50S ribosomal protein L40e	665	X
6748	NMR assignments of the Ki67FHA/hNIFK(226-269)3P complex	1743	X
6749	Solution structure of the NRSF/REST-mSin3B PAH1 complex	1084	X
6750	Structural basis for cooperative transcription factor binding to the CBP coactivator	284	X
6751	Solution Structure of Asl1650, an Acyl Carrier Protein from Anabaena sp. PCC 7120 with a Variant Phosphopantetheinylation-Site Sequence	1100	X
6752	Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments for the PH-PDZ tandem of alpha syntrophin	2542	X
6753	Backbone 1H,13C, and 15N chemical shift assignments for the PH1 domain of alpha-syntrophin	1711	X
6754	Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments for the PDZ domain of alpha syntrophin	932	X
6755	Backbone 1H, 13C, and 15N Chemical Shift Assignments for TA0743	1303	X
6756	Solution structure of domain 6 from the ai5(gamma) group II intron	389			X
6757	1H and 13C Chemical Shift assignments for BVDV NS5A membrane anchor sequence [1-28]	655	X
6758	NMR assignment of the E.coli cytolethal distending toxin CdtB-II subunit	1018	X
6759	NEAT NMR Resonance Assignments	1508	X
6760	NMR assignment of the mTOR domain responsible for rapamycin binding	1267	X
6761	SOLUTION STRUCTURE AND BACKBONE DYNAMICS OF AN N-TERMINAL UBIQUITIN-LIKE DOMAIN IN THE GLUT4-TETHERING PROTEIN, TUG	1066	X
6762	The response regulator TorI belongs to a new family of atypical excisionase	1236	X
6763	1H, 15N and 13C resonance assignments of the middle domain of human release factor eRF1	1410	X
6766	Complete assignment of a hypothetical protein pa0128 form Pseudomonas aeruginosa. Northeast Structural Genomics Consortium Target PaT1.	1404	X
6769	Complete assignments of a hypothetical protein NE2066, from Nitrosomonas_europaea. Northeast Structural Genomics Consortium Target NeT1.	1008	X
6771	Solution structure of a "retroevolved" lambda Cro monomer reveals the basis for increased monomer stability and reduced dimerization	783	X
6774	1H and Calpha assignments for bombinin H2	116	X
6775	1H and Calpha assignments for bombinin H4	109	X
6776	Assignment of 1H, 15N and 13C resonances of the bacterial protein YFHJ	843	X
6777	Beta PIX-SH3 complexed with an atypical peptide from alpha-PAK	828	X
6778	NMR and molecular dynamics studies of the interaction of melatonin with calodulin	28	X
6779	Solution Structure of the type 1 pilus assembly platform FimD(25-125)	1074	X
6780	NMR Assignment of HI1506, a novel two-domain protein from Haemophilus influenzae	1439	X
6781	Resonance Assignments for the ADA2-like Swirm domain	931	X
6782	1H, 13C, and 15N Chemical Shift Assignments for E. coli protein YbiA	2074	X
6783	Backbone/Sidechain assignments for RKIP.	1803	X
6784	KID domain	352	X
6785	Backbone resonance assignments for the Fv fragment of the catalytic antibody 6D9 complexed with a transition state analogue	1069	X
6786	1H, 13C and 15N resonance assignment of an oxidized form (Cys51-Cys198) of methionine sulfoxide reductase A from Escherichia coli	1579	X
6787	Backbone 1H, 13C, and 15N Chemical Shift Assignments for rabphilin C2A domain	1674	X
6788	Ser133-phosphorylated KID domain	350	X
6789	Backbone 1H- and 15N-amide chemical shifts of apo-, (Ca2+)1- and (Ca2+)2-Eq04Q TR2C of bovine calmodulin, at 301K and pH 6.0.	142	X
6790	Solution Structure of Stearoyl-ACP from Spinach	896	X
6791	Conformation of two oppositely functioning Allatostatin peptides for 2D NMR	90	X
6792	Conformation of two oppositely functioning Allatostatin peptides for 2D NMR	81	X
6793	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Bacillus Subtilis Protein Ysne: The Northeast Structural Genomics Consortium Target SR220	1656	X
6794	L.mexicana ICP	1456	X
6796	NMR assignments of the dimeric S. aureus small multidrug-resistance pump in LPPG micelles	518	X
6797	NMR assignment of the outer membrane lipoprotein (OmlA) from Xanthomonas axonopodis pv citri	1512	X
6798	chemical shift values of the methyl groups of Met residues in the Ca2+-CaM-CaMKI-peptide complex	36	X
6799	Resonance Assignments for Methanococcus Maripaludis Protein Mmp0443: The Northeast Structural Genomics Consortium Target Mrr16	1276	X
6800	NMR solution structure and backbone dynamics of tick-borne E-protein domain III Langat flavivirus	1048	X
6801	1H, 13C, and 15N Chemical Shift Assignments for Human Small Ubiquitin-like Modifier Protein Isoform 2 (SUMO-2)	1039	X
6802	Chemical shifts of the selected resonances in calmodulin alone and in complex with various sk-MLCK target peptides	8	X
6803	1H, 13C, and 15N Chemical Shift Assignments for the periplasmic signaling domain of FecA from Escherichia coli	1160	X
6804	Letter to the Editor:NMR assignments of the free and bound-state components of an anti-idiotypic affibody complex	722	X
6805	Letter to the Editor: NMR assignments of the free and bound-state components of an anti-idiotypic affibody complex	747	X
6806	Letter to the Editor: NMR assignments of the free and bound-state components of an anti-idiotypic affibody complex	1474	X
6807	1H, 13C, and 15N chemical shift assignments for stereo-array isotope labelled (SAIL) maltodextrin-binding protein (MBP)	3148	X
6808	1H, 13C, and 15N Chemical Shift Assignments for the N-terminal Peptide of Equinatoxin II	252	X
6809	Backbone 1H,13C, and 15N chemical shift assignments for rabbitpox encoded viral chemokine inhibitor (vCCI)	973	X
6810	Letter to the Editor: Assignment of 1H, 13C and 15N resonances of the last 250 residues in Escherichia coli RcsC, including the phosphoreceiver domain.	3026	X
6811	Solution structure of apoCadA	533	X
6812	ta0938	1137	X
6814	Class I GTP aptamer	288			X
6815	NMR structure of Retrocyclin-2 in SDS	89	X
6816	Solution structure of the C-terminal RpoN domain of aquifex aeolicus SIGMA-54 shows similarity to SIGMA-70	715	X
6817	Structure of cyclic conotoxin MII-7	120	X
6818	Structure of the cyclic conotoxin MII-6	99	X
6820	Solution Structure Of The Calcium-loaded N-Terminal Sensor Domain Of Centrin	1137	X
6821	Human SOD before harboring the catalytic metal: Solution structure of copper depleted, disulfide reduced form	1642	X
6822	The Structure of the Hamp Domain Implies a Rotational Mechanism in Transmembrane Signalling	681	X
6823	Backbone and Sidechain chemical shift assignments of the Human Rhinovirus 3C Protease covalently complexed with a peptidyl inhibitor	2321	X
6824	1H, 13C, and 15N Chemical Shift Assignments for ORF 7a coded X4 protein of SARS Coronavirus	953	X
6825	1H Chemical Shifts of CaD Peptide in CaM/Peptide Mixture (1/30) at pH 6.5, 288 K.	101	X
6826	Backbone 1H, 13C, and 15N Chemical Shift Assignments for N-terminal DNA recognition domain of the Bacillus subtilis of the transcription-state regulator Abh	622	X
6827	Structure function relationships of the polyhistidine rich peptide LAH4 in micellar environment;pH dependent mode of antibiotic action and DNA transfection	155	X
6828	Backbone 1H, 13C, and 15N Chemical Shift Assignments for MazF(E24A)	422	X
6829	Chemical shift assignments for Chitin-binding Domain of Hyperthermophilic Chitinase from Pyrococcus furiosus	1211	X
6830	1H, 13C Chemical shifts and pKa values in Ca2+-CaM and the CaM-cNOS peptide comlex.	36	X
6831	1H, 13C Chemical shifts and pKa values in Ca2+-CaM and the CaM-cNOS peptide comlex.	36	X
6832	Comparative NMR study on the impact of point mutations on protein stability of Pseudomonas mendocina lipase	1145	X
6833	Backbone 1H, 13C, and 15N Chemical Shift Assignments for holo-MazF(E24A) with MazEp(54-77)	414	X
6834	Solution Structure of the hSet2/HYPB SRI domain	1247	X
6835	Structures of antimicrobial peptide Fowlicidin 1	224	X
6836	Solution Structure of HndAc : A Thioredoxin-like Domain Involved in the NADP-reducing Hydrogenase Complex.	530	X
6837	NMR Assignments of L27 Heterodimer From C. Elegans Lin-7 and H. Sapiens Lin-2 Scaffold Proteins	1488	X
6838	1H, 13C and 15N backbone resonance assignment for PSE-4, a 29.5 kDa class A beta-lactamase from Pseudomonas aeruginosa	1298	X
6839	1H Chemical shift assignments for PV5 in DPC micelles	129	X
6840	15N 13C and 1H chemical shift assignments for the WIF domain of human WIF-1	1702	X
6841	Solution structure of Calmodulin-like Skin Protein C terminal domain	491	X
6843	Solution structure of the NOD1 Caspase Activating and Recruitment Domain	1170	X
6844	Solution Structure of Drosophila melanogaster SNF RBD2	1030	X
6845	NMR Structural analysis of archaeal Nop10	817	X
6846	NMR structural analysis of Nop10p from Saccharomyces cerevisiae	707	X
6847	NMR assignments of a thioredoxin-like protein in the oxidized state	1723	X
6849	Crassostrea gigas defensin	279	X
6850	First FF domain of the PRP40 yeast protein	634	X
6851	Solution Structure of the human homodimeric DNA repair protein XPF.	774	X
6853	Backbone Chemical Shift Assignment for TAP-N	983	X
6854	1H, 13C, and 15N Chemical Shift Assignments for the first SH3 domain of Nck2	657	X
6855	Sequence specific assignment of SH3 domain B from human CIN85 protein	723	X
6856	1H, 13C, and 15N assignments for UDP-N-acetylmuramyl-pentapeptide (PG-P) bound to Peptidoglycan associated lipoprotein (pal) from Haemophilus influenzae or free.	89	X
6857	Solution structure of an immunodominant epitope of myelin basic protein (MBP) - Conformational dependence on environment of an intrinsically unstructured protein	475	X
6858	1H, 13C, and 15N assignments for UDP-N-acetylmuramyl-pentapeptide (PG-P) bound to Peptidoglycan associated lipoprotein (pal) from Haemophilus influenzae or free.	87	X
6859	1H chemical shift assignments for peptide P2	163	X
6860	Chemical shift assignments of the human ortholog of tRNA endonuclease subunt SEN15	1406	X
6861	Selected chemical shifts in apo N-CamY	9	X
6862	Selected chemical shifts in Ca2+ bound N-CamY	10	X
6863	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Mengovirus Leader polypeptide	273	X
6864	1H, 13C and 15N resonance assignments of a repeat domain of the egg case silk from Nephila antipodiana	1472	X
6865	1H, 13C, and 15N chemical shift assignments for P. falciparum TRAP-TSR domain	505	X
6866	chemical shift assignments of the human sorting nexin 22	1310	X
6867	Solution structure of micelle-bound fusion domain of HIV-1 gp41	229	X
6868	Solution Structure of ydhR protein from Escherichia coli	1225	X
6869	Solution Structure of C-Terminal 14 kDa Domain of the tau subunit from Escherichia coli DNA Polymerase III	1534	X
6870	Probing the conformation and dynamics of allatostatin neuropeptides: a structural model for functional differences.	81	X
6872	Solution structure of kalata B8	183	X
6873	1H, 15N and 13C chemical shift assignments of pleckstrin's C-terminal PH domain	1311	X
6874	Structural diversity in CBP/p160 complexes	1224	X
6875	Solution structure of a biologically active human FGF-1 monomer, complexed to a hexasaccharide heparin-analogue	1140	X			X
6876	1H, 15N and 13C chemical shifts of T. cruzi Chagasin	1096	X
6877	NMR assignments of the Human Papillomavirus type 16 E2C DNA-bound form	664	X	X
6878	Backbone 1H and 13C Chemical Shifts Assignemts for putative TM7 from V-ATPase subunit a	49	X
6879	Backbone 1H, 13C, and 15N Chemical Shift Assignment for aKv1.1N	426	X
6880	1H, 13C and 15N chemical shift assignments of Schistocerca gregaria chymotrypsin inhibitor at pH=6.0	114	X
6881	1H, 13C and 15N chemical shift assignments of Schistocerca gregaria chymotrypsin inhibitor complexed with bovine chymotrypsin	69	X
6882	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the extracellular sushi domain of the Interleukin-15 receptor	799	X
6883	Ufd1	2169	X
6884	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Bacillus subtilis Acylphosphatase	1060	X
6885	Assignment of 1H and 15N chemical shifts for the Ig1 module of FGFR1	702	X
6886	Structure-function relationships of the polyhistidine-rich peptide LAH4 in micellar environments; pH dependent mode of antibiotic action and DNA transfection	322	X
6888	1H, 15N Assignment of Neocarzinostatin Apo-Protein complexed with Flavone	738	X
6890	Structural Determinants for High Affinity Binding in a Nedd4 WW3* Domain - Comm PY Motif Complex	550	X
6891	Solution structure of MrIA	79	X
6892	Structure and influence on stability and activity of the N-terminal propetide part of lung surfactant protein C	239	X
6893	Bovine Fibrinogen alpha-C Domain	882	X
6894	New insights into binding of the possible cancer target RalGDS	1047	X
6895	NMR Structure of the RNA Binding Domain of Human Fox-1 in Complex with UGCAUGU	882	X		X
6896	Solution structure of [Sec2,3,8,12]-ImI	60	X
6897	Solution structure of [Sec2,8]-ImI	60	X
6898	NMR structure of the peptide linked to the genome (VPg) of poliovirus	276	X
6899	Native PAH2 domain of Mm. mSin3B	1067	X
6900	15N, 13C and 1H resonance assignments for the C-terminal MA-3 domain of the tumour suppressor protein Pdcd4	1550	X
6901	1H, 13C, and 15N Chemical Shift Assignments for DUSP domain of HUSP15	1639	X
6902	Complete 1H and 15N assignment of the FK506-binding domain of human FKBP38	987	X
6903	1H, 13C and 15N resonance assignment of M-crystallin: a novel Ca2+ binding protein of the bg-crystallin superfamily from Methanosarcina acetivorans	897	X
6904	1H, 13C and 15N resonance assignment of M-crystallin: a novel Ca2+ binding protein of the bg-crystallin superfamily from Methanosarcina acetivorans	900	X
6905	Solution Structure of a Zap1 Zinc-Responsive Domain Provides Insights into Metalloregulatory Transcriptional Repression in Saccharomyces cerevisiae	341	X
6906	1H, 13C, and 15N Chemical Shift Assignments for the Bicoid Homedomain	864	X	X
6907	Chemical Shift Assignments for V66W110 fragment of Staphylococcal Nuclease	572	X
6908	1H, 13C, and 15N Chemical Shift Assignments for SNase110 fragment of Staphylococcal Nuclease in 2M TMAO	629	X
6909	1H and 15N Chemical Shift Assignments for the Alpha-domain of Human Metallothionein-3	235	X
6910	1H,13C,15N chemical shift assignment for SMP-1 (Small Myrisoylated Protein-1) from Leishmania	1386	X
6911	13C, 15N and 1H assignment of the PDZ1 domain of hMAGI-1 using QUASI	1238	X
6912	1H, 13C, and 15N Resonance Assignments for the reduced form of Thioredoxin 1 from Sacharomyces cerevisae	1228	X
6913	'1H, 13C and 15N Resonance Assignments for the Reduced Form of Thioredoxin 2 from Saccharomyces cerevisiae'	1238	X
6914	Solution structure of the Wilson ATPase N-domain in the presence of ATP	1828	X
6915	1H and 15N Chemical Shift Assignments of Recombinant Dendroaspin	444	X
6916	NMR structure of the C-terminal domain (dimer) of HPV45 oncoprotein E7	677	X
6917	Backbone assignments of Pyrococcus furiosus Pop5 (PF1378), an archaeal RNase P protein.	510	X
6918	Backbone 1H, 13C, and 15N Chemical Shift Assignments for CRC-N (algal centrin N-term)	1136	X
6919	Letter to the Editor: 1H, 13C and 15N resonance assignments of the region 655-775 of the human MAN1	1220	X
6920	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Mid1 BBox 1	668	X
6921	Backbone and side chain chemical shift assignments for hydrophilic domain of human cytochrome b5	1267	X
6922	Solution structure of the Vts1 SAM domain in the presence of RNA	1095	X		X
6923	Backbone 1H, 13C, and 15N resonance assignments of the N-terminal domain of FKBP38 (FKBP38NTD)	1757	X
6924	1H chemical shifts for discrepin, a scorpion toxin that blocks IA currents of the voltage dependent K+ channels	250	X
6925	Backbone and Beta 1H, 13C, and 15N Chemical Shift Assignments for the Bacterial Toxin Kid	794	X
6926	Chemical Shift Assignments of Thylakoid Soluble Phosphoprotein of 9 kDa	803	X
6927	Spinophilin PDZ domain	1312	X
6928	1H, 13C, and 15N NMR Assignment of the Rep Protein Nuclease Domain from the Porcine Circovirus PCV2	1375	X
6929	1H, 13C, and 15N Chemical Shift Assignments for Nitrosomonas Europaea Protein Ne2328: Northeast Structural Genomics Consortium target NeT3	1007	X
6930	NMR assignments of SNF RBD1	1325	X
6932	Chemical shift assignments of phosphoryl carrier domain of pyruvate phosphate dikinase	1338	X
6933	Complete Chemical Shift Assignment for the Neurabin PDZ Domain	1105	X
6934	1H, 15N, and 13C Assigned Chemical shift for Wzb	1806	X
6935	Comparative NMR study on the impact of point mutations on protein stability of Pseudomonas mendocina lipase	905	X
6936	Resonance assignments for the pKM101 homologue of VirB7 (TraN) in complex with the pKM101 homologue of VirB9 (TraO)	1801	X
6938	1H, 13C and 15N NMR assignment of the region 51-160 of human KIN17 protein	1480	X
6939	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Ubiquitin Specific Protease 7	498	X
6940	NMR assignment of the 2H, 13C, 15N labeled amino-terminal domain of apo-pantothenate synthetase from E.coli.	774	X
6941	'1H, 13C, and 15N Chemical Shift Assignments for Ac-Dab-Dab-(Ala)7-Orn-Orn-NH2 where Dab-diaminobutyric acid; Orn - ornithine'	109	X
6942	1H, 13C, and 15N Chemical Shift Assignments for Myristoylated neuronal calcium sensor-1	1902	X
6943	Resonance Assignment of Bombyx mori Chemosensory Protein 1	1355	X
6944	Resonance assignment for the N-terminal region of eukaryotic initiation factor 5 (eIF5)	1521	X
6945	solution structure of PSD-1	629	X
6946	Solution structure of free form of the GTP/GDP binding domain of translation initiation factor IF2	1613	X
6947	Backbone 1H, 13C, and 15N Chemical Shift assignments for dimeric E.coli Ferric Uptake Regulator (Fur)	1170	X
6948	Backbone 1H, 13C, and 15N Chemical Shift assignments for monomeric E. coli Ferric Uptake Regulator (Fur).	549	X
6949	domain 2 of receptor-associated protein	1352	X
6950	domain 3 of RAP	1389	X
6951	Solution structure of conotoxin pl14a	139	X
6952	Violacin A	132	X
6953	NMR solution of rabbit Prion Protein (91-228)	1615	X
6954	NMR structure of influenza HA fusion peptide mutant W14A in DPC in pH5	113	X
6955	Solution Structure of the gene product of E. coli gene ydhA	920	X
6956	RNA recognition by the Vts1 SAM domain	1048	X		X
6957	Solution structure of the SCAN homodimer from MZF-1/ZNF42	1144	X
6960	Target Structure-Based Discovery of Small Molecules that Block Human p53 and CREB Binding Protein (CBP) Association	1402	X
6962	Resonance Assignments of 10:0-ACP	1016	X
6963	1H Chemical Shift Assignments for the Second Kunitz domain of human WFIKKN1, Pro61 in cis- or trans- conformation	820	X
6964	NMR Structure of the Rpa2829 protein from Rhodopseudomonas palustris: Northeast Structural Genomics Consortium Target RpR43	1492	X
6965	1H and 15N assignment of the soluble domain of the ba3 oxidase subunit II of Thermus thermophilus in the oxidized state	993	X
6966	1H and 15N assignment of cytochrome c552 from Thermus thermophilus in the reduced state	1121	X
6967	1H and 15N assignment of cytochrome c552 from Thermus thermophilus in the oxidized state	1107	X
6968	1H, 13C and 15N assignment of C', CA, CB, N, HN, HA and HB of intrinsically disordered alpha-synuclein	1063	X
6969	Chemical Shift Assignment for SARS-CoV S2-HR2	604	X
6970	1H, 15N, 13C assignments for the activated form of the small Rho-GTPase Rac1	858	X
6971	NMR assignment of the b' domain of thermophilic fungal protein disulfide isomerase	1412	X
6972	NMR assignment of the a' domain of thermophilic fungal protein disulfide isomerase	1306	X
6973	human p23(1-119)	1076	X
6974	human p23(1-160)	596	X
6975	1H chemical shift assignments for Bcl2MidG4	199		X
6976	Solution NMR structure of the UPF0346 protein yozE from Bacillus subtilis. Northeast Structural Genomics target SR391.	948	X
6979	An Alternating Sheared AA Pair and Elements of Stability for a Single Sheared Purine-Purine Pair Flanked by Sheared GA Pairs	186			X
6980	Chemical Shift Assignment of human allograft inflammatory factor I	1595	X
6981	Solution Structure of Monomeric BsaL, the Type III Secretion Needle Protein of Burkholderia pseudomallei	848	X
6982	Solution Structure of TA0895, an MoaD homologue from Thermoplasma acidophilum	930	X
6983	'Backbone 1H, 13C, 15N, and 13CB Chemical Shift Assignments for Azide-Inhibited P. aeruginosa Heme Oxygenase'	872	X
6984	1H, 13C, and 15N Chemical Shift Assignments of the cAMP-Binding Domain A of the PKA Regulatory Subunit	1396	X
6985	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the human Hexim1 TBD	1299	X
6986	NMR ASSIGNMENT OF THE PHOSPHOTYROSINE BINDING(PTB) DOMAIN OF TENSIN	1407	X
6987	Backbone 1H, 13C, 15N, and 13CB Chemical Shift Assignments for Cyanide-Inhibited P. aeruginosa Heme Oxygenase	883	X
6988	1H, 13C, and 15N Chemical Shift Assignments for HGB1-UBA	1139	X
6989	1H, 13C, and 15N Chemical Shift Assignments for Ribosomal Protein S24E	1099	X
6990	1H, 15N and 13C resonance assignments of the cerato-platanin, a phytotoxic protein from Ceratocystis fimbriata	1508	X
6991	Phosphorylation of Cytoplasmic Tail of Tissue Factor and its Role in Modulating	176	X
6992	Three-dimensional structure of the bacterial cell wall peptidoglycan	161				X
6993	Phosphorylation of Cytoplasmic Tail of Tissue Factor and its Role in Modulating Structure and Binding Affinity.	168	X
6995	Solution structure of GDP-bound form of the GTP/GDP binding domain of translation initiation factor IF2	1695	X
6996	Phosphorylation of Cytoplasmic Tail of Tissue Factor and its Role in Modulating Structure and Binding Affinity.	164	X
6997	Structural Insights of the Specificity and Catalysis of a Dimeric Viral SET Domain Histone H3 Lysine-27 Methyltransferase	1292	X
6998	Phosphorylation of Cytoplasmic Tail of Tissue Factor and its Role in Modulating Structure and Binding Affinity.	161	X
6999	KorA	1113	X
7000	Solution structure of the conserved hypothetical protein Rv2302 from the bacterium Mycobacterium tuberculosis	826	X
7001	Structure of the Phosphorylation Motif of the oncogenic Protein beta-Catenin Recognized By a Selective Monoclonal Antibody	171	X
7002	1H, 13C, and 15N Chemical Shift Assignments for the Ede1 UBA-ubiquitin complex	1429	X
7003	NMR backbone assignment of the human HSP90 N-terminal domain	894	X
7004	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Rhodopseudomonas palustrus protein Rpa0253. Northeast structural genomics target RpR3.	1789	X
7005	The PP-fold Solution Structure of Human Polypeptide YY and Human Polypeptide YY 3-36 as Determined by NMR	204	X
7006	Structure of human PYY	199	X
7007	Solution structure of At5g39720.1 from Arabidopsis thaliana	1824	X
7008	Second Ca2+ binding domain of the Na,Ca-exchanger (NCX1)	1675	X
7009	First Ca2+ binding domain of the Na,Ca-exchanger (NCX1)	1422	X
7010	Solution Structure and Immune Response to an Epidermal Growth Factor Domain from Plasmodium Falciparum Merozoite Surface Protein 1	581	X
7011	Solution structure of 97-109 segment of staphylococcal nuclease	119	X
7012	Solution structure of 55-72 segment of staphylococcal nuclease	165	X
7013	1H, 15N, 13C resonance assignments for Bcl-xL protein 38 kDa dimer	791	X
7014	NMR assigment of the SARS-CoV protein nsp1	1452	X
7015	NMR assignments for apo- and Ca2+ saturated paramecium calmodulin	690	X
7016	Backbone 1H- and 15N-amide chemical shifts of apo-, (Ca2+)1- and (Ca2+)2-Eq04Q TR2C of bovine calmodulin, at 301K and pH 6.0.	134	X
7017	Backbone 1H- and 15N-amide chemical shifts of apo-, (Ca2+)1- and (Ca2+)2-Eq04Q TR2C of bovine calmodulin, at 301K and pH 6.0.	142	X
7018	chemical shift values of the methyl groups of Met residues in the Ca2+-CaM-CaMKI-peptide complex	36	X
7019	NMR assignment of the protein nsp3a from SARS-CoV	1386	X
7020	Chemical Shift Assignments for a Subunit of RNA Polymerase II	1407	X
7021	Backbone dynamics and domain motions of the Mip protein from legionella pneumophilia in solution	1810	X
7022	Letter to the Editor: 1H, 13C and 15N backbone resonance assignments of DUF589 domain from human HSPC144 protein	1628	X
7023	Assignment of 1H,13C and 15N resonances for the REF2-I mRNA export factor	1815	X
7024	Resonance assignments of the 34kD rabbitpox vCCI:human MIP-1b complex	1662	X
7025	1H, 13C, and 15N Resonance Assignments of the VAP-A: OSBP Complex	1909	X
7028	Chemical shifts of the selected resonances in calmodulin alone and in complex with various sk-MLCK target peptides	8	X
7029	Chemical shifts of the selected resonances in calmodulin alone and in complex with various sk-MLCK target peptides	8	X
7030	Chemical shifts of the selected resonances in calmodulin alone and in complex with various sk-MLCK target peptides	8	X
7031	Chemical shifts of the selected resonances in calmodulin alone and in complex with various sk-MLCK target peptides	8	X
7032	NMR Solution Structure, Dynamics and Binding Properties of the Kringle IV Type 8 module of apolipoprotein(a)	1136	X
7033	GSPT1/eRF3a(PAM2-2)-PABC complex	1059	X
7034	1H, 13C, and 15N chemical shift assignments for the zinc-finger region of human ZHX1	927	X
7035	Backbone 1H, 13C, and 15N Chemical Shift Assignments for 2nd SH3 domain of human NCK2 adaptor protein	463	X
7036	Backbone 1H, 13C, and 15N Chemical Shift Assignments for 3rd SH3 domain of human NCK2 adaptor protein	570	X
7049	1H chemical shifts of the fifth transmembrane segment of Na,K-ATPase in SDS micelles	213	X
7050	Solution structure of growth-blocking peptide of the cabbage armyworm, Mamestra brassicae	144	X
7051	Solution structure of growth-blocking peptide of the tobacco cutworm, Spodoptera litura	136	X
7053	1H, 13C and 15N resonance assigned of a first cysteine catalytic half-domain of mouse ubiquitin-activating enzyme E1.	1220	X
7054	NMR chemical shift assignments and structure determination of Xanthomonas campestris XCC1710: Northeast Structural Genomics Consortium Target XcR35	1326	X
7055	1H, 13C, and 15N Chemical Shift Assignments for PTH from Mycobacterium tuberculosis H37Rv	1959	X
7056	1H, 13C, 15N assignments of an independently folded C-terminal domain of influenza polymerase subunit PB2	2043	X
7057	Chemical Shift Assignment for hbSBD	509	X
7058	Backbone 1H, 13C, and 15N Chemical Shift Assignments for calponin homology domain of human MICAL_1	1277	X
7059	1H, 13C, and 15N Resonance Assignments of the Pyrazinamidase from Mycobacterium Tuberculosis	1967	X
7061	NMR structure of talin-PTB in complex with PIPKI	1434	X
7063	Solution NMR structure of the putative cytoplasmic protein ygaC from Salmonella typhimurium. Northeast Structural Genomics target StR72.	1495	X
7064	Cycloviolacin O14	181	X
7065	Solution conformation of gaegurin4	273	X
7066	Structure of the Cadmium metal-sensor CmtR from Mycobacterium tuberculosis	1054	X
7067	Human Nogo-A functional domain: nogo60	359	X
7068	Solution structure and intermolecular interactions of the Copper form of third metal-binding domain of ATP7A, the menkes disease protein	857	X
7069	Solution structure and intermolecular interactions of the apo form of third metal-binding domain of ATP7A, the menkes disease protein	873	X
7070	RRMs 1 and 2 of Prp24 from S. cerevisiae	1958	X
7071	Backbone and Beta 1H, 13C, and 15N Chemical Shift Assignments for the Bacterial Antitoxin Kis	631	X
7072	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the PDZ domain of GOPC	1071	X
7073	Structure Determination of a New Protein (PF1455) from Backbone-Centered NMR Data and NMR-Assisted Structure Prediction	249	X
7074	1H, 13C and 15N chemical shift assignments of the protein Pf0610 from pyrococcus furiosus	1141	X
7075	Assignment of conserved hypothetical protein pa2412	814	X
7078	1H Chemical Shift Assigments for a Potent Bowman-Birk Inhibitor from Lentil seeds	417	X
7079	Sequence specific assignment of a hypothetical protein RP2812 (NESG ID: RPT4) from Rhodopseudomonas palustris	1456	X
7080	Complex of TM1a(1-14)Zip with TM9a(251-284): a model for the polymerization domain ("overlap region")of tropomyosin	900	X
7081	1H, 13C, and 15N Chemical Shift Assignment of the N-terminal domain of LANP	2075	X
7082	1H, 13C, and 15N assignments for the Psuedomonas putida protein PutA45	558	X
7083	Chemical shifts of SBD from Rhizopu oryzae glucoamylase	1068	X
7084	Dr13312 chemical shift data	964	X
7085	Assignment of hypothetical protein yst6499	1175	X
7086	Assignment of hypothetical protein tm1012	1913	X
7087	1H, 13C and 15N Assignments of the Dengue-4 Envelope Protein Domain III	1114	X
7088	dynamics within the fMet-tRNA binding domain of translation initiation factor IF2 from Bacillus stearothermophilus	658	X
7089	1H, 13C, and 15N Peak Assignments of Human Macrophage Metalloelastase, in its inhibitor-free state	1762	X
7090	Solution structure of a purine rich hexaloop hairpin belonging to PGY/MDR1 mRNA and targeted by antisense oligonucleotides	277			X
7091	Backbone 1H, 13C, and 15N Chemical Shift Assignments for GroES	313	X
7092	Chemical shifts of Vigna radiata Defensin 2 from Mung bean	288	X
7093	Chemical shift assignment of monomeric chorimate mutase from methanococcus jannaschii in a complex with a transition state analog	989	X
7094	1H and 15N Chemical Shift Assignments for the Acylphosphatase from Eschaerichia Coli	586	X
7095	Solution structure of BC059385 from Homo sapiens	1161	X
7097	DNA recognition by the Brinker nuclear repressor - an extreme case of the coupling between binding and folding	912	X	X
7098	Linear dimer of stemloop SL1 from HIV-1	329			X
7099	NMR Solution Structure of VP9 from White Spot Syndrome Virus	827	X
7101	Mistranslation of a computationally designed protein yields an exceptionally stable homodimer: Implications for protein evolution and engineering.	672	X
7102	High-resolution structural and thermodynamic analysis of extreme stabilization of human procarboxypeptidase by computational protein design	849	X
7103	1H, 15N and 13C assignments of the H98S mutant of acireductone dioxygenase from Klebsiella ATCC 8724	2052	X
7104	1H and 15N Chemical Shift Assignments for the NCAM F3 module 2.	667	X
7105	1H, 13C and 15N chemical shift assignments for SRY.B in complex with 16-mer DNA	2275	X	X
7106	NMR Assignment of human RGS18 (regulator of G-protein signalling)	1659	X
7107	1H, 13C and 15N Chemical Shift Assignments for human Keratinocyte Fatty-acid binding protein with potent small molecule inhibitor (BMS-480404)	1528	X
7108	1H, 13C and 15N chemical shift assignments for TrxA (reduced form) from Bacillus subtilis	1239	X
7109	1H, 13C and 15N chemical shift assignments for TrxA (oxidized form) from Bacillus subtilis	1217	X
7110	1H, 13C, 15N CHEMICAL SHIFT FOR CBP BROMODOMIAN	1047	X
7111	Chemical shift assignment of multicrystalline ubiquitin using solid state MAS NMR spectroscopy	356	X
7112	1H, 13C, and 15N NMR Assignment of the Master-Rep Protein Nuclease Domain (2-95) from the Faba Bean Necrotic Yellows Virus	1179	X
7113	Chemical Shift Assignments for the First Immunoglobulin Domain of Myotilin	1181	X
7114	1H, 13C, and 15N chemical shift assignment of Escherichia coli Maltose Binding Protein complexed with Beta-Cyclodextrin	4389	X
7115	1H, 13C and 15N resonance assignments of the apo-form of human eIF4E	1693	X
7116	The solution structure of PHS018 from pyrococcus horikoshii	1209	X
7117	Complete 1H, 15N, and 13C chemical shift assignments for hybrid atracotoxin	425	X
7118	Solution structure of neurabin SAM domain	916	X
7119	NMR Assignment of the Human Cancer-Related Protein 32324	2256	X
7120	The SAM domain of DLC1 defines a novel structure that interacts with elongation factor 1A1 at cortical actin and membrane ruffles	843	X
7121	Solution Structure of UPF0301 protein HD_1794	1876	X
7122	Structural Studies of MJ1529, an O6 Methylguanine DNA Methyltransferase	1647	X
7123	1H Chemical shifts assignment of BR2, a toxin extracted from the venom of thespider Brachypelma runahui	251	X
7124	Solution Structure of MID1 B-box2 domain: A defining domain in TRIM/RBCC proteins reveals possible versatility in zinc-coordination	453	X
7125	Chemical Shifts Assignments of Human Adult Hemoglobin in the Carbonmonoxy Form	2761	X
7126	1H,13C and 15N resonance assignments of barnase-barstar complex NMR deuterium methyl relaxation data for free barnase and barnase-barstar complex	618	X
7127	Fibronectin 2F3 chemical shift assignments	1060	X
7128	Fibronecting 1F3-2F3 backbone chemical shift assignments	672	X
7129	Solution Structure and Folding Characteristics of the C-Terminal SH3 Domain of c-Crk-II	854	X
7130	Backbone NMR assignment of the 29.6 kDa Rhodanese protein from Azotobacter vinelandii	1187	X
7131	Solution structure of IGF2R domain 11	1641	X
7132	1H, 13C and 15N Chemical Shift Assignments for the CheA P1 domain from Thermotoga maritima	756	X
7133	Backbone 1H and 15N Chemical Shift Assignments for the CheA P4 domain from Thermotoga maritima, in the context of a P3P4 construct	230	X
7134	DNA recognition by the Brinker nuclear repressor - an extreme case of the coupling between binding and folding	279	X
7135	Assignments of 2SSalpha in 8M urea, pH 2, 293 K	324	X
7136	Assignments of 2SSbeta in 8M urea, pH 2, 293 K	361	X
7137	NMR assignments of the C-terminal domain of insulin-like growth factor binding protein 2 (IGFBP-2)	1155	X
7140	Csk SH2 domain, free form	363	X
7141	SH2 domain of Human Csk, complex with Cbp	388	X
7142	rabbit prion protein (91-228)	1616	X
7144	Chemical shift changes upon ligand binding	39	X
7147	The acute myeloid leukemia fusion protein AML1-ETO targets E-proteins via a PAH-like TAFH domain	1190	X
7149	Characterization of the Molten Globule of Human Serum Retinol-Binding Protein using NMR Spectroscopy	348	X
7150	Chemical Shift Assignments for the talin F3 sub-domain in complex with a chimeric beta3-integrin/PIPKIg peptide	1380	X
7151	Backbone 1H, 13C, and 15N Chemical Shift Assignments for DLC2-SAM	918	X
7152	NMR spectroscopy of T4 Lysozyme peptide fragments	88	X
7153	NMR spectroscopy of T4 Lysozyme peptide fragments	202	X
7154	NMR spectroscopy of T4 Lysozyme peptide fragments	105	X
7155	NMR spectroscopy of T4 Lysozyme peptide fragments	209	X
7156	NMR spectroscopy of T4 Lysozyme peptide fragments	312	X
7157	NMR spectroscopy of T4 Lysozyme peptide fragments	294	X
7158	Molecular characterization of the Ran binding zinc finger domain	384	X
7159	1H chemical shift assignments of 2SS[6-127, 30-115] at pH 3.8 and 25 C	592	X
7160	1H chemical shift assignments of metLYZ at pH 3.8 and 25 C	802	X
7161	Backbone 1H, 13C and 15N Chemical Shift Assignments of Ezrin C ERMAD in a non-covalent complex with Ezrin N FERM	497	X
7162	1H and 15N assignments for the b' domain of ERp57	246	X
7165	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Saccharomyces cerevisiae Urm1	1180	X
7166	1H chemical shift assignments for CgNa an anemone toxin from Condylactis Gigantea	285	X
7167	1H, 15N, 13C resonance assignments for regeneration-induced CNPase homolog (RICH) protein	1932	X
7168	Membrane interactions of dynorphins	225	X
7169	Membrane interactions of dynorphins	114	X
7170	1H, 13C, and 15N Chemical Shift Assignments for Bacillus subtilis Hypothetical Protein yvyC: Northeast Structural Genomics Consortium target SR482	1489	X
7171	Proton chemical shift assignment for tachystatin B1	246	X
7172	Backbone and side-chain 1H, 13C and 15N resonance assignments of C-terminal domain of an actin monomer binding protein twinfilin	1877	X
7173	'Proton chemical shift assignment for tachystatin B2'	247	X
7174	Chemical Shift Assignments for Hdm2 RING finger domain	565	X
7175	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Bacillus Subilis YorP	1000	X
7176	1H Chemical Shift Assignments of an Antimicrobial Peptide, Fowlicidin-3	183	X
7177	Solution structure of alpha-conotoxin Vc1.1	80	X
7178	Solution NMR structure of Q8ZP25 from Salmonella typhimurium LT2.	1184	X
7179	Dispersin Solution Structure	1015	X
7180	NMR structure of UPF0301 PROTEIN SO3346 from Shewanella oneidensis: Northeast Structural Genomics Consortium target SOR39	1667	X
7181	Solution Structure of Hypothetical protein PA4359: Northeast Structural Genomics Target PaT89	848	X
7182	NMR Structure of YcgL, a Conserved Protein from Escherichia coli Representing the DUF709 Family with a Novel a/b/a Sandwich Fold	1133	X
7184	NMR solution structure of CSPsg4	1256	X
7185	An ARC/MEDIATOR subunit required for SREBP gene activation and regulation of cholesterol and fatty acid homeostasis	717	X
7186	Backbone 1H Chemical Shift Assignments for Magi 5	178	X
7187	NMR asigment of Ct-ole e 9, C terminal domain from the olive allergen Ole e 9	1096	X
7188	Im7, Immunity Protein of Colicin E7	720	X
7189	NMR assignments of the low molecular weight protein tyrosine phosphatase from Campylobacter Jejuni	2996	X
7190	The structure and function of a novel two-site calcium-binding fragment of calmodulin	802	X
7191	1H, 13C, and 15N Chemical Shift Assignments for Pseudomonas aeruginosa Hypothetical Protein RPA1041: Northeast Structural Genomics Consortium target Pat90	993	X
7192	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Bacillus Subilis YqaI Dimer	863	X
7193	Sequence specific resonance assignments of a hypothetical protein PA1123 (NESG ID: PaT4) from Pseudomonas aeruginosa	1256	X
7194	Transcription Factor IIIA zinc fingers 4-6 bound to 5S rRNA 55mer	977	X		X
7196	1H and 15N chemical shifts of NH groups in DHFR complexes with brodimoprim analogues 3-5, methotrexate and trimethoprim	303	X
7199	1H and 15N chemical shifts of NH groups in DHFR complexes with brodimoprim analogues 3-5, methotrexate and trimethoprim.	301	X
7200	1H and 15N chemical shifts of NH groups in DHFR complexes with brodimoprim analogues 3-5, methotrexate and trimethoprim	302	X
7201	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Bacillus subtilis YqbF	1365	X
7202	Backbone 1H, 13C, and 15N Chemical Shift Assignments for dSUMO	1010	X
7203	Backbone and sidechain 1H, 15N, and 13C chemical shift assignments for HOP	671	X
7204	Resonance assignments of a CoA binding protein from Klebsiella pneumoniae	1673	X
7205	1H, 13C, and 15N Chemical Shift Assignments for Transmembrane Segment of ErbB4	535	X
7206	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Human RNase 7	1489	X
7207	NMR assignments of the truncated human zeta-COP	1874	X
7208	1H, 13C, 15N Chemical shift assignment for Glycophorine A in bicelles and micelles	906	X
7209	Assignment of 1H, 13C, and 15N resonances for the PilP pilot protein from Neisseria meningitidis.	1301	X
7210	plant homeodomain finger of the tumour suppressor ING4	715	X
7211	1H and 15N Chemical Shift Assignments of Erabutoxin b	448	X
7212	Backbone 1H Chemical Shift Assignments for J1	123	X
7213	Backbone 1H Chemical Shift Assignments for J1cc	115	X
7214	Backbone 1H Chemical Shift Assignments for J3	110	X
7215	Backbone 1H Chemical Shift Assignments for J7	125	X
7216	Backbone 1H, 13C, and 15N Chemical Shift Assignments for yeast triosephosphate isomerase, TIM	959	X
7218	1H, 13C and 15N assignment of the Master-Rep protein nuclease domain from the Faba Bean Necrotic Yellows Virus	1042	X
7219	NMR Data for the Human Ubiquitin-Conjugating Enzyme Variant hUev1a	1898	X
7220	ephrinB2 ectodomain	1515	X
7221	Amide chemical shifts of free and hyaluronan-bound Link_TSG6 at a range of pH values	1321	X
7222	Amide chemical shifts of free and hyaluronan-bound Link_TSG6 at a range of pH values	2492	X
7223	Solution NMR structure of the C-terminal domain of the interferon alpha-inducible ISG15 protein from Homo sapiens. Northeast Structural Genomics target HR2873B	1066	X
7224	Solution NMR structure of Phage-like element PBSX protein xkdW, Northeast Structural Genomics Consortium Target SR355 (CASP Target)	724	X
7225	Solution NMR structure of the UPF0291 protein ynzC from Bacillus subtilis. Northeast Structural Genomics target SR384. (CASP Target)	902	X
7226	Solution NMR Structure of Conserved protein MTH1368, Northeast Structural Genomics Consortium Target TT821A	1184	X
7227	Solution nmr structure of hypothetical protein yppE: Northeast Structural Genomics Consortium Target SR213	1302	X
7228	Solution NMR structure of UPF0107 protein AF_0055, Northeast Structural Genomics Consortium Target GR101 (CASP Target)	1573	X
7229	Solution structure of Brak/CXCL14	914	X
7230	The NMR Structure of an Internal Loop from 23S Ribosomal RNA Differs from its Structure in Crystals of the 50S Ribosomal Subunit	102			X
7231	Solution structure of the heme-binding protein p22HBP	1819	X
7232	Trans-(4-aminomethyl)phenylazobenzoic acid-aPP bound to DPC micelles	239	X
7233	Cis-Azobenzene-avian pancreatic polypeptide bound to DPC micelles and in water	484	X
7234	Backbone 1H, 15N, and 13C assignments for beta phosphoglucomutase in a ternary complex with glucose-6-phosphate and MgF3-	1066	X
7235	Backbone 1H, 15N, and 13C assignments for beta phosphoglucomutase in the open form	928	X
7236	NMR Investigation of Tyr105 Mutants in TEM-1 beta-lactamase Suggests Active-Site Dynamical Coupling	1162	X
7237	NMR Investigation of Tyr105 Mutants in TEM-1 beta-lactamase Suggests Active-Site Dynamical Coupling	744	X
7238	NMR Investigation of Tyr105 Mutants in TEM-1 beta-lactamase Suggests Active-Site Dynamical Coupling	744	X
7239	NMR Investigation of Tyr105 Mutants in TEM-1 beta-lactamase Suggests Active-Site Dynamical Coupling	744	X
7240	Backbone Assignment of the 98kDa homotrimeric yeast PCNA	1269	X
7241	Chromo 2 domain of cpSRP43 complexed with cpSRP54 peptide	514	X
7242	13Ca resonances (100%), 1Ha(99.6%), non-proline backbone 1HN and 15N (94%), and side-chain 13C and 1H (85%) chemical shift assignment for URO-synthase	2561	X
7243	beta-microseminoprotein	1001	X
7244	1H, 15N, 13C', 13CA and 13CB Chemical Shift Assignments of intrinsically disordered gamma-synuclein	614	X
7245	Structural and Functional Characterization of TM VII of the NHE1 Isoform of the Na+/H+ Exchanger	300	X
7246	Backbone assignments of the RUNT domain of the mouse PEBP2alpha protein	284	X
7247	Solution structure of a single chain diiron protein model	1435	X
7248	1H, 13C, 15N Chemical Shift Assignments for Mesd12-155	1632	X
7249	Complete 1H, 13C, and 15N Chemical Shift Assignments for the 15.5K Protein	1602	X
7250	Backbone 1H, 13C, 15N Chemical Shift Assignments for HIV-1 unmyristoylated matrix protein	1342	X
7251	1H chemical shift assignments for wild type p53 tetramerization domain	229	X
7252	1H chemical shift assignments for p53 tetramerization domain mutant T329F Q331K	231	X
7253	1H chemical shift assignments for p53 tetramerization domain mutant T329V Q331K	231	X
7254	1H chemical shift assignments for p53 tetramerization domain mutant Y327S T329G Q331G	216	X
7255	1H chemical shift assignments for p53 tetramerization domain mutant Y327S T329E Q331G	218	X
7256	NMR structure of protein Hydrogenase-1 operon protein hyaE from Escherichia coli: Northeast Structural Genomics Consortium Target ER415	1554	X
7257	Solution structure of the RRM domain of SR rich factor 9G8	1250	X
7258	Structural characterization and oligomerization of PB1-F2, a pro-apoptotic influenza A virus protein	357	X
7259	The solution structure of the BRCT domain from human polymerase reveals homology with the TdT BRCT domain	1164	X
7260	Solution NMR structure of the YjcQ protein from Bacillus subtilis. Northeast Structural Genomics target SR346. (CASP Target)	1024	X
7261	Solution NMR structure of protein ykfF from Escherichia coli. Northeast Structural Genomics target ER397. (CASP Target)	1012	X
7262	NMR assignments of the the N-terminal subdomain of IGFBP-6	271	X
7263	Complete 1H assignment of Meg-A12	280	X
7264	Backbone and Selected Sidechain 1H, 13C, and 15N Chemical Shift Assignments of the beta-1,4-glycosidase Cex from Cellulomonas fimi	1546	X
7266	Chemical shift assignments for protein NE1680 from Nitrosomonas europaea: Northeast Structural Genomics Consortium target NeT5	1018	X
7268	1H, 13C, and 15N Chemical Shift Assignments for the N-terminal Extracellular Domain of Truncated Cadherin	1268	X
7269	1H, 13C, 15N sequence-specific backbone and sidechain resonance assignments for dockerin-containing C-terminal region of the NagH hyaluronidase from Clostridium perfringens	1548	X
7270	1H, 13C, 15N sequence-specific backbone and sidechain resonance assignments for a putative protein-protein interaction module from a family 84 glycoside hydrolase of Clostridium perfringens	1690	X
7271	Backbone and sidechain 1H, 13C and 15N resonance assignments of AF2241 from Archaeoglobus fulgidus	1452	X
7272	Backbone and Side Chains Assignments of RGS10	1629	X
7273	Solution structure of Jingzhaotoxin-III, a novel toxin inhibiting both Nav and Kv channels	230	X
7274	Solution NMR structure of the YdfO protein from Escherichia coli. Northeast Structural Genomics target ER251	1861	X
7276	Complete 1H, 13C and 15N resonance assignments of Blo t 5, a major mite allergen from Blomia tropicalis.	1640	X
7277	Backbone amide chemical shifts for dG85 T. thermophilus RNase H	288	X
7278	Backbone amide chemical shifts for iG80b E. coli RNase H	134	X
7279	NMR resonance assignments of the human non-chromitin architectural transcription factor HMGA1	684	X
7280	1H, 13C, and 15N chemical shift assignments for non-aromatic parts of GB1 domain	594	X
7281	NMR STRUCTURE OF PROTEIN YJBR FROM ESCHERICHIA COLI;NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET ER226	1465	X
7282	Design of a-helical peptide based on conformationally restricted libraries	140	X
7283	The design of the beta-harpin and a-helix tethered by a 4Gly linker using conformationally restricted libraries	185	X
7284	The design of the beta-harpin and a-helix tethered by a 4Gly linker using conformationally restricted libraries	183	X
7285	1H, 13C and 15N assignments for a double dockerin domain	1064	X
7286	Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments for CG7054	2079	X
7287	Backbone and side chain 1H, 13C and 15N Chemical Shift Assignments for human BRD7 bromodomain	1342	X
7288	1H, 13C, 15N Chemical Shift Assignments and 15N Relaxation Data for Transmembrane Domain of BNIP3	482	X
7289	Structural characterization and oligomerization of PB1-F2, a pro-apoptotic influenza A virus protein	289	X
7290	Structural characterization and oligomerization of PB1-F2, a pro-apoptotic influenza A virus protein	351	X
7291	NMR Assignment and Secondary Structure of Coxsackievirus and Adenovirus receptor Domain	995	X
7292	Backbone assignment of internal interaction site of ALP	778	X
7293	Backbone 1H, 13C, and 15N chemical shift assignments for recoverin bound to rhodopsin kinase	946	X
7294	1H and 13C chemical shift assignments for the bacillomycin Lc	96	X
7295	1H chemical shift assignments and 3JHNHa coupling constants for the synthetic analogue SCP of the bacillomycin Lc.	48	X
7296	Solution Conformation of the His 47 to Ala 47 Mutant of Pseudomonas stutzeri ZoBell Ferrocytochrome c-551	564	X
7297	Assignment of conserved hypothetical protein RPA1320 from Rhodopseudomonas Palustris; Northeast Structural Genomics Consortium Target RPT3 / Ontario Center for Structural Proteomics Target RP1313	1160	X
7298	1H, 13C, 15N-NMR resonance assignments for Znf-UBP domain of Ubp-M	1406	X
7299	Mouse Cripto CFC domain solution structure	239	X
7300	Solution Structure of the COMMD1 N-terminal domain	1261	X
7301	Assignment of 1H, 13C, and 15N resonances for SF2/ASF RNA recognition motif 2(RRM2)	1196	X
7302	The PX domain of Sorting Nexin 1 (SNX1)	1434	X
7303	1H, 13C and 15N resonance assignments for proapoptotic protein Nix (1~156) from Danio rerio	1402	X
7304	beta-microseminoprotein	555	X
7305	R21A Spc-SH3 free	467	X
7306	R21A Spc-SH3 bound	471	X
7307	Backbone assignment and RDCs of L11 in complex with RNA	510	X		X
7308	Backbone assignment and RDCs of L11 in complex with RNA and thiostrepton	608	X		X
7309	Backbone 1H, 13C, 15N Chemical Shift Assignments for HIV-1 myristoylated matrix protein	1326	X
7310	Automated structure based backbone and sidechain assignment of mitochondrial Cyclophilin D	1634	X
7311	Backbone 1H, 13C, and 15N and CB Assignments for Rat Islet Amyloid Polypeptide	221	X
7312	1H,13C and 15N resonance assignment of the VHS domain of human STAM1 protein	1072	X
7313	1H, 13C and 15N Backbone Resonance Assignments of the Pactolus I domain	804	X
7314	The backbone chemical shifts of ribosomal protein L11 in the complex with rRNA	892	X		X
7315	The backbone chemical shifts of ribosomal protein L11 in the complex with rRNA and thiostrepton	533	X		X
7316	Backbone 1HN, 15N, and 13C Chemical Shift Assignments for wt Im7* (* denotes his-tag) and its variants, Im7L53AI54A and Im7YY	407	X
7317	Backbone 1HN, 15N, and 13C Chemical Shift Assignments for wt Im7* (* denotes his-tag) and its variants, Im7L53AI54A and Im7YY	325	X
7318	Backbone 1HN, 15N, and 13C Chemical Shift Assignments for wt Im7* (* denotes his-tag) and its variants, Im7L53AI54A and Im7YY	371	X
7319	Polymerase Beta and Double gap double hairpin DNA	1311	X	X
7320	PufX structure	855	X
7321	Complete 1H 13C 15N chemical shift assignments for LDLa module from RXFP1	385	X
7322	Chemical Shift Assignments for calcium-free rat beta-parvalbumin	1287	X
7323	1H, 13C and 15N nmr chemical shift assignments for the colicin immunity protein IM2	974	X
7324	NMR solution structure of mouse SelW	1094	X
7325	Backbone and Ile(d1), Leu and Val Sidechain Resonance Assignments of the NUDIX Domain of Yeast Dcp2	867	X
7326	Homonuclear NMR Assignment of the Pheromone En-1	341	X
7327	Homonuclear NMR Assignment of the Pheromone En-2	389	X
7330	Solution Structure of BmKalphaIT01, an alpha-insect toxin from the Venom of the Chinese Scorpion Buthus martensi Karsch	428	X
7339	Solution structure of Arabidopsis thaliana protein At1g70830, a member of the major latex protein family	1868	X
7340	NMR assignments for a helical diacylglycerol kinase (DAGK), 40 kDa membrane protein from E. coli	424	X
7341	CYCLIC MRIA: AN EXCEPTIONALLY STABLE AND POTENT CYCLIC CONOTOXIN WITH A NOVEL TOPOLOGICAL FOLD THAT TARGETS THE NOREPINEPHRINE TRANSPORTER.	83	X
7342	SOLUTION STRUCTURE OF THE ZN COMPLEX OF HIV-2 NCP(23-49) PEPTIDE, ENCOMPASSING PROTEIN CCHC-LINKER, DISTAL CCHC ZN-BINDING MOTIF AND C-TERMINAL TAIL	184	X
7349	NMR SOLUTION STRUCTURE OF A PROTEIN ASPARTIC ACID PHOSPHATE PHOSPHATASE FROM BACILLUS ANTHRACIS	781	X
7350	NMR SOLUTION STRUCTURE OF A PROTEIN ASPARTIC ACID PHOSPHATE PHOSPHATASE FROM BACILLUS ANTHRACIS	749	X
7351	NMR STRUCTURE OF HUMAN RTF1 PLUS3 DOMAIN.	1828	X
7352	SOLUTION STRUCTURE OF THE ZN COMPLEX OF EIAV NCP11(22-58) PEPTIDE, INCLUDING TWO CCHC ZN-BINDING MOTIFS.	255	X
7354	NMR STRUCTURE OF A PROTEIN-DNA COMPLEX OF AN ALTERED SPECIFICITY MUTANT OF THE LAC REPRESSOR THAT MIMICS THE GAL REPRESSOR	876	X	X
7356	HN,CA,CB Chemical shift assignments for apo-Rat intestinal fatty acid binding protein, Clofibric acid-Rat intestinal fatty acid binding protein complex, Fenofibric acid-Rat intestinal fatty acid binding protein complex and Tolfenamic acid-Rat intestinal fatty acid binding protein complex.	504	X
7357	HN,CA,CB Chemical shift assignments for apo-Rat intestinal fatty acid binding protein, Clofibric acid-Rat intestinal fatty acid binding protein complex, Fenofibric acid-Rat intestinal fatty acid binding protein complex and Tolfenamic acid-Rat intestinal fatty acid binding protein complex.	496	X
7358	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the golli myelin basic protein isoform BG21	1091	X
7359	1H, 15N and 13C chemical shift assignments for reduced and oxidised forms of the DsbA oxidoreductase from Vibrio cholerae	1865	X
7360	1H, 15N and 13C chemical shift assignments for reduced and oxidised forms of the DsbA oxidoreductase from Vibrio cholerae	1865	X
7361	SOLUTION STRUCTURE OF A LINEAR ANALOG OF THE SQUASH TRYPSIN INHIBITOR MCOTI-II, NMR, 30 STRUCTURES.	280	X
7362	NMR Structure of Protein UPF0165 protein AF_2212 from Archaeoglobus Fulgidus; Northeast Structural Genomics Consortium Target GR83	768	X
7364	Solution Structure of Variable-type Domain of Human Receptor for Advanced Glycation Endproducts	1037	X
7365	Solution structure of Fe65 WW domain	494	X
7366	Solution Structure of Putative periplasmic protein: Northest Structural Genomics Target StR106	874	X
7367	Solution structure of a Beta-Hairpin Peptidomimetic Inhibitor of the BIV Tat-Tar Interaction	103	X
7370	Backbone 1H and 15N chemical shift assignments of D. crassirhizoma Plastocyanin	190	X
7371	Solution NMR Structure: Northeast Structural Genomics Consortium Target SiR5	1195	X
7375	Backbone chemical shifts assignment of the soluble N-terminal region of the ATP7A	1135	X
7376	Resonance assignments of the metal sensor CzrA in the apo-, Zn2- and DNA-bound (42 kDa) states	730	X
7377	Resonance assignments of the metal sensor CzrA in the apo-, Zn2- and DNA-bound (42 kDa) states	745	X	X
7381	Calcium binding protein in the free form	1464	X
7382	NMR Structure of RRM-2 of Yeast NPL3 Protein	988	X
7383	NMR Structure of RRM-1 of Yeast NPL3 Protein	809	X
7386	Engrailed homeodomain helix-turn-helix motif	546	X
7387	PIPdim 18	111	X
7388	sPLA2 inhibitor pip 17	79	X
7389	sPLA2 inhibitor 9	51	X
7390	Solution model of crosslinked complex of cytochrome c and adrenodoxin	292	X
7391	Electrostatic contributions to the stability of the GCN4 leucine zipper structure.	188	X
7395	Solution Structure of RWD/GI domain of Saccharomyces cerevisiae GCN2	1473	X
7396	Solution Structure of ETO-TAFH refined in explicit solvent	1301	X
7401	Full-sequence computational design and solution structure of a thermostable protein variant	1389	X
7402	Spatial Structure and Membrane Permeabilization for Latarcin-1, a Spider Antimicrobial Peptide	162	X
7406	NMR resonance assignment of the Ccc2ab protein	503	X
7407	Backbone 1H, 13C, and 15N Chemical Shift Assignments for MxiD in complex with MxiM	150	X
7408	Mapping intramolecular interactions between domains in HMGB1 using a tail-truncation approach	340	X
7409	Mapping intramolecular interactions between domains in HMGB1 using a tail-truncation approach	350	X
7410	Mapping intramolecular interactions between domains in HMGB1 using a tail-truncation approach	352	X
7411	Mapping intramolecular interactions between domains in HMGB1 using a tail-truncation approach	348	X
7412	Mapping intramolecular interactions between domains in HMGB1 using a tail-truncation approach	350	X
7413	Mapping intramolecular interactions between domains in HMGB1 using a tail-truncation approach	356	X
7414	Evidence of reciprocical reorientation of the catalytic and hemopexin-like domains of full-length MMP-12	2173	X
7416	Solution structure of CaM complexed to DRP1p	521	X
7417	Solution structure of CaM complexed to DRP1p	481	X
7418	Solution structure of CaM complexed to DRP1p	585	X
7419	SOLUTION STRUCTURE OF AMINO TERMINAL DOMAIN OF HUMAN DNA POLYMERASE EPSILON SUBUNIT B REVEALS ITS HOMOLOGY TO C-DOMAINS OF AAA PROTEINS.	1122	X
7420	STRUCTURE OF CCP MODULE 7 OF COMPLEMENT FACTOR H- THE AMD AT RISK VARIENT (402H)	782	X
7421	STRUCTURE OF CCP MODULE 7 OF COMPLEMENT FACTOR H- THE AMD NOT AT RISK VARIENT (402Y)	794	X
7422	Pseudo Contact shifts and RDCs of Galectin-3 with C-terminal LBT tagged at a proton frequency of 600MHz.	34	X
7423	Solution structure of CaM complexed to DAPk peptide	623	X
7424	Solution structure of CaM complexed to DAPk peptide	457	X
7425	Solution structure of CaM complexed to DAPk peptide	441	X
7426	Yersinia pseudotuberculosis type III secretion effector YopE.	470	X
7427	Yersinia pseudotuberculosis type III secretion effector YopE.	258	X
7428	Local and global structure of the monomeric subunit of the potassium channel KcsA probed by NMR	562	X
7429	Backbone 1H and 15N Chemical Shift Assignments for the Phosphotyrosine Binding Domain of Insulin Receptor Substrate 1 in the Apo and Phosphopeptide Bound Forms	196	X
7430	Solution structure of Reduced ERp18	601	X
7432	Structural characterization of IscU and its interaction with HscB	419	X
7433	Extracellular CD147 (EMMPRIN): Isoform -3	387	X
7434	Backbone assignment of 3F5 heavy chain antibody fragment in its free form and in complex with PABPN1	459	X
7435	HVS ORF57 8-120 backbone assignment, in complex with REF2-I 54-155.	208	X
9500	Structure of actin-interacting domain of troponin	188	X
10001	A high resolution structure of mastoparan-X strongly bound to lipid-bilayer membrane determined by solid-state NMR	93	X
10002	F-spondin TSR 4	662	X
10004	1H, 13C and 15N resonance assignments of the 2'-5' RNA ligase-like protein from Pyrococcus furiosus	2530	X
10005	1H, 13C, and 15N Chemical Shift Assignments for ChitinaseC chitin binding domain	550	X
10006	SOLUTION STRUCTURE OF FIBRONECTIN TYPE III DOMAIN OF MOUSE HYPOTHETICAL PROTEIN	1389	X
10008	Solution structure of C-terminal fibronectin type III domain of mouse 1700129L13Rik protein	1302	X
10009	Solution structure of SH3 domain of mouse Kalirin-9a protein	799	X
10010	bovine beta-lactoglobulin A34C mutant	757	X
10011	SOLUTION STRUCTURE OF THE SWIRM DOMAIN OF HUMAN LSD1	1472	X
10012	Structure of actin-interacting domain of troponin	584	X
10013	Solution Structure Of The Ring Finger Domain Of The Human Kiaa1045 Protein	935	X
10014	Assignments of a GAAG tetraloop in helix 6 of SRP RNA from Pyrococcus furiosus	64			X
10015	Assignments of a HIV-1 integrase Zn finger domain mutant	360	X
10016	Backbone 1H, 13C and 15N Chemical Shift Assignments for the Nucleotide-Free Form of Human ABCB6 C-Terminal Domain	1752	X
10017	Backbone 1H, 13C and 15N Chemical Shift Assignments for the ADP-BOUND Form of Human ABCB6 C-Terminal Domain	1857	X
10018	1H Chemical Shift Assignments for LINE RNA	178			X
10019	GSPT1/eRF3a(PAM2-1)-PABC complex	1008	X
10021	Backbone and sidechain 13C and 15N Chemical Shift Assignments of H+-ATP synthase subunit c in the solid state	299	X
10022	3D Structure of amyloid protofibrils of beta2-microglobulin fragment probed by solid-state NMR	139	X
10023	Chemical shift assignment of human eIF2alpha	1945	X
10024	Chemical shift assignments for the Rhodobacter sphaeroides PufX membrane protein	559	X
10025	Solution structure of kinase associated domain 1 of mouse MAP/microtubule affinity-regulating kinase 3	1234	X
10026	Solution structure of kinase associated domain 1 of mouse MAP/microtubule affinity-regulating kinase 3	1564	X
10027	chemical shift assignment of DnaA domain I-II	1302	X
10028	Solution structure of the second WW domain from mouse salvador homolog 1 protein (mm45).	492	X
10029	Solution structure of the fifth PDZ domain of human membrane associated guanylate kinase inverted-2 (KIAA0705 protein)	1178	X
10030	Solution structure of the forth CH domain from human plastin 3 T-isoform	1474	X
10031	Solution structure of the 2nd mbt domain from human KIAA1617 protein	1561	X
10032	Solution structure of the first mbt domain from human KIAA1798 protein	1474	X
10033	Soluiotn structure of J-domain of mouse DnaJ like protein	1131	X
10034	Solution structure of Fibronectin type III domain derived from human KIAA0970 protein	1618	X
10035	Solution structure of Lectin C-type domain derived from a hypothetical protein from C. elegans	1760	X
10036	Solution structure of mouse CGI-38 protein	1766	X
10037	Solution structure of the third mbt domain from human KIAA1798 protein	1189	X
10038	Solution structure of zf-C2H2 domains from human Zinc finger protein 295	1242	X
10039	Solution Structure of the Pleckstrin Homology Domain of Mouse Ethanol Decreased 4 Protein	1345	X
10040	Solution Structure of the RA Domain of Human Grb7 Protein	1096	X
10041	Solution Structure of the Tudor Domain from Mouse Hypothetical Protein Homologous to Histone Acetyltransferase	1399	X
10042	Solution Structure of the CS Domain of Human KIAA1068 Protein	1464	X
10043	Solution Structure of the N-terminal Domain of Mouse Putative Signal Recoginition Particle 54 (SRP54)	1193	X
10044	Solution structure of homeobox domain of Arabidopsisthaliana zinc finger homeobox family protein	884	X
10045	Solution structure of homeobox domain of Arabidopsis thaliana hypothetical protein F22K18.140	918	X
10046	Solution structure of the PB1 domain of mouse mitogen activated protein kinase kinase 5 (MAP2K5)	1324	X
10047	Solution Structure of the Homeobox Domain of Human Homeodomain Leucine Zipper-Encoding Gene (Homez)	916	X
10048	Solution Structure of the UBA Domain of Human Tudor Domain Containing Protein 3	675	X
10049	Solution structure of the N-terminal Domain I of mouse transcription elongation factor S-II protein 3	1248	X
10050	Solution structure of N-terminal ubiquitin-like domain of human NEDD8 ultimate buster-1	1150	X
10051	Backbone 1H and 15N assignment for the human c-Ha Ras (Y32W) in the GDP-bound state	344	X
10052	characterization of PCP-0SH in the D1 state was examined by using H/D exchange experiments.	1105	X
10053	Backbone 1H, 13C, and 15N assignments of a 59 kDa Salmonella typhimurium periplasmic oligopeptide binding protein OppA	2240	X
10054	Solution structure of the first cold-shock domain of the human KIAA0885 protein (UNR protein)	1062	X
10055	Solution Structure of Glia Maturation Factor-gamma from Mus Musculus	1936	X
10056	Solution structure of the Ras-binding domain of mouse RGS14	1173	X
10057	Solution structure of Iron-sulfur cluster protein U (IscU)	1484	X
10058	Solution Structure of the PICOT homology 2 domain of the mouse PKC-interacting cousin of thioredoxin protein	1277	X
10059	Solution Structure of the Band 7 Domain of the mouse Flotillin 2 Protein	1754	X
10060	Solution structure of hypothetical protein C330018D20Rik from Mus musculus	1227	X
10061	Solution structure of PDZ domain of mouse Cypher protein	1064	X
10062	Backbone 1H and 15N Chemical Shift Assignments for Nedd8	144	X
10063	Solution structure of the fourth SH3 domain of human intersectin 2 (KIAA1256)	860	X
10064	Solution Structure of The forth PDZ Domain of Human Atrophin-1 Interacting Protein 1 (KIAA0705 Protein)	1335	X
10065	Solution structure of the SAND domain of the putative nuclear protein homolog (5830484A20Rik)	1092	X
10066	Solution structure of the third PDZ domain of human KIAA1526 protein	1154	X
10067	Solution Structure of The FHA Domain of Arabidopsis thaliana Hypothetical Protein	1347	X
10068	Solution Structure of the CH domain from Mouse Trangelin	1744	X
10069	Solution structure of the Villin headpiece domain of human actin-binding LIM protein homologue (KIAA0843 protein)	1120	X
10070	Solution structure of RRM domain in heterogeneous nuclear ribonucleoprotein H'	1085	X
10071	Solution structure of RRM domain in RNA-binding protein NP_057951	1251	X
10072	Solution structure of RRM domain in HNRPC protein	1070	X
10073	C2 domain-containing protein from putative elicitor-responsive gene	1617	X
10074	The first C2 domain of human synaptotagmin XIII	1536	X
10075	The fourth FN3 domain of human sidekick-2	1349	X
10076	The eighth FN3 domain of human sidekick-2	1535	X
10077	Solution structure of the RNA binding domain of eukaryotic initiation factor 4B	1155	X
10078	Backbone Resonance Assignments for LolA	839	X
10079	Solution structure of putative domain of human KIAA0561 protein	1267	X
10080	Solution structure of mouse putative 42-9-9 protein	1586	X
10081	Solution structure of the PDZ domain of mouse Rhophilin-2	1205	X
10082	Solution structure of RRM domain in calcipressin 1	1209	X
10083	PDZ domain of human RIM2B	1596	X
10084	Nuclear move domain of nuclear distribution gene C homolog	1680	X
10085	Solution structure of the first RRM domain in heterogeneous nuclear ribonucleoprotein H	1185	X
10086	RA domain of guanine nucleotide exchange factor for Rap1	1190	X
10087	Solution structure of C-terminal ubiquitin like domain of human 2'-5'-oligoadenylate synthetase-like protain (p59 OASL)	985	X
10088	Solution structure of the second PDZ domain of human scribble (KIAA0147 protein)	1109	X
10089	Solution structure of phosphotyrosine interaction domain of mouse Numb protein	1866	X
10090	Solution structure of hypothetical protein F20O9.120 from Arabidopsis thaliana	1651	X
10091	Solution structure of the C-terminal ubiquitin-like domain of mouse tubulin-specific chaperone e	1207	X
10092	Solution structure of the DEATH domain of Interleukin-1 receptor-associated kinase4 (IRAK4) from Mus musculus	1500	X
10093	Solution structure of the second CUT domain of human Homeobox protein Cux-2	1233	X
10094	Solution structure of the third CUT domain of human Homeobox protein Cux-2	1299	X
10095	Solution structure of the KH domain of human ribosomal protein S3	1015	X
10096	Backbone Resonance Assignments for LolB	794	X
10097	Solution Structure of the SH3 Domain Binding Glutamic Acid-rich Protein Like 3	1236	X
10098	Solution Structure of The C1 Domain of The Human Diacylglycerol Kinase Delta	899	X
10099	Solution Structure of the First Fibronectin Type III domain of human KIAA1568 Protein	1359	X
10100	Solution Structure of The Third PDZ Domain of Human Atrophin-1 Interacting Protein 1 (KIAA0705 Protein)	1152	X
10101	Solution structure of four helical up-and-down bundle domain of the hypothetical rotein 2610208M17Rik similar to the protein FLJ12806	1516	X
10102	Solution structure of the second fibronectin Type III domain of human KIAA1568 protein	1430	X
10103	Solution structure of the fourth PDZ domain of human scribble (KIAA0147 protein)	1229	X
10104	The forkhead associated (FHA) domain like structure from mouse polynucleotide kinase 3'-phosphatase	1438	X
10105	Solution structure of the SWIB/MDM2 domain of the hypothetical protein At5g14170 from Arabidopsis thaliana	1058	X
10106	Solution structure of the SWIB/MDM2 domain of the hypothetical protein At5g08430 from Arabidopsis thaliana	1240	X
10107	Solution structure of the CH domain from mouse EB-1	1498	X
10108	Solution Structure of DC1 Domain of PDI-like Hypothetical Protein from Arabidopsis thaliana	974	X
10109	Solution Structure of the PDZ Domain from Mouse Glutamate Receptor Interacting Protein 1A-L (GRIP1) Homolog	1323	X
10110	Solution Structure of the Gas2 Domain of the Growth Arrest Specific 2 Protein	1076	X
10111	Solution structure of the 6th HMG box of mouse UBF1	1273	X
10112	Solution structure of the ubiquitin domain from mouse D7Wsu128e protein	1158	X
10113	Solution Structure of the Pleckstrin Homology Domain of Mouse APS	1590	X
10114	Solution Structure of the C-terminal Pleckstrin Homology Domain of Sbf1 from Mouse	1423	X
10115	Solution Structure of the Pleckstrin Homology Domain of Oxysterol-Binding Protein-Related Protein 8 (KIAA1451 Protein)	1620	X
10116	The Confirmation of the Denatured Structure of Pyrrolidone Carboxyl Peptidase under Non denaturing Conditions: Helix Propensity of wild-type H6-peptide	117	X
10117	The Confirmation of the Denatured Structure of Pyrrolidone carboxyl Peptidase under Non denaturing Conditions: Deference in Helix Propensity of Two Synthetic Peptides with Single Amino Acid Substitution	117	X
10118	1H 13C and 15N Chemical Shift Assignments for C-terminal domain of PH0471	896	X
10119	DnaJ domain of human KIAA0730 protein	1078	X
10120	Solution structure of immunoglobulin like domain of mouse nuclear lamin	1648	X
10121	Solution structure of a putative peptidyl-tRNA hydrolase domain in a mouse hypothetical protein	1312	X
10122	Solution structure of the second SH3 domain of human intersectin 2 (KIAA1256)	873	X
10123	Solution structure of the PWWP domain of mouse Hepatoma-derived growth factor, related protein 3	1173	X
10124	Solution structure of the second PDZ domain of human membrane associated guanylate kinase inverted-2 (MAGI-2)	1075	X
10125	Solution structure of the dsRBD from hypothetical protein BAB26260	1528	X
10126	Solution structure of the R3H domain from human hypothetical protein BAA76846	1490	X
10127	Solution structure of the alpha-helical domain from mouse hypothetical PNPase	1191	X
10128	Solution structure of the second FNIII domain of DSCAML1 protein	1432	X
10129	Solution structure of the first Fn3 domain of Sidekick-2 protein	1438	X
10130	Solution structure of a novel beta-grasp fold like domain of Hypothetical protein (Arabidopsis thaliana)	1305	X
10131	Solution Structure of the N-terminal Pleckstrin Homology Domain Of TAPP2 from Mouse	1519	X
10132	1H and 15N assignment of oxidized Pseudomonas aeruginosa cytochrome c551	148	X
10133	1H and 15N assignment of reduced Pseudomonas aeruginosa cytochrome c551	150	X
10134	1H and 15N assignment of oxidized Hydrogenobacter thermophilus cytochrome c552	146	X
10135	1H and 15N assignment of reduced Hydrogenobacter thermophilus cytochrome c552	150	X
10136	Solution structure of the first SH3 domain of human intersectin2 (KIAA1256)	1060	X
10137	Lipocalin-type Prostaglandin D synthase	1132	X
10138	Solution structure of the N-terminal domain of RimM from Thermus thermophilus HB8	1093	X
10139	Backbone NMR assignments of RimM from Thermus thermophilus	685	X
10140	Backbone NMR assignments of of RimM complexed with rS19	438	X
10141	Solution structure of the alpha adaptinC2 domain from human Adapter-related protein complex 1 gamma 2 subunit	1639	X
10142	Solution structure of the N-terminal extended 20th Filamin domain from human Filamin-B	1193	X
10143	Solution structure of the 14th filamin domain from human Filamin-B	1324	X
10144	Solution structure of the RhoGAP domain from human Rho GTPase activating protein 5 variant	2684	X
10145	Solution structure of the N-teruminus extended RhoGAP domain from human Rho GTPase activating protein 5 variant	2787	X
10146	Solution structure of the 21th filamin domain from human Filamin-B	1118	X
10147	Solution structure of the CH domain from human Sperm flagellar protein 1	1595	X
10148	Solution structure of three zf-C2H2 domains from mouse protein odd-skipped-related 2 splicing isoform 2	1224	X
10149	Solution structure of the CH domain from human MICAL-2	1487	X
10150	Solution structure of the SANT domain of fission yeast SPCC24B10.08c protein	665	X
10151	Solution structure of the C2H2 type zinc finger (region 887-919) of human Zinc finger protein 268	372	X
10152	Solution structure of the C2H2 type zinc finger (region 495-525) of human Zinc finger protein 268	437	X
10153	Solution structure of the C2H2 type zinc finger (region 519-551) of human Zinc finger protein 484	415	X
10154	Solution structure of the C2H2 type zinc finger (region 557-589) of human Zinc finger protein 473	452	X
10155	Solution structure of the C2H2 type zinc finger (region 603-635) of human Zinc finger protein 484	427	X
10156	Solution structure of the C2H2 type zinc finger (region 715-747) of human Zinc finger protein 484	410	X
10157	Solution structure of the C2H2 type zinc finger (region 626-654) of human B-cell lymphoma 6 protein	403	X
10158	Solution structure of the C2H2 type zinc finger (region 370-400) of human Zinc finger protein 473	412	X
10159	Solution structure of the 16th filamin domain from human Filamin-B	1111	X
10160	Solution structure of the 17th filamin domain from human Filamin-B	1296	X
10161	Solution structure of the 22th filamin domain from human Filamin-B	1201	X
10162	Solution structure of the 23th filamin domain from human Filamin-B	1283	X
10163	Solution structure of the 24th filamin domain from human Filamin-B	1160	X
10164	Solution structure of the A1pp domain from human protein C6orf130	1821	X
10165	Solution structure of the CBM_21 domain from human protein phosphatase 1, regulatory (inhibitor) subunit 3B	1906	X
10166	Solution structure of the C2H2 type zinc finger (region 637-667) of human Zinc finger protein 268	419	X
10167	Solution structure of the C2H2 type zinc finger (region 584-616) of human Zinc finger protein 28 homolog	419	X
10168	Solution structure of the C2H2 type zinc finger (region 640-672) of human Zinc finger protein 28 homolog	431	X
10169	Solution structure of the C2H2 type zinc finger (region 171-203) of human Zinc finger protein 224	378	X
10170	Solution structure of the C2H2 type zinc finger (region 415-447) of human Zinc finger protein 28 homolog	417	X
10171	Solution structure of the C2H2 type zinc finger (region 311-343) of human Zinc finger protein 224	416	X
10172	Solution structure of the C2H2 type zinc finger (region 395-427) of human Zinc finger protein 224	366	X
10173	Solution structure of the C2H2 type zinc finger (region 592-624) of human Zinc finger protein 347	409	X
10174	Solution structure of the C2H2 type zinc finger (region 340-372) of human Zinc finger protein 347	396	X
10175	Solution structure of the C2H2 type zinc finger (region 556-588) of human Zinc finger protein 28 homolog	390	X
10176	Solution structure of the C2H2 type zinc finger (region 696-728) of human Zinc finger protein 28 homolog	378	X
10177	Solution structure of the C2H2 type zinc finger (region 687-719) of human Zinc finger protein 484	399	X
10178	Solution structure of the C2H2 type zinc finger (region 204-236) of human Zinc finger protein 473	407	X
10179	Solution structure of the C2H2 type zinc finger (region 724-756) of human Zinc finger protein 28 homolog	411	X
10180	Solution structure of the C2H2 type zinc finger (region 339-371) of human Zinc finger protein 224	420	X
10181	Solution structure of the C2H2 type zinc finger (region 367-399) of human Zinc finger protein 224	424	X
10182	Solution structure of the C2H2 type zinc finger (region 725-757) of human Zinc finger protein 473	402	X
10183	Solution structure of the C2H2 type zinc finger (region 379-411) of human Zinc finger protein 484	421	X
10184	Solution structure of the C2H2 type zinc finger (region 463-495) of human Zinc finger protein 484	454	X
10185	Solution structure of the C2H2 type zinc finger (region 607-639) of human Zinc finger protein 268	443	X
10186	Solution structure of the C2H2 type zinc finger (region 369-401) of human Zinc finger protein 95 homolog	431	X
10187	Solution structure of the C2H2 type zinc finger (region 479-511) of human Zinc finger protein 224	413	X
10188	Solution structure of the C2H2 type zinc finger (region 564-596) of human Zinc finger protein 347	426	X
10189	Solution structure of the C2H2 type zinc finger (region 341-373) of human Zinc finger protein 95 homolog	439	X
10190	Solution structure of the C2H2 type zinc finger (region 425-457) of human Zinc finger protein 95 homolog	422	X
10191	Solution structure of the C2H2 type zinc finger (region 719-751) of human Zinc finger protein 268	428	X
10192	Solution structure of the C2H2 type zinc finger (region 283-315) of human Zinc finger protein 224	418	X
10193	Solution structure of the Myb-like DNA-binding domain of human ZZZ3 protein	870	X
10194	Solution structure of the SH3 domain of mouse RUN and TBC1 domain containing 3	881	X
10195	Solution structure of the second SH3 domain of human Vinexin	1009	X
10196	Solution structure of the C2H2 type zinc finger (region 768-800) of human Zinc finger protein 95 homolog	391	X
10197	Solution structure of the C2H2 type zinc finger (region 199-231) of human Zinc finger protein 224	410	X
10198	Solution structure of the C2H2 type zinc finger (region 423-455) of human Zinc finger protein 224	460	X
10199	Solution structure of the C2H2 type zinc finger (region 312-344) of human Zinc finger protein 347	413	X
10200	Solution structure of the C2H2 type zinc finger (region 342-372) of human Zinc finger protein 473	426	X
10201	Solution structure of the C2H2 type zinc finger (region 641-673) of human Zinc finger protein 473	434	X
10202	Solution structure of the C2H2 type zinc finger (region 491-523) of human Zinc finger protein 484	451	X
10203	Solution structure of the C2H2 type zinc finger (region 547-579) of human Zinc finger protein 484	445	X
10204	Solution structure of the C2H2 type zinc finger (region 612-644) of human Zinc finger protein 28 homolog	422	X
10205	Solution structure of the C2H2 type zinc finger (region 668-70) of human Zinc finger protein 28 homolog	441	X
10206	Solution structure of the C2H2 type zinc finger (region 780-812) of human Zinc finger protein 28 homolog	415	X
10207	Solution structure of the C2H2 type zinc finger (region 368-400) of human Zinc finger protein 347	403	X
10208	Solution structure of the C2H2 type zinc finger (region 315-345) of human Zinc finger protein 473	404	X
10209	Solution structure of the C2H2 type zinc finger (region 809-841) of human Zinc finger protein 473	424	X
10210	Solution structure of the C2H2 type zinc finger (region 528-560) of human Zinc finger protein 28 homolog	423	X
10211	Solution structure of the SH3 domain of human Tyrosine-protein kinase ITK/TSK	1010	X
10212	Solution structure of the SH3 domain of the human SRC-like adopter protein (SLAP)	847	X
10213	Solution structure of the GUCT domain from human ATP-dependent RNA helicase DDX50, DEAD box protein 50	1078	X
10214	Solution structure of the second WW domain from the human membrane-associated guanylate kinase, WW and PDZ domain-containing protein 1. MAGI-1	679	X
10215	Solution structure of the short-isoform of the second WW domain from the human membrane-associated guanylate kinase, WW and PDZ domain-containing protein 1 (MAGI-1)	536	X
10216	Solution structure of the C2H2 type zinc finger (region 411-441) of human Zinc finger protein 268	408	X
10217	Solution structure of the C2H2 type zinc finger (region 693-723) of human Zinc finger protein 268	416	X
10218	Solution structure of the C2H2 type zinc finger (region 355-385) of human Zinc finger protein 268	396	X
10219	Solution structure of the C2H2 type zinc finger (region 441-469) of human Zinc finger protein 268	424	X
10220	Solution structure of the C2H2 type zinc finger (region 397-429) of human Zinc finger protein 95 homolog	418	X
10221	Solution structure of the C2H2 type zinc finger (region 255-287) of human Zinc finger protein 224	425	X
10222	Solution structure of the C2H2 type zinc finger (region 775-807) of human Zinc finger protein 268	408	X
10223	Solution structure of the C2H2 type zinc finger (region 760-792) of human Zinc finger protein 347	406	X
10224	Solution structure of the C2H2 type zinc finger (region 859-889) of human Zinc finger protein 268	415	X
10225	Solution structure of the C2H2 type zinc finger (region 301-331) of human Zinc finger protein 268	448	X
10226	Solution structure of the C2H2 type zinc finger (region 273-303) of human Zinc finger protein 268	415	X
10227	Solution structure of the C2H2 type zinc finger (region 551-583) of human Zinc finger protein 268	414	X
10228	Solution structure of the C2H2 type zinc finger (region 628-660) of human Zinc finger protein 95 homolog	405	X
10229	Solution structure of the C2H2 type zinc finger (region 385-413) of human Zinc finger protein 268	409	X
10230	Solution structure of the C2H2 type zinc finger (region 563-595) of human Zinc finger protein 224	415	X
10231	Solution structure of the C2H2 type zinc finger (region 598-626) of human B-cell lymphoma 6 protein	397	X
10232	Solution structure of the C2H2 type zinc finger (region 796-828) of human Zinc finger protein 95 homolog	440	X
10233	Solution structure of the C2H2 type zinc finger (region 284-316) of human Zinc finger protein 347	470	X
10234	Solution structure of the C2H2 type zinc finger (region 648-680) of human Zinc finger protein 347	412	X
10235	Solution Structure of the C-terminal Phosphotyrosine Interaction Domain of APBB2 from Mouse	1594	X
10236	Structure of the C-terminal PID Domain of Fe65L1 Complexed with the Cytoplasmic Tail of APP Reveals a Novel Peptide Binding Mode	1775	X
10237	Solution structure of the chimera of the C-terminal PID domain of Fe65L and the C-terminal tail peptide of APP	2053	X
10238	Solution structure of the chimera of the C-terminal tail peptide of APP and the C-terminal PID domain of Fe65L	1970	X
10239	Solution structure of the chimera of the C-terminal tail peptide of APP and the C-terminal PID domain of Fe65L	2056	X
10240	Solution structures of the SH3 domain of human Src substrate cortactin	890	X
10241	Solution structures of the SH3 domain of human rho guanine exchange factor (GEF) 16	894	X
10242	Solution structures of the PDZ domain of human Interleukin-16	1314	X
10243	Solution structures of the C2H2 type zinc finger domain of human Zinc finger protein 24	741	X
10244	Solution structures of the C2H2 type zinc finger domain of human Zinc finger protein 462	899	X
10245	Solution structures of the SH3 domain of human megakaryocyte-associated tyrosine-protein kinase.	870	X
10246	Solution structures of the C2H2 type zinc finger domain of human Transcriptional repressor CTCF	883	X
10247	Solution structures of the LIM domain of human NEDD9 interacting protein with calponin homology and LIM domains	844	X
10248	Solution Structure of the HMG_box Domain of Murine Bobby Sox Homolog	920	X
10249	Solution structure of the C-terminal PH domain of human pleckstrin	1550	X
10250	Solution structure of the PH domain of human Docking protein BRDG1	1873	X
10251	Solution structure of the C-terminal PH domain of human pleckstrin 2	1529	X
10252	Solution structure of the HMG_box domain of thymus high mobility group box protein TOX from mouse	1083	X
10253	Solution structure of the PH domain of protein kinase C, D2 type from human	1420	X
10254	Solution structure of the C-terminal PH domain of FYVE, RhoGEF and PH domain containing protein 3 (FGD3) from human	1273	X
10255	Solution structure of the N-terminal PH domain of ARAP2 protein from human	1297	X
10256	Solution structure of the C-terminal PH domain of hypothetical protein KIAA1914 from human	1213	X
10257	Solution structures of the C2H2 type zinc finger domain of human zinc finger BED domain containing protein 2	764	X
10258	Solution structures of the fn3 domain of human ephrin type-B receptor 1	1264	X
10259	Solution structures of the PDZ domain of human unnamed protein product	1153	X
10260	Solution structures of the fn3 domain of human receptor-type tyrosine-protein phosphatase F	1137	X
10261	Solution structures of the WHEP-TRS domain of human methionyl-tRNA synthetase	839	X
10262	Solution structures of the fn3 domain of human collagen alpha-1(XX) chain	1121	X
10263	Solution structures of the 6th fn3 domain of human receptor-type tyrosine-protein phosphatase F	1245	X
10264	The solution structure of the VHS domain of human Signal transducing adaptor molecule 2	1919	X
10265	Solution structures of the fn3 domain of human receptor-type tyrosine-protein phosphatase F	1436	X
10266	Solution structures of the fn3 domain of human receptor-type tyrosine-protein phosphatase F	1213	X
10267	Solution structures of the PDZ domain of mus musculus PDZ domain-containing protein 1	1374	X
10268	Solution structures of the CA domain of human protocadherin 9	1341	X
10269	Solution structures of the Chromo domain of human chromodomain helicase-DNA-binding protein 4	780	X
10270	Solution structures of the fn3 domain of human contactin 1	1362	X
10271	Solution structures of the fn3 domain of human collagen alpha-1(XX) chain	1106	X
10272	Solution structures of the SH3 domain of human KIAA0418	873	X
10273	Solution structures of the TGS domain of human developmentally-regulated GTP-binding protein 1	1121	X
10274	Solution structures of the fn3 domain of human collagen alpha-1(XX) chain	1128	X
10275	Solution structures of the PAAD_DAPIN domain of mus musculus interferon-activatable protein 205	1116	X
10276	Solution structure of the Tudor domain of Tudor domain containing protein 3 from mouse	879	X
10277	Solution structure of the Chromo domain of chromobox homolog 2 from human	870	X
10278	Solution structure of the PH domain of Pleckstrin homology domain-containing protein family B member 1 from mouse	1462	X
10279	Solution structure of the PH domain of Docking protein 2 from human	1436	X
10280	Solution structure of the PH domain of Oxysterol binding protein-related protein 11 from human	1386	X
10281	Solution structure of the homeobox domain of the human paired box protein Pax-6	871	X
10282	Solution structure of the homeobox domain of the human hypothetical protein FLJ21616	1050	X
10283	Solution structure of the first homeobox domain of AT-binding transcription factor 1 (ATBF1)	794	X
10284	Solution structure of the second homeobox domain of AT-binding transcription factor 1 (ATBF1)	791	X
10285	Solution structure of the third homeobox domain of AT-binding transcription factor 1 (ATBF1)	939	X
10286	Solution structure of the homeobox domain of the hypothetical protein, DKFZp686K21156	893	X
10287	Solution structure of the second homeobox domain of Zinc fingers and homeoboxes protein 3 (Triple homeobox 1 protein)	841	X
10288	Solution structure of the homeobox domain of Hepatocyte nuclear factor 1-beta (HNF-1beta)	1123	X
10289	Solution structure of the homeobox domain of Zinc finger homeobox protein 1b (Smad interacting protein 1)	798	X
10290	The solution structure of the homeobox domain of human Homeobox protein DLX-5	775	X
10291	The solution structure of the homeobox domain of human homeobox protein TGIF2LX	884	X
10292	Solution structure of the third homeobox domain of Zinc fingers and homeoboxes protein 2	938	X
10293	Solution structure of the homeobox domain of LIM/homeobox protein Lhx9	863	X
10294	Solution structure of the homeobox domain of Homeobox protein OTX2	794	X
10295	Solution structure of the homeobox domain of Homeobox protein BarH-like 1	869	X
10296	Solution structure of the homeobox domain of Homeobox protein goosecoid	766	X
10297	Solution structure of the homeobox domain from human NIL-2-A zinc finger protein, transcription factor 8	744	X
10298	structure of the third Homeodomain from the human homeobox and leucine zipper protein, Homez	752	X
10299	Solution structures of the fn3 domain of human Tripartite motif protein 9	1193	X
10300	Solution structures of the fn3 domain of human Proto-oncogene tyrosine-protein kinase MER precursor	1398	X
10301	Solution structures of the SH3 domain of human Crk-like protein	915	X
10302	Solution structures of the SH3 domain of human SH3-containing GRB2-like protein 2	808	X
10303	Solution structure of the C2H2 type zinc finger (region 752-784) of human Zinc finger protein 28 homolog	427	X
10304	Solution structure of the C2H2 type zinc finger (region 544-576) of human Zinc finger protein 95 homolog	430	X
10305	Solution structure of the C2H2 type zinc finger (region 536-568) of human Zinc finger protein 347	438	X
10306	Solution structure of the 1st zf-C2H2 domain from Human B-cell lymphoma 6 protein	397	X
10307	Solution structure of the C2H2 type zinc finger (region 426-458) of human Zinc finger protein 473	413	X
10308	Solution structure of the C2H2 type zinc finger (region 484-512) of human Zinc finger protein 473	416	X
10309	Solution structure of the C2H2 type zinc finger (region 771-803) of human Zinc finger protein 484	471	X
10310	Solution structure of the C2H2 type zinc finger (region 396-428) of human Zinc finger protein 347	435	X
10311	Solution structure of the PH domain of PEPP-3 from human	1392	X
10312	Solution structure of the PH domain of Protein kinase C, nu type from human	1520	X
10313	Solution structure of the PH domain of PIP2-dependent ARF1 GTPase-activating protein from human	1337	X
10314	Solution structure of the PH domain of Evectin-2 from mouse	1440	X
10315	Solution structure of the PH domain of Rho GTPase activating protein 21 from human	1459	X
10316	Solution structure of the PH domain of TBC1 domain family member 2 protein from human	1387	X
10317	Solution structure of the PH domain of pleckstrin homology domain-containing protein family A member 5 from human	1544	X
10318	Solution structure of the PTB domain of KIAA1075 protein from human	1832	X
10319	Solution structure of the PH domain of KIAA0640 protein from human	1414	X
10320	Solution structure of the 9th filamin domain from human Filamin-B	1409	X
10321	Solution structure of the 11th filamin domain from human Filamin-B	1382	X
10322	Solution structure of the 12th filamin domain from human Filamin-B	1155	X
10323	Solution structure of the 13th filamin domain from human Filamin-B	1241	X
10324	Solution structure of the 20th Filamin domain from human Filamin-B	1097	X
10325	Solution structure of the 15th Filamin domain from human Filamin-B	1144	X
10326	Solution structure of the 18th Filamin domain from human Filamin-B	1303	X
10327	Solution structure of the filamin domain from human tripartite motif protein 45	1366	X
10328	Solution structure of the 14th Filamin domain from human Filamin C	1293	X
10329	Solution structure of the 16th Filamin domain from human Filamin C	1063	X
10330	Solution structure of the 17th Filamin domain from human Filamin C	1204	X
10331	Solution structure of the 22th Filamin domain from human Filamin C	1254	X
10332	Solution structure of the 23th Filamin domain from human Filamin C	1177	X
10333	Solution structure of the filamin domain from human BK158_1 protein	1465	X
10334	Solution structure of the 19th filamin domain from human Filamin-B	1230	X
10335	Solution structure of the 10th filamin domain from human Filamin-B	1179	X
10336	Solution structure of the DUF1000 domain of a thioredoxin-like protein 1	2107	X
10337	Solution structure of SH3 domain in Suppressor of T-cell receptor signaling 1	974	X
10338	Solution Structure of the First UBA Domain in the Human Ubiquitin Specific Protease 5 (Isopeptidase 5)	656	X
11000	C-Terminal Domain of Epsilon Subunit of F1F0-ATP Synthase from The Thermophilic Bacillus PS3 WITH ATP	178	X
11001	Solution structure of Cu(I) loaded human Sco2	1953	X
11002	NMR structure of the antimicrobial peptide RP-1 bound to SDS micelles	172	X
11003	NMR structure of the antimicrobial peptide RP-1 bound to DPC micelles	166	X
11004	NMR Structure of Ebola fusion peptide in SDS micelles at pH 7	95	X
11005	Solution structure of a bent alpha-helix	129	X
11006	The Glycosylated EGF-Like Repeats 12 From Mouse NOTCH-1, NMR, Minimized Average Structure	262	X			X
11007	FBP28WW2 domain in complex with PTPPPLPP peptide	279	X
11008	FBP28WW2 domain in complex with a PPPLIPPPP peptide	284	X
11009	SOLUTION STRUCTURE OF THE LSM DOMAIN OF Dm EDC3 (ENHANCER OF DECAPPING 3)	1107	X
11010	Rac1/PRK1 Complex	2881	X
11011	Solution structure of the N-terminal soluble domains of Bacillus subtilis CopA	1456	X
11012	1H, 13C and 15N resonance assignments for the 25.8 kDa DNA binding domain of the human p63 protein	2510	X
11013	The dynein stalk head, the microtubule binding domain of dynein, derived from mouse	713	X
11014	Liquid crystal solution structure of the kissing complex formed by the apical loop of the HIV TAR RNA and a high affinity RNA aptamer optimized by SELEX.	420			X
11016	Humal Insulin Mutant B31Lys -B32Arg	360	X
11017	NMR solution structure of TnpE protein from Shigella flexneri. Northeast Structural Genomics Target SfR125.	1086	X
11018	NMR structure note: murine Itk SH3 domain	703	X
11019	Cox17	726	X
11020	Solution structure of human Cu(I)Cox17	711	X
11021	NMR STRUCTURE OF THE MUTANT OF CHIGNOLIN, CLN025	56	X
11022	1H chemical shift assignment for big defensin	511	X
11024	NMR STRUCTURE OF THE S. AUREUS VRAR DNA BINDING DOMAIN	742	X
11026	SOLUTION STRUCTURE OF ALPHA-SPECTRIN SH3-BERGERAC FROM CHICKEN	878	X
11027	SPECTRIN SH3 CHIMERA WITH A LIGAND LINKED TO BE BOUND IN ORIENTATION II	889	X
11028	Solid-state NMR assignment of the rigid core of the HET-s(218-289) prion protein in its amyloid conformation.	273	X
11029	Solution Structure of the N-terminal SAP Domain of SUMO E3 Ligases from Saccharomyces cerevisiae	1491	X
11030	Solution Structure of the N-terminal SAP Domain of SUMO E3 Ligases from Oryza sativa	2639	X
11031	The solution structure of phtotactic transducer protein HtrII linker region from Natronomonas pharaonis	698	X
11032	Solution structure of the knotted tudor domain of the yeast histone acetyltransferase protein, Esa1	1203	X
11033	Solution structure of the presumed chromodomain of the yeast histone acetyltransferase protein, Esa1	1119	X
11034	Backbone 1H, 13C, and 15N Chemical Shift Assignments for N-terminal DNA Recognition Domain of the Bacillus subtilis transition-state regulator SpoVT	667	X
11035	1H, 13C, and 15N chemical shift assignments for Thermus thermophilus HB8 TTHA1718 protein	766	X
11036	NMR solution structures of KAP-1PHD finger-bromodomain	1998	X
11037	1H, 13C, and 15N chemical shift assignments for Thermus thermophilus HB8 TTHA1718 protein in living E. coli cells	625	X
11038	The DNA binding domain of RTBP1	1200	X
11040	Structural Basis of PxxDY motif recognition in SH3 binding	796	X
11041	Solution structure of domains 3 and 4 of human ATP7B	2032	X
11042	Assigned chemical shifts of RelE	1159	X
11043	Structure of chimeric variant of SH3 domain - SHH	916	X
11044	Solution structure of Magi4, a spider toxin from Macrothele gigas	286	X
11045	Mhr1p-bound ssDNA	37	X	X
11046	hsRad51-bound ssDNA	37	X	X
11047	RecO-bound ssDNA	37	X	X
11048	RecT-bound ssDNA	37	X	X
11049	Structure of the N-terminal BARpeptide in DPC micelles	276	X
11050	Structure of the N-terminal BARpeptide in SDS micelles	288	X
11051	Disulfide-free variant of hen lysozyme: 0SS	661	X
11052	Two-disulfide variant of hen lysozyme: 2SS[6-127, 64-80]	640	X
11053	Chemical shifts assignment for the West Nile virus NS2B(K96A)-NS3 protease	1963	X
11054	Solution structure of a novel insect chemokine isolated from integument	190	X
11055	NMR structure of Grb2 SH2 domain complexed with the inhibitor	1070	X
11056	KMTM7 a peptide derived from V-ATPase subunit a, putative TM7	173	X
11057	MICROTUBULE BINDING DOMAIN OF DYNEIN-C	1764	X
11058	Chemical shift assignment of PACAP21 bound to phospholipid membranes by magic angle spinning solid-state NMR	119	X
11059	Chemical shift assignment of PACAP27 bound to phospholipid membranes by magic angle spinning solid-state NMR	152	X
11060	Unusual Thermal Disassembly of the SPFH Domain Oligomer from Pyrococcus horikoshii	1317	X
11061	Solution structure of the monomeric form of mouse APOBEC2	2377	X
11062	Solution structure of mouse lipocalin-type prostaglandin D synthase possessing a intrinsic disulfide bond.	1471	X
11063	Backbone 1H, 13C, and 15N Chemical Shift Assignments for KP-PmrD	915	X
11064	Solid-state NMR assignment of the rigid core of the HET-s(218-289) prion protein in its amyloid conformation.	326	X
11065	Solution structure of the 4.1R FERM alpha lobe domain	1375	X
11067	Backbone resonance assignments for the cytoplasmic regions of G protein-activated inwardly rectifying potassium channel1 (GIRK1)	952	X
11068	solution structure of 1-23 GBP (growth-blocking peptide)	140	X
11069	solution structure of 1-28 GBP (growth-blocking peptide)	183	X
11070	DPC micelle bound structure of 1-28 GBP (growth-blocking peptide)	199	X
11072	The solution structure of the N-terminal fragment of big defensin	195	X
11073	Solution structure of juvenile hormone binding protein from silkworm in complex with JH III	2900	X
11074	Chemical shifts assignment for the segmentally labelled beta subunit (391-473 residues) of the F1-ATPase in the F1 complex	148	X
11075	1H, 13C, and 15N Chemical Shift Assignments for N-terminal domain of kp60	938	X
11076	NMR based model structure of mesoderm development (MESD) in solution.	1456	X
11077	Solution structure of the E. coli ribosome hibernation promoting factor HPF	1047	X
11078	Solution structure of the TIR domain of human MyD88	1438	X
11080	3D structure of Pin from the psychrophilic archeon Cenarcheaum symbiosum (CsPin)	1077	X
11081	Solution structure of the human DDEF1 SH3 domain	762	X
11082	Solution structure of the complex between the DDEF1 SH3 domain and the APC SAMP1 motif	969	X
11083	Solution structure of the Leucine Rich Repeat of human Acidic leucine-rich nuclear phosphoprotein 32 family member B	2105	X
11084	Solution structure of the CH domain of human calponin-2	1750	X
11085	Solution structure of the CH domain of human NEDD9 interacting protein with calponin homology and LIM domains	1324	X
11086	Solution structure of the CH domain of human microtubule-associated protein RP/EB family member 3	1978	X
11087	Solution structure of the PH domain of Kindlin-3 from human	1698	X
11088	Solution structure of the PH domain of Dynamin-2 from human	1396	X
11089	Solution structure of the PH domain of Pleckstrin homology domain-containing family A member 6 from human	1441	X
11090	Solution structure of the N-terminal PapD-like domain of HYDIN protein from human	1482	X
11091	Solution structure of the C-terminal PapD-like domain from human HYDIN protein	1347	X
11092	Solution structure of the chromo domain of Mortality factor 4-like protein 1 from human	1229	X
11093	Solution structure of the BTK motif of tyrosine-protein kinase ITK from human	672	X
11094	Solution structure of the complex of the PTB domain of SNT-2 and 19-residue peptide (aa 1571-1589) of hALK	1839	X
11095	Solution structure of the chimera of the PTB domain of SNT-2 and 19-residue peptide (aa 1571-1589) of hALK	1704	X
11096	Solution structure of the first fibronectin type III domain of human Netrin receptor DCC	1292	X
11097	Solution structure of the fifth fibronectin type III domain of human Netrin receptor DCC	1358	X
11098	Solution structure of the sixth fibronectin type III domain of human Netrin receptor DCC	1394	X
11099	Solution structure of the fourth fibronectin type III domain of human Netrin receptor DCC	1291	X
11100	The solution structure of the first thioredoxin domain of mouse Protein disulfide-isomerase A6	1489	X
11101	The solution structure of the first thioredoxin domain of mouse Protein disulfide-isomerase A4	1640	X
11102	The solution structure of the second thioredoxin domain of human Protein disulfide-isomerase A3	1668	X
11103	Solution structure of the second fibronectin type III domain of human Netrin receptor DCC	1203	X
11104	The solution structure of the second thioredoxin domain of mouse Protein disulfide-isomerase A4	1421	X
11105	The solution structure of the thioredoxin domain of human Thioredoxin-related transmembrane protein 2	1674	X
11106	The solution structure of the FN3 domain of human Midline 2 protein	1488	X
11107	The solution structure of the third thioredoxin domain of human Thioredoxin domain-containing protein 5	1421	X
11108	The solution structure of the thioredoxin domain of human Thioredoxin-like protein 2	1549	X
11109	The solution structure of the third thioredoxin domain of mouse Protein disulfide-isomerase A4	1556	X
11110	The solution structure of the 33rd fibronectin type III domain of human Tenascin-X	1200	X
11111	The solution structure of the sixth fibronectin type III domain of human Neogenin	1424	X
11112	The solution structure of the fourth fibronectin type III domain of human Neogenin	1416	X
11113	The solution structure of the thioredoxin-like domain of human Thioredoxin-related transmembrane protein	1541	X
11114	The solution structure of the second thioredoxin-like domain of human Protein disulfide-isomerase	1412	X
11115	Complex structure of the zf-CW domain and the H3K4me3 peptide	843	X
11116	The solution structure of the second thioredoxin-like domain of human Protein disulfide-isomerase A6	1510	X
11117	The solution structure of the second fibronectin type III domain of mouse Ephrin type-A receptor 1	1232	X
11118	The solution structure of the fifth fibronectin type III domain of human Neogenin	1298	X
11119	The solution structure of the first fibronectin type III domain of human Neogenin	1352	X
11120	The solution structure of the third fibronectin type III domain of human Neogenin	1496	X
11121	The solution structure of the second fibronectin type III domain of human Neogenin	1277	X
11122	The solution structure of the tetratrico peptide repeat of human Smooth muscle cell associated protein-1, isoform 2	1649	X
11123	Solution structure of the SANT domain of human SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily C member 1	865	X
11124	Solution structure of the CH domain of human Calponin 1	1621	X
11125	Solution structure of the 6th fibronectin type III domain from human fibronectin type III domain containing protein 3	1137	X
11126	Solution structure of the second CH domain of human spectrin beta chain, brain 2	1509	X
11127	Solution structure of the 2nd fibronectin type III domain from mouse biregional cell adhesion molecule-related/down-regulated oncogenes (Cdon) binding protein	1400	X
11128	Solution structure of the 3rd fibronectin type III domain from mouse biregional cell adhesion molecule-related/down-regulated oncogenes (Cdon) binding protein	1335	X
11129	Solution structure of the CH domain of human Rho guanine nucleotide exchange factor 6	1433	X
11130	Solution structure of two zf-C2H2 domains from human Zinc finger protein 512	1085	X
11131	Solution structure of the FYVE domain from human FYVE domain containing 27 isoform b protein	854	X
11132	Solution structure of the HMG box like domain from human hypothetical protein FLJ14904	1055	X
11133	Solution structure of the fourth CH domain from human L-plastin	1420	X
11134	Solution structure of the HMG box domain from human WD repeat and HMG-box DNA binding protein 1	864	X
11135	Solution structure of the 8th KH type I domain from human Vigilin	1065	X
11136	Solution structure of the 12th KH type I domain from human Vigilin	1232	X
11137	Solution structure of the 14th KH type I domain from human Vigilin	1102	X
11138	Solution structure of the 13th KH type I domain from human Vigilin	1129	X
11139	Solution structure of the 1st KH type I domain from human Vigilin	1112	X
11140	Solution structure of the 4th KH type I domain from human Vigilin	1204	X
11141	Solution structure of the CH domain from human Vav-3 protein	1784	X
11142	Solution structure of the CH domain from human Smoothelin splice isoform L2	1465	X
11143	Solution structure of the CH domain from human MICAL-3 protein	1434	X
11144	Solution structure of the DnaJ domain from human Williams-Beuren syndrome chromosome region 18 protein	1067	X
11145	Solution structure of the CH domain from human EH domain binding protein 1	1443	X
11146	Solution structure of the eIF-5_eIF-2B domain from human Eukaryotic translation initiation factor 5	1915	X
11147	Solution structure of the tandem HMG box domain from Human High mobility group protein B1	2133	X
11148	Solution structure of the TIG domain from Human Nuclear factor of activated T-cells, cytoplasmic 4	1423	X
11149	Structural study of the UBA domain of p62 and its interaction with ubiquitin	626	X
11150	Solution structure of the Somatomedin B domain of human Ectonucleotide pyrophosphatase/phosphodiesterase family member	482	X
11151	Solution structure of the first Phorbol esters/diacylglycerol binding domain of human Protein kinase C, delta	861	X
11152	Solution structure of the fibronectin type III domain of human Integrin beta-4	1324	X
11153	Solution structure of the SH3 domain of 130 kDa phosphatidylinositol 4,5-biphosphate-dependent ARF1 GTPase-activating protein	833	X
11154	Solution structure of the SH3 domain of Sorbin and SH3 domain-containing protein 1	773	X
11155	Solution structure of the SH3 domain of Abl interactor 2 (Abelson interactor 2)	883	X
11156	Solution structure of the SH3 domain of human Nostrin	879	X
11157	Solution structure of the BTK motif of human Cytoplasmic tyrosine-protein kinase BMX	479	X
11158	Solution structure of the HMG box of human Transcription factor SOX-17	940	X
11159	Solution structure of the Ring finger of human Retinoblastoma-binding protein 6	768	X
11160	Solution structure of the HMG box of human Myeloid/lymphoid or mixed-lineage leukemia protein 3 homolog	1072	X
11161	Solution structure of the Zinc finger, C3HC4 type (RING finger) domain Tripartite motif protein 30	981	X
11162	Solution structure of the Zinc finger, C3HC4 type (RING finger) domain of RING finger protein 126	861	X
11163	Solution structure of the Zinc finger, C3HC4 type (RING finger) domain of Tripartite motif-containing protein 5	961	X
11164	Solution structure of the Zinc finger, C3HC4 type (RING finger) domain of TNF receptor-associated factor 3	742	X
11165	Solution structure of the C2H2 type zinc finger (region 329-359) of human Zinc finger protein 268	426	X
11166	Solution structure of the C2H2 type zinc finger (region 581-609) of human Zinc finger protein 268	393	X
11167	Solution structure of the C2H2 type zinc finger (region 508-540) of human Zinc finger protein 347	415	X
11168	Solution structure of the C2H2 type zinc finger (region 732-764) of human Zinc finger protein 347	398	X
11169	Solution structure of the C2H2 type zinc finger (region 435-467) of human Zinc finger protein 484	414	X
11170	Solution structure of the C2H2 type zinc finger (region 631-663) of human Zinc finger protein 484	426	X
11171	Solution structure of the C2H2 type zinc finger (region 659-691) of human Zinc finger protein 484	386	X
11172	13C and 15N chemical shifts of the membrane-reconstituted subunit c-ring of E. coli H+-ATP synthase	162	X
11173	Solution Structure of the First UBA Domain in the Human Ubiquitin Specific Protease 5 (Isopeptidase 5)	693	X
11175	Solution structure of calponin homology domain of IQGAP1	2093	X
11176	Solution Structure of RNA aptamer against AML1 Runt domain	105			X
11177	Backbone chemical shift assignments for Thermus thermophilus RecO	378	X
11178	Solution structure of the SH3 domain of human olygophrein-1 like protein (KIAA0621)	774	X
11179	Solution structure of the SH3 domain of SH3-domain kinase binding protein 1	809	X
11180	Solution structure of the first SH3 domain of KIAA0318 protein	1115	X
11181	Solution structure of the fourth fn3 domain of KIAA1496 protein	1352	X
11182	Solution structure of the PDZ domain of human KIAA0340 protein	1462	X
11183	Solution structure of the FNIII domain of human RIM-binding protein 2	1436	X
11184	Solution structure of the second SH3 domain of human RIM-binding protein 2	1047	X
11185	Solution structure of the third SH3 domain of human RIM-binding protein 2	823	X
11186	Solution structure of the fifth PDZ domain of InaD-like protein	1265	X
11187	Solution structure of the 7th PDZ domain of InaD-like protein	1438	X
11188	Solution structure of the first PDZ domain of InaD-like protein	1468	X
11189	Solution structure of the second PDZ domain of human InaD-like protein	1195	X
11190	Solution structure of the third PDZ domain of human InaD-like protein	1444	X
11191	Solution structure of the eighth PDZ domain of human InaD-like protein	1310	X
11192	Solution structure of the Ig-like domain(433- 525) of murine myosin-binding protein C, fast-type	1281	X
11193	Solution structure of the first SH3 domain from human KIAA0418 protein	789	X
11194	Solution structure of the fifth SH3 domain from human KIAA0418 protein	819	X
11195	Solution structure of the PDZ domain of human Rho guanine nucleotide exchange factor 11	1028	X
11196	Solution structure of the third SH3 domain from human KIAA1666 protein	822	X
11197	Solution structure of the sixth PDZ domain of human InaD-like protein	1384	X
11198	Solution structure of the third PDZ domain of synapse-associated protein 102	1307	X
11199	Solution structure of the PDZ domain of Enigma homologue protein	1170	X
11200	Solution structure of the PDZ domain of Pals1 protein	1358	X
11201	Solution structure of the fourth PDZ domain of KIAA1095 protein	1502	X
11202	Solution structure of the PDZ domain of Spinophilin/NeurabinII protein	1257	X
11203	Solution structure of the core domain of calcyclin binding protein; siah-interacting protein (SIP)	1581	X
11204	Solution structure of the second PDZ domain of harmonin protein	1308	X
11205	Solution structure of the first and second zf-C2H2 domain of Zinc finger protein 435	819	X
11206	Solution structure of the fourth PDZ domain of Glutamate receptor interacting protein 2	1250	X
11207	Solution structure of the first PDZ domain of scribble homolog protein (hScrib)	1222	X
11208	Solution structure of the second fn3 domain of Eph receptor A8 protein	1286	X
11209	Solution structure of the SH3 domain of Endophilin B1 (Sh3g1b1)	918	X
11210	Solution structure of the first PDZ domain of amyloid beta A4 precursor protein-binding family A, member 1	1174	X
11211	Solution structure of the third ig-like domain of Myosin-dinding protein C, slow-type	1189	X
11212	Solution structure of the first ig-like domain of Myosin-binding protein C, slow-type	1529	X
11213	Solution structure of the SH3 domain of Hypothetical protein SH3YL1	905	X
11214	Solution structure of the SH3 domain of Fyn-related kinase	889	X
11215	Solution structure of the PDZ domain of T-cell lymphoma invasion and metastasis 1 varian	1321	X
11216	Solution structure of the third PDZ domain of PDZ domain containing protein 1	1172	X
11217	Solution structure of the first SH3 domain of Stac protein	804	X
11218	Solution structure of the CIDE-N domain of human cell death activator CIDE-A	1069	X
11219	Solution structure of the first SH3 domain of human sorbin and Sh3 domain-containing protein 1	815	X
11220	Solution structure of the second SH3 domain of human KIAA0769 protein	823	X
11221	Solution structure of the Ig-like domain (615-713) from human Obscurin-like protein 1	1285	X
11222	Solution structure of the first SH3 domain of human KIAA0769 protein	910	X
11223	Solution structure of the Ig-like domain of human Leucine-rich repeat-containing protein 4	1164	X
11224	Solution structure of the SH3 domain from Phospholipase C, gamma 2	777	X
11225	Solution structure of the SH3 domain of human SLIT-ROBO Rho GTPase-activating protein 2	824	X
11226	Solution structure of the PDZ domain from Human MAGUK p55 subfamily member 2	1055	X
11227	Solution structure of the second fn3 domain from human Ephrin type-B receptor 4	1187	X
11228	Solution structure of the SH3 domain from Rho guanine nucleotide exchange factor 9	919	X
11229	Solution structure of the Ig-like domain (714-804) from human Obscurin-like protein 1	1226	X
11230	Solution structure of the 6th Ig-like domain from human KIAA1556	1148	X
11231	Solution structure of the PKD domain from KIAA 1837 protein	1144	X
11232	Solution structure of the PKD domain (329-428) from human KIAA0319	1332	X
11233	Solution structure of the SH3 domain of human KIAA1783 protein	926	X
11234	Solution structure of the RING domain (1-66) from tripartite motif-containing protein 31	846	X
11235	Solution structure of the 6th Ig-like domain from human Myosin-binding protein C, fast-type	1457	X
11236	Solution structure of the fourth Ig-like domain from myosin light chain kinase, smooth muscle	1133	X
11237	Solution structure of the first and second PHD domain from Myeloid/lymphoid or mixed-lineage leukemia protein 3 homolog	1266	X
11238	Solution structure of the C2H2-type zinc finger domain (699-729) from zinc finger protein 473	434	X
11239	Solution structure of the C2H2-type zinc finger domain (781-813) from zinc finger protein 473	447	X
11240	Solution structure of the e3_binding domain of dihydrolipoamide branched chaintransacylase	787	X
11242	Solution structure of the first SH3 domain of human vinexin	773	X
11244	Solution structure of the first SANT domain from human nuclear receptor corepressor 1	748	X
11245	Solution Structure of the murine ubiquitin-like 5 protein from RIKEN cDNA 0610031K06	1176	X
11246	Solution structure of the FHA domain of mouse Afadin 6	1445	X
11247	Solution structure of the FHA domain of human ubiquitin ligase protein RNF8	1728	X
11248	Solution structure of the PDZ domain from mouse LIM domain kinase	1380	X
11249	Assignment of holo form GrxS14 from Populus trichocarpa	1196	X
11250	Structure and function of the N-terminal nucleolin binding domain of nuclear valocine containing protein like 2 (NVL2) harboring a nucleolar localization signal.	867	X
11251	The solution structure of the C-terminal region of Zinc finger FYVE domain-containing protein 21	1666	X
11252	Resonance assignments of HRDC domain from Bloom syndrome protein	973	X
11253	Solution Structure of the Ubiquitin-like Domain from Mouse Hypothetical 1700011N24Rik Protein	1123	X
11254	Solution Structure of a N-terminal Ubiquitin-like Domain in Mouse Tubulin-specific Chaperone B	1112	X
11255	Solution Structure of Anticodon Binding Domain from Nuclear Receptor Coactivator 5 (Human KIAA1637 Protein)	1428	X
11256	Solution Structure of the N-terminal Ubiquitin-like Domain of Mouse Ubiquitin Specific Protease 14 (USP14)	1138	X
11257	Solution Structure of Mouse Ubiquitin-like 3 Protein	1257	X
11258	Solution Structure of Mouse Hypothetical Protein 2900073H19RIK	1345	X
11259	Solution Structure of CUE domain in the C-terminal of Human Toll-interacting Protein (Tollip)	608	X
11260	Solution Structure of UBA domain of Human Ubiquitin Associated Protein 1 (UBAP1)	689	X
11261	Solution Structure of the N-terminal Ubiquitin-like Domain in the Human Ubiquilin 3 (UBQLN3)	1212	X
11262	Solution Structure of the N-terminal Ubiquitin-like Domain in the 4931431F19Rik Protein	1058	X
11263	Solution Structure of the N-terminal Ubiquitin-like Domain in the Human BAT3 Protein	998	X
11264	Solution Structure of Ras-binding Domain in Mouse AF-6 Protein	1312	X
11265	Solution Structure of the N-terminal Ras-binding Domain (RBD) in Human a-Raf Kinase	969	X
11266	Solution Structure of the N-terminal Ubiquitin-like Domain in Human Np95/ICBP90-like Ring Finger Protein (NIRF)	1035	X
11267	Solution Structure of Human SUMO-2 (SMT3B), a Ubiquitin-like Protein	1128	X
11268	Solution Structure of the N-terminal Ubiquitin-like Domain in Mouse Ubiquitin-like Protein SB132	1283	X
11269	Solution Structure of the N-terminal CUE Domain in the Human Mitogen-activated Protein Kinase Kinase Kinase 7 Interacting Protein 2 (MAP3K7IP2)	803	X
11270	Solution Structure of the Novel Identified Ubiquitin-like Domain in the Human Hypothetical Protein FLJ35834	1384	X
11271	Solution Structure of the C-terminal UBA Domain in the Human Ubiquilin 3	562	X
11272	Solution Structure of the Novel Identified Ubiquitin-like Domain in the Human COBL-like 1 Protein	1080	X
11273	Solution Structure of the Novel Identified UBA-like Domain in the N-terminal of Human Fas Associated Factor 1 Protein	599	X
11274	Solution Structure of the Novel Identified UBA-like Domain in the N-terminal of Human ETEA Protein	718	X
11275	Solution Structure of the RRM Domain in the Human Poly (ADP-ribose) Polymerase Family, Member 10 Variant	1128	X
11276	Solution Structure of the CUE Domain in the Human CUE Domain Containing Protein 1 (CUEDC1)	732	X
11277	Solution Structure of the RA Domain in the Human Link Guanine Nucleotide Exchange Factor II (Link-GEFII)	1347	X
11278	Solution Structure of the CUE Domain in the Human Activating Signal Cointegrator 1 Complex Subunit 2 (ASCC2)	848	X
11279	2DZI/Solution Structure of the N-terminal Ubiquitin-like Domain in Human Ubiquitin-like Protein 4A (GDX)	999	X
11280	2DZJ/Solution Structure of the N-terminal Ubiquitin-like Domain in Human Synaptic Glycoprotein SC2	1077	X
11281	Structure of the UBX domain in Mouse UBX Domain-Containing Protein 2	1242	X
11282	Solution Structure of the UBA domain in Human Protein FAM100B	670	X
11283	Solution Structure of the Ubiquitin-like Domain in Human FAS-associated factor 1 (hFAF1)	1136	X
11284	Solution structure of the SH3 domain of human hypothetical protein FLJ21522	782	X
11285	Solution structure of the SH3 domain of mouse peroxisomal biogenesis factor 13	1015	X
11286	Solution structure of the BSD domain of human Synapse associated protein 1	1224	X
11287	Solution structure of the C2H2 type zinc-binding domain of human zinc finger protein 292	809	X
11288	Solution structure of the fibronectin type-III domain of human fibronectin type-III domain containing protein 3a	1315	X
11289	Solution structure of the LIM domain of human Leupaxin	857	X
11290	Solution structure of the fibronectin type-III domain of human fibronectin type III domain containing protein 3	1198	X
11291	Solution structure of the fibronectin type-III domain of mouse myosin-binding protein C, Fast-type homolog	1213	X
11292	Solution structure of the fibronectin type-III domain of human protein tyrosine phosphatase, receptor type, D isoform 4 variant	1265	X
11293	Solution structure of the LIM domain of human Cysteine-rich protein 2	805	X
11294	Solution structure of the RWD domain of human RWD omain containing protein 2	1846	X
11295	Solution structure of the RWD domain of human protein C21orf6	1756	X
11296	Solution structure of the RWD domain of human ring finger protein 25	1527	X
11297	Solusion structure of the Todor domain of human Lamin-B receptor	725	X
11298	Solution structure of the BSD domain of human TFIIH basal transcription factor complex p62 subunit	684	X
11299	Solution structure of the SH3 domain of the human Proline-serine-threonine phosphatase-interacting protein 1	724	X
11300	Solution structure of the Myb_DNA-binding domain of human Cell division cycle 5-like protein	781	X
11301	Solution structure of the Myb_DNA-binding domain of human Cell division cycle 5-like protein	704	X
11302	Solution structure of the N-terminal C2H2 type zinc-binding domain of the Zinc finger protein 64, isoforms 1 and 2	1009	X
11303	An extended conformation of the RWD domain of human Ring finger protein 25	1607	X
11304	Solution structure of the Fibronectin type-III domain of human Neural cell adhesion molecule 2	1394	X
11305	Solution Structure of the LIM Domain of the Human Actin Binding LIM Protein 2	836	X
11306	Solution Structure of the Ring-H2 Finger Domain of Mouse Deltex Protein 2	1305	X
11307	Solution Structure of the RING finger Domain of the human UbcM4-interacting Protein 4	1112	X
11308	Solution structure of the C2H2 zinc finger domain of the protein arginine N-methyltransferase 3 from Mus musculus	1463	X
11309	Solution structure of the N-terminal zinc finger domain of mouse cell growth regulating nucleolar protein LYAR	823	X
11310	Solution structure of the C-terminal domain of mouse phosphoacetylglucosamine mutase (PAGM)	1262	X
11311	Solution structure of the FAS1 domain of human transforming growth factor-beta induced protein IG-H3	1738	X
11312	Solution structure of the C2H2 type zinc-binding domain of human zinc finger protein 64, isoforms 1 and 2	672	X
11313	Solution structure of the RING domain of the Zinc finger protein 183-like 1	901	X
11314	Solution Structure of the RING domain of the Synaptotagmin-like protein 4	741	X
11315	Solution structure of the RING domain of the Non-SMC element 1 protein	769	X
11316	Solution Structure of the zinc finger domain of Transcriptional repressor CTCF protein	815	X
11317	Solution Structure of the RING domain of the Tripartite motif protein 32	1007	X
11318	Solution Strutcure of the SH3 domain of the Cdc42-interacting protein 4	707	X
11319	Solution Structure of the zinc finger BED domain of the zinc finger BED domain containing protein 1	789	X
11320	solution structure of the sh3 domain-binding glutamic acid-rich-like protein 2	1349	X
11321	Solution Structure of the IBR domain of the RING finger protein 31 protein	975	X
11322	Solution structure of the SANT domain of human KIAA1915 protein	928	X
11323	Solution structure of the MYND domain of the human zinc finger MYND domain-containing protein 10	720	X
11324	Solution structure of the thap domain of the human thap domain-containing protein 2	1121	X
11325	Solution structure of the RING domain of the human cellular modulator of immune recognition protein	823	X
11326	Solution structure of the RING domain of the human RING finger protein 146	744	X
11327	Solution structure of the B-box domain of the human tripartite motif-containing 63 protein	674	X
11328	Solution structure of the B-box domain of the zinc finger FYVE domain-containing protein 19 from Mus musculus	632	X
11329	Solution structure of the Bromodomain of human SWI/SNF related matrix associated actin dependent regulator of cromatin subfamily A member 2	1490	X
11330	Solution structure of the plus-3 domain of human KIAA0252 protein	1782	X
11331	Solution structure of the B-box domain of the human Midline-2 protein	942	X
11332	Solution structure of the RING domain of the human Polycomb group RING finger protein 6	826	X
11333	Solution structure of the CHY zinc finger domain of the RING finger and CHY zinc finger domain-containing protein 1 from Mus musculus	1613	X
11334	Solution structure of the TFIIS domain II of human PHD finger protein 3	1454	X
11335	Solution Structure of the RING domain of the human Cell growth regulator with RING finger domain 1 protein	706	X
11336	Solution Structure of the RING domain of the human ring finger protein 4	746	X
11337	Solution structure of the RWD domain of human RWD domain containing protein 3	1577	X
11338	Solution structure of the RWD domain of human RWD domain containing protein 1	1560	X
11339	Solution structure of the ring domain of the Baculoviral IAP repeat-containing protein 4 from Homo sapiens	915	X
11340	Solution structure of the RING domain of the human TNF receptor-associated factor 6 protein	1037	X
11341	Solution structure of the RING domain of the human tripartite motif-containing protein 39	652	X
11342	Solution Structure of the RING domain of the human RING-box protein 2	942	X
11343	Solution structure of the RING domain of the RING finger and CHY zinc finger domain-containing protein 1 from Mus musculus	603	X
11344	Solution structure of the RING domain of the human RING finger protein 141	717	X
11345	Solution structure of the SWIRM domain of baker's yeast Transcriptional adapter 2	1096	X
11346	Solution structure of Fn14 CRD domain	443	X
11347	Solution structure of the PHD domain in PHD finger protein 21A	621	X
11348	Solution structure of the NEUZ domain in KIAA1787 protein	2005	X
11349	Solution structure of LIM domain in LIM-protein 3	792	X
11350	Solution structure of LIM domain in Four and a half LIM domains protein 2	757	X
11351	Solution structure of the NEUZ (NHR) domain in Neuralized from Drosophila melanogaster	2050	X
11352	Solution structure of PHD domain in inhibitor of growth family, member 1-like	786	X
11353	Solution structure of PHD domain in inhibitor of growth protein 3 (ING3)	728	X
11354	Solution structure of PHD domain in ING1-like protein BAC25079	774	X
11355	Solution structure of Splicing Factor Motif in Pre-mRNA splicing factor 18 (hPRP18)	868	X
11356	Solution structure of SH3 domain in Rac/Cdc42 guanine nucleotide exchange factor(GEF) 6	833	X
11357	Solution structure of WW domain in transcription elongation regulator 1	810	X
11358	Assigned chemical shifts of the zf-CW domain with H3 peptide	112	X
11359	Assigned chemical shifts of the zf-CW domain with H3 dimethyl K4 peptide	114	X
11360	Assigned chemical shifts of the zf-CW domain with H3 trimethyl K4 peptide	114	X
11361	Assigned chemical shifts of the zf-CW domain with H4 trimethyl K20 peptide	114	X
11362	Assigned chemical shifts of the zf-CW domain in zinc finger CW-type PWWP domain protein 1	773	X
11363	Solution structure of zinc finger HIT domain in protein FON	561	X
11364	Solution structure of the first SURP domain of human splicing factor SF3a120	806	X
11365	Solution structure of the second SURP domain of human splicing factor SF3a120 in complex with a fragment of human splicing factor SF3a60	1610	X
11366	Assigned chemical shifts of the human spliceosomal protein complex p14-SF3b155	1432	X
11367	Assigned chemical shifts of the human spliceosomal protein SF3b155	571	X
11368	Solution structure of the C2H2 type zinc finger (region 656-688) of human Zinc finger protein 95 homolog	453	X
11369	Solution structure of the C2H2 type zinc finger (region 507-539) of human Zinc finger protein 224	451	X
11370	Assigned chemical shifts of the second RNA recognition motif (RRM) of TIA-1, C terminal truncated	410	X
11371	Assigned chemical shifts of the second RNA recognition motif (RRM) of TIA-1, D131A mutant	476	X
11372	Assigned chemical shifts of the second RNA recognition motif (RRM) of TIA-1, K138A mutant	483	X
11373	Assigned chemical shifts of the second RNA recognition motif (RRM) of TIA-1, T134A mutant	482	X
11374	Assigned chemical shifts of the second RNA recognition motif (RRM) of TIA-1 with RNA (CCCCC)	192	X		X
11375	Assigned chemical shifts of the second RNA recognition motif (RRM) of TIA-1 with RNA (UUUUU)	200	X		X
11376	Assigned chemical shifts of the second RNA recognition motif (RRM) of TIA-1	1305	X
11377	Solution structure of the first C2H2 type zinc finger domain of Zinc finger protein 278	673	X
11378	Solution structure of the third zinc finger domain of Zinc finger protein 278	423	X
11379	Solution structure of the secound zinc finger domain of Zinc finger protein 278	405	X
11380	Solution structure of the 4th zinc finger domain of Zinc finger protein 278	521	X
11381	Solution structure of the first C2H2 type zinc finger domain of Zinc finger protein 32	369	X
11382	Solution structure of the secound C2H2 type zinc finger domain of Zinc finger protein 32	404	X
11383	Solution structure of the 20th C2H2 type zinc finger domain of Zinc finger protein 268	400	X
11384	Solution structure of the 24th C2H2 type zinc finger domain of Zinc finger protein 268	409	X
11385	Solution structure of the third C2H2 type zinc finger domain of Zinc finger protein 28 homolog	433	X
11386	Solution structure of the 9th C2H2 type zinc finger domain of Zinc finger protein 347	378	X
11387	Solution structure of the 16th C2H2 type zinc finger domain of Zinc finger protein 347	336	X
11388	Solution structure of the ARID domain of Jarid1b protein	1475	X
11389	Solution structure of the ARID domain of JARID1D protein	1242	X
11390	Solution structure of the death domain of Ankyrin-1	1230	X
11391	Solution structure of the 10th C2H2 type zinc finger domain of Zinc finger protein 268	394	X
11392	Solution structure of the 4th C2H2 type zinc finger domain of Zinc finger protein 28 homolog	405	X
11393	Solution structure of the 8th C2H2 type zinc finger domain of Zinc finger protein 347	257	X
11394	Solution structure of the 17th C2H2 type zinc finger domain of Zinc finger protein 347	387	X
11395	Solution structure of the 11th C2H2 type zinc finger domain of Zinc finger protein 224	420	X
11396	Solution structure of the 6th C2H2 type zinc finger domain of Zinc finger protein 484	408	X
11397	Solution structure of the BACK domain of Kelch repeat and BTB domain-containing protein 4	1237	X
11398	Solution structure of PDZ domain in protein XP_110852	1470	X
11399	solution structure of RNA binding domain in PTB-like protein L	1163	X
11400	Solution Structure of the RNA recognition motif in Arginine/serine-rich splicing factor 10	1013	X
11401	Solution structure of the phorbol esters/diacylglycerol binding domain of protein kinase C gamma	859	X
11402	Solution structure of chromo domain 2 in Chromodomain-helicase-DNA-binding protein 6	791	X
11403	Solution structure of Zinc finger domain 7 in Zinc finger protein 32	362	X
11404	Solution structure of SH3 domain in Rho-GTPase-activating protein 4	832	X
11405	Assigned chemical shifts of RNA binding domain 3	1337	X
11406	Assigned chemical shifts of RNA binding domain 3 in RNA (CUGCUG)	200	X		X
11407	Assigned chemical shifts of RNA binding domain 3 in RNA (UAUAUA)	200	X		X
11408	Assigned chemical shifts of RNA-binding domain 3 of CUGBP1 in complex with RNA (UG)3	1336	X		X
11409	Assigned chemical shifts of RNA binding domain in human Tra2 beta protein in complex with RNA (GAAGAA)	1153	X		X
11410	Assigned chemical shifts of RNA binding domain in human Tra2 beta protein in complex with RNA (GACUUCAACAAGUC)	170	X		X
11411	Assigned chemical shifts of RNA binding domain in human Tra2 beta protein in complex with RNA (AAAAAA)	164	X		X
11412	Assigned chemical shifts of RNA binding domain in human Tra2 beta protein in complex with RNA (UCAAU)	156	X		X
11413	Refinement of RNA binding domain in human Tra2 beta protein	1079	X
11414	Solution structure of C2H2 type Zinc finger domain 345 in Zinc finger protein 278	1038	X
11415	Solution structure of C2H2 type Zinc finger domain 3 in Zinc finger protein 32	382	X
11416	Solution structure of C2H2 type Zinc finger domain 5 in Zinc finger protein 32	382	X
11417	Solution structure of the J domain of DnaJ homolog subfamily B member 8	1014	X
11419	NMR structure of vasoactive intestinal peptide in Methanol	358	X
11420	NMR structure of vasoactive intestinal peptide in DPC Micelle	362	X
11422	Solution structure of the E. coli ORF135 protein	1568	X
11423	Solution structure of the C-terminal domain of the FliK	1923	X
11424	Interplay between phosphatidyl-inositol-phosphates and claudins upon binding to the 1st PDZ domain of zonula ocludens 1	1048	X
11425	1H, 13C, and 15N resonance assignment of the SPFH domain of human stomatin.	1338	X
11426	Solution structure of SecDF periplasmic domain P4	1086	X
11427	NMR assignments of ubiquitin fold domain (UFD) in SUMO-activating enzyme subunit 2 from rice	1531	X
11428	1H, 15N chemical shift assignments for a disulfide-deficient mutant of the starch-binding domain of glucoamylase	725	X
11429	SOLUTION STRUCTURE OF THE N-TERMINAL DOMAIN OF THE HMGB2	780	X
11430	SOLUTION STRUCTURE OF THE C-TERMINAL DOMAIN OF THE HMGB2	895	X
11431	SOLUTION STRUCTURE OF THE C-TERMINAL DOMAIN OF THE HMGB2 (H22Y)	930	X
11434	NMR Chemical Shift Assignments for Ostrich egg white Lysozyme	830	X
11435	1H, 13C, and 15N Chemical Shift Assignments for amyloid-beta-(1-40)	352	X
11436	NMR Chemical Shift Assignments for E73A mutant of Ostrich egg white Lysozyme	687	X
11437	DNA oligmer containing propylene cross-linked cyclic 2' -deoxyuridylate dimer	213		X
11438	DNA oligomer containing ethylene cross-linked cyclic 2'-deoxyuridylate dimer	211		X
11439	NMR Structure of LC4 transmembrane segment of CCR5	19	X
11440	Solution structure of Magnesium-bound form of calmodulin C-domain E104D/E140D mutant	831	X
11441	NMR chemical shift of bryum coronatum chitinase	962	X
11442	Backbone 1H, 13C and 15N chemical shift assignments of Hd3a (K31A/E57A)	721	X
11443	Crystal structure of the UBA domain of p62 and its interaction with ubiquitin	626	X
11450	1H, 13C, and 15N Chemical Shift Assignments for Musashi1 RBD1:r(GUAGU) complex	1081	X		X
11451	NMR strucure of stereo-array isotope labelled (SAIL) peptidyl-prolyl cis-trans isomerase from E. coli (EPPIb)	1528	X
11452	NMR chemical shift assignments for stomagen from Arabidopsis thaliana	467	X
11453	Backbone chemical shifts assignment of UHRF1 atypical PHD finger	250	X
11454	NMR Chemical Shift Assignments for QB domain of Sp1	590	X
11456	Solution structure of the N-terminal dsRBD from RNA helicase A	1110	X
11457	Solution structure of the second dsRBD from RNA helicase A	1378	X
11458	Solution structure of the N-terminal RNA recognition motif of NonO	1091	X
11459	One-disulfide variant of hen lysozyme: 1SS[6-127]	638	X
11460	One-disulfide variant of hen lysozyme: 1SS[30-115]	230	X
11461	One-disulfide variant of hen lysozyme: 1SS[64-80]	248	X
11462	One-disulfide variant of hen lysozyme: 1SS[76-94]	234	X
11463	Solution structure of the bromodomain of human BRPF1 in complex with histone H4K5ac peptide	1599	X
11466	NMR chemical shift of bryum coronatum chitinase E61A mutant	958	X
11467	Family GH19 chitinase from Rye seeds	918	X
11468	Solution STRUCTURE OF THE BOMBYX MORI LYSOZYME	1487	X
11469	Solution structure of the plant homeodomain (PHD) of the E3 SUMO ligase Siz1 from rice	840	X
11470	NMR chemical shift assignments for the cytoplasmic region of the Mg2+-transporter MgtE in the Mg2+ unbound state	1012	X
11471	NMR structure of FKBP12-mTOR FRB domain-rapamycin complex structure determined based on PCS	1480	X
11472	Complex structure of WWE in RNF146 with ATP	1262	X
11473	Solution structure of the CERT PH domain	1021	X
11474	Solution structures of the DNA-binding domains of immune-related zinc-finger protein ZFAT	406	X
11475	Solution structures of the DNA-binding domains of immune-related zinc-finger protein ZFAT	366	X
11476	Solution structures of the DNA-binding domains of immune-related zinc-finger protein ZFAT	404	X
11477	Solution structures of the DNA-binding domains of immune-related zinc-finger protein ZFAT	393	X
11478	Solution structures of the DNA-binding domains of immune-related zinc-finger protein ZFAT	373	X
11479	Solution structures of the DNA-binding domains of immune-related zinc-finger protein ZFAT	399	X
11480	Solution structures of the DNA-binding domains of immune-related zinc-finger protein ZFAT	374	X
11481	Solution structures of the DNA-binding domains of immune-related zinc-finger protein ZFAT	387	X
11482	Solution structures of the DNA-binding domains of immune-related zinc-finger protein ZFAT	361	X
11483	Solution structures of the DNA-binding domains of immune-related zinc-finger protein ZFAT	351	X
11484	Solution structures of the DNA-binding domains of immune-related zinc-finger protein ZFAT	406	X
11485	Solution structures of the DNA-binding domains of immune-related zinc-finger protein ZFAT	377	X
11486	Solution structures of the DNA-binding domains of immune-related zinc-finger protein ZFAT	386	X
11487	Solution structures of the DNA-binding domains of immune-related zinc-finger protein ZFAT	1081	X
11488	Solution structures of the DNA-binding domains of immune-related zinc-finger protein ZFAT	1126	X
11489	RNA aptamer against prion protein in complex with the partial binding peptide	155	X		X
11490	Backbone and side-chain 1H, 15N and 13C resonance assignments of the microtubule-binding domains of yeast cytoplasmic dynein in the high affinity state	1398	X
11491	Solution structure and siRNA-mediated knockdown analysis of the mitochondrial disease-related protein C12orf65 (ICT2)	1329	X
11492	Dihydrofolate Reductase from E.coli G67 deletion mutant	547	X
11493	NMR chemical shift of Streptomyces sp. N174 chitosanase	727	X
11494	NMR chemical shift of E22A mutant of Streptomyces sp. N174 chitosanase	850	X
11495	Backbone and side-chain 1H, 15N and 13C resonance assignments of the microtubule-binding domains of yeast cytoplasmic dynein in the low affinity state	1376	X
11496	Solution structure of the chromodomain of Chp1 in complex with H3K9me3 peptide	1033	X
11497	Solution structure of the chromodomain of Swi6	1055	X
11498	Backbone resonance assignment for the unique and SH3 domains of mouse lymphocyte specific kinase	539	X
11499	Solution structure of RNF146 WWE domain	1309	X
11500	solution structure of PARP11 WWE domain	1169	X
11501	solution structure of PARP14 WWE domain	1151	X
11502	Copper(I) loaded form of the first domain of the human copper chaperone for SOD1, CCS	987	X
11504	Structure of SPOC domain of the human transcriptional corepressor SHARP	2023	X
11505	Alternative structure of Ubiquitin	989	X
11506	Solution structure of human full-length vaccinia related kinase 1 (VRK1)	2601	X
11507	Solution structure of IseA, an inhibitor protein of DL-endopeptidases from Bacillus subtilis	2009	X
11508	Solution structure of the SH2 domain of Csk in complex with a phosphopeptide from Cbp	1605	X
11511	acidic intrinsically disordered region of SSRP1	383	X
11512	Backbone 13C Chemical Shift Assignments for Ubiquitin in Lyophilized Powder	222	X
11513	NMR chemical shift of carbohydrate binding module, C1, derived from GH8 chitosanase/glucanase from Paenibacillus fukuinensis D2	567	X
11514	NMR chemical shift of carbohydrate binding module, C2, derived from GH8 chitosanase from Paenibacillus fukuinensis D2	593	X
11515	goat alpha-lactalbumin at pH 2.0	80	X
11516	THE SOLUTION STRUCTURE OF THE C-TERMINAL DOMAIN OF HUMAN ACTIVATOR OF 90 KDA HEAT SHOCK PROTEIN ATPASE HOMOLOG 1	1734	X
11519	The chemical shift assignments of the headpiece subdomain of chicken villin protein under the diluted condition	100	X
11520	The chemical shift assignments of the headpiece subdomain of chicken villin protein under the crowded condition	66	X
11521	The chemical shift assignments of the headpiece subdomain of chicken villin protein under the crowded condition with the segment B1 of streptococcal protein G	66	X
11522	1H, 13C and 15N backbone resonance assignments of the monomeric human M-ficolin fibrinogen-like domain secreted by Brevibacillus choshinensis	1066	X
11523	Solution structure of the second RRM domain of Nrd1	1155	X
11524	NMR Structure of designed protein, AF.2A1, (Ensembles)	155	X
11525	Backbone 1H, 13C, and 15N Chemical Shift Assignments for PriC N-terminal domain	1231	X
11526	Backbone 1H, 13C, and 15N assignments of yeast Ump1, an intrinsically disordered protein operating as proteasome assembly chaperone	1103	X
11527	Backbone 1H, 13C, and 15N Chemical Shift Assignments for PriB	468	X
11528	STRUCTURE OF METALLO-DNA IN SOLUTION	220		X
11529	Solution structure of a regulatory domain of meiosis inhibitor	616	X
11530	chitin binding domain1	826	X
11531	Solution structure of the chitin-binding domain of Chi18aC from Streptomyces coelicolor	981	X
11532	solution structure of oxidized human HMGB1 A box	1057	X
11534	Solution structure of the GGQ domain of YaeJ protein from Escherichia coli	1523	X
11535	Solution structure of navitoxin	191	X
11536	Solution structure of MarkTX-7	177	X
11537	Solution structure of actinomycin	189	X
11538	Tachyplesin I in the presence of lipopolysaccharide	121	X
11539	Tachyplesin I in water	113	X
11540	Solution structure of esf3	666	X
11541	Solution Structure of Protein-RNA Complex	1042	X		X
11542	Backbone 1H, 13C, and 15N Chemical Shift Assignments for yeast Tim50 PBD domain	270	X
11543	NMR solution structure of [G5,T7,S9]-oxytocin	81	X
11544	DESIGNED ARMADILLO REPEAT PROTEIN SELF-ASSEMBLED COMPLEX (YIIM2-MAII)	1899	X
11545	Backbone 1H, 13C, and 15N chemical shift assignment for aqMutL-CTD	479	X
11546	1H, 15N and 13C resonance assignments of the conserved domain in the middle of Schizosaccharomyces pombe SAPK-interacting protein 1	1593	X
11547	the pure alternative state of ubiquitin	980	X
11548	DESIGNED ARMADILLO REPEAT PROTEIN FRAGMENT (MAII)	801	X
11549	DnaT C-terminal domain	1123	X
11551	Structure of antimicrobial peptide anoplin in DPC micelles	126	X
11552	Structure of anoplin mutant R5W in DPC micelles	129	X
11553	Structure of anoplin double mutant R5K T8W in DPC micelles	134	X
11554	Structure of anoplin double mutant R5F T8W in DPC micelles	88	X
11555	Structure of the YAM domain of E. coli Transporter YajR	811	X
11556	Sequential backbone HN, N, Ca and Cb assignments of E.coli dihydrofolate reductase G67V mutant-folate binary complex	566	X
11557	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the peptidyl prolyl cis-trans isomerase domain of human Pin1 without sulfate ion	546	X
11558	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the peptidyl prolyl cis-trans isomerase domain of C113D mutant human Pin1 without sulfate ion	539	X
11559	Solution structure of the peptidyl prolyl cis-trans isomerase domain of human Pin1 with sulfate ion	1438	X
11560	Solution structure of the peptidyl prolyl cis-trans isomerase domain of C113D mutant with sulfate ion	1433	X
11561	Redox protein (oxidized form)	1273	X
11562	Redox protein (reduced form)	1242	X
11563	Refined solution structure of the first RNA recognition motif domain in CPEB3	1341	X
11564	RPEL1 motif of MKL1	121	X
11565	L94P-RPEL1 motif of MKL1	119	X
11566	L105P-RPEL1 motif of MKL1	117	X
11567	RPEL2 motif of MKL1	118	X
11568	RPEL3 motif of MKL1	113	X
11569	Chemical Shift Assignments for MIP and MDM2 in bound state	1553	X
11570	Solution Structure of the Bacillus anthracis Sortase A-substrate Complex	1798	X
11572	Chemical shift assignments of the human Smoothelin CH domain	551	X
11573	Solution structure of the human BMX SH2 domain	1323	X
11574	SOLUTION STRUCTURE OF THE FIRST PDZ DOMAIN OF HUMAN KIAA1526 PROTEIN	1122	X
11575	SOLUTION STRUCTURE OF THE SECOND PDZ DOMAIN OF HUMAN KIAA1526 PROTEIN	1440	X
11578	Solution structure of the complex between p53 transactivation domain 2 and TFIIH p62 PH domain	1524	X
11580	NMR Structures and Localization of Potential Fusion Peptides and Pre-transmembrane Region of SARS-CoV: Implications in Membrane Fusion	136	X
11581	NMR Structures and Localization of Potential Fusion Peptides and Pre-transmembrane Region of SARS-CoV: Implications in Membrane Fusion	120	X
11582	NMR Structures and Localization of Potential Fusion Peptides and Pre-transmembrane Region of SARS-CoV: Implications in Membrane Fusion	125	X
11583	Solution structure of rat P2X4 receptor head domain	636	X
11584	Backbone 1H, 13C, and 15N Chemical Shift Assignments for c-Myb R2R3 C130I	375	X
11585	Backbone 1H, 13C, and 15N Chemical Shift Assignments for c-Myb R2R3 V103L/C130I	238	X
11587	Solution structure of Human Pin1 PPIase mutant C113A	1433	X
11588	Solution structure of Human Pin1 PPIase C113S mutant	1438	X
11589	A GB1-gp41 fusion protein containing hydrophobic pocket binding domain residues of gp41	334	X
11590	Solution Structure of the PhoP DNA-Binding Domain from Mycobacterium tuberculosis	1224	X
11591	Solution structure of chitosan-binding module 1 derived from chitosanase/glucanase from Paenibacillus sp. IK-5	1274	X
11592	Solution structure of chitosan-binding module 2 derived from chitosanase/glucanase from Paenibacillus sp. IK-5	1277	X
11593	Effects of linker length and transient secondary structure elements in the intrinsically disordered RAM region of NICD on Notch signaling	476	X
11594	Solution structure of the complex between XPC acidic domain and TFIIH p62 PH domain	1881	X
11595	Solution structure of Zalpha domain of goldfish ZBP-containing protein kinase	651	X
11596	Gallium ferredoxin	459	X
11597	Solution NMR structure of Monosiga brevicollis CRK/CRKL homolog (crka1) SH2 domain	1226	X
11599	NMR structure of eIF1	1318	X
11601	pET22-hESRP1-RRM3	591	X
11604	Solution structure of the chromodomain of HP1alpha with the N-terminal tail	1019	X
11605	Solution structure of the chromodomain of HP1alpha with the phosphorylated N-terminal tail	1032	X
11606	Solution structure of the chromodomain of HP1a with the phosphorylated N-terminal tail complexed with H3K9me3 peptide	1111	X
11607	Solution structure of a reverse transcriptase recognition site of a LINE RNA from zebrafish	130			X
11608	SOLUTION STRUCTURE OF DNA CONTAINING METALLO-BASE-PAIR	244		X
11609	Solution structure of the isolated histone H2A-H2B heterodimer	1221	X
12000	Backbone chemical shifts assignments of a two-domain family GH19 chitinase allergen from Japanese cedar (Cryptomeria japonica) pollen,CJP-4.	1080	X
12002	Backbone resonance assignments of the second LysM domain from Volvox carteri chitinase	230	X
12003	ILMV methyl assignments for the neuronal SNARE complex	444	X
12009	Backbone assignment of the N-terminal ubiquitin C-terminal hydrolase domain of UCH37	1016	X
12010	Backbone 1H, 13C, 15N chemical shift assignments for FliGc protein	480	X
12011	Backbone 1H, 13C, 15N chemical shift assignments for FliGc A282T mutated protein	442	X
12014	Backbone 1H, 13C, and 15N Chemical Shift Assignments for cyclophilin 1 from Trichomonas vaginalis	609	X
12016	Backbone 1H and 15N Chemical Shift Assignments for Sup35NM	438	X
12018	Backbone resonance assignments of the YAP-binding domain of transcription factor TEAD4 of mouse	559	X
12019	Solid-state NMR C-13 and N-15 chemical shifts of the chitin binding domain of chitinase A1 from Bacillus circulans WL-12	274	X
12020	1H and 15N Chemical Shifts Assignment for wild-type SPINK1	337	X
12021	1H and 13C Assignments for PPTI (Pseudocerastes Persicus Trypsin Inhibitor)	471	X
12022	sublancin chemical shifts	355	X
12024	Resonance assignments of a cellulosomal double-dockerin from Clostridium thermocellum	1786	X
12026	NMR resonance assignments of the NZF domain of mouse HOIL-1L in free form and linear di-ubiquitin-bound form	276	X
12032	Solution NMR structure of the W187R mutant of 1918 NS1 effector domain	1352	X
12033	c-MYC 353-437	283	X
12035	Backbone assignment for the segmental-labeled acidic region in the DNA-binding domain of Drosophila melanogaster SSRP1	403	X
12036	Backbone assignment for the segmental-labeled basic region and HMG-box in the DNA-binding domain of Drosophila melanogaster SSRP1	490	X
12038	Backbone assignment for the segmental-labeled acidic region in the phosphorylated DNA-binding domain of Drosophila melanogaster SSRP1	392	X
12039	Backbone assignment for the segmental-labeled basic region and HMG-box in the phosphorylated DNA-binding domain of Drosophila melanogaster SSRP1	454	X
12040	1H, 13C and 15N resonance assignments of the proteasome lid subunit Rpn12 from Saccharomyces cerevisiae	1147	X
12041	1H, 13C and 15N resonance assignments of Q38FZ4, hypothetical protein from Trypanosoma brucei	951	X
15000	Solution structure of chicken villin headpiece subdomain containing a fluorinated side chain in the core	340	X
15001	Structures and chemical shift assignments for the ADD domain of the ATRX protein	1390	X
15002	Solution structure of the THAP domain from C. elegans C-terminal binding protein (CtBP)	1148	X
15003	SOLUTION STRUCTURE OF GROUP IV WW DOMAIN: A.NIDULANS PINA	524	X
15007	Structural Studies on Plasmodium vivax Merozoite Surface Protein-1	875	X
15008	Backbone and Side Chain 1H, 13C and 15N Chemical Shift Assignments for Sporulation Phosphotransferase F Mutant H101A	1392	X
15009	Backbone and Side Chain 1H, 13C, 15N Chemical Shift Assignments for Sporulation Phosphotransferase F Mutant I90A	1490	X
15010	Backbone and Side Chain 1H, 13C and 15N Chemical Shift Assignments for Sporulation phosphotransferase F mutant L66A	1409	X
15011	Backbone and Side Chain 1H, 13C and 15N Chemical Shift Assignments for Sporulation phosphotransferase F mutant Y13A	1567	X
15012	chemical shift assignment of the protein Atu4866 from Agrobacterium tumefaciens	813	X
15013	Chimer between Spc-SH3 and P41	887	X
15014	Solution structure of the RING domain from human TRAF6.	730	X
15016	Solution structure of the Su(dx) WW4 - Notch peptide complex	782	X
15019	NMR assignments for a helical diacylglycerol kinase (DAGK), 40 kDa membrane protein from E. coli	538	X
15020	Structure of the N-WASP EVH1 domain in complex with an extended WIP peptide	1635	X
15021	Structural and Dynamical Analysis of a Four-Alpha-Helix Bundle with Designed Anesthetic Binding Pockets	693	X
15023	1H, and 15N Chemical Shift Assignments for the N-terminal domain of Myxococcus xantus CarA protein.	638	X
15025	Backbone 1H Chemical Shift Assignments for peptide sMTM7 from subunit a of proton V-ATPase	165	X
15026	NMR Structure of the IQ-modified Dodecamer CTCGGC[IQ]GCCATC	204		X
15027	NMR Structure of the B-DNA Dodecamer CTCGGCGCCATC	203		X
15028	1H, 13C, and 15N Chemical Shift Assignments of Trx-ArsC complex	2532	X
15031	Solution Structure of alpha-Conotoxin BuIA	70	X
15032	Chemical shift assignments of the type 1 pilus subunit FimF	2019	X
15033	Dimeric solution structure of the cyclic octamer d(CCGTCCGT)	67		X
15034	1H,13C and 15N NMR Assignments of the Yellow Fever Envelope Protein Domain III	1341	X
15035	1H, and 15N Chemical Shift Assignments for the N-terminal domain of Myxococcus xantus CarA protein.	590	X
15036	SOLUTION STRUCTURE OF HUMAN BETA-MICROSEMINOPROTEIN	1043	X
15037	Solution structure of human beta-microseminoprotein	467	X
15038	1H, 13C, and 15N resonance assignments of FK506-binding domain of Plasmodium falciparum FKBP35	1526	X
15039	solution structure of ta0956	1108	X
15040	DPC micelle-bound NMR structures of Tritrp2	101	X
15041	DPC micelle-bound NMR structures of Tritrp3	93	X
15042	DPC micelle-bound NMR structures of Tritrp5	102	X
15043	DPC micelle-bound NMR structures of Tritrp7	97	X
15044	DPC micelle-bound NMR structures of Tritrp8	97	X
15045	NMR SOLUTION STRUCTURE OF A MINIMAL TRANSMEMBRANE BETA-BARREL PLATFORM PROTEIN	528	X
15046	1H, 13C, and 15N resonance assignments of subunit F of the A1AO ATP synthase from Methanosarcina mazei Go1	1179	X
15047	Ubiquitin in 8 M Urea	215	X
15048	Rub184	1576	X
15049	Resonance assignment of the first and second KH (hnRNP-K homology) domains of human poly(C)-binding protein-2 (PCBP2)	1924	X
15050	piscidin solution structure in presence of DPC micelles	160	X
15051	DPC micelle-bound NMR structures of Tritrp1	99	X
15052	HPRP-173-195-D178N SOLUTION STRUCTURE	149	X
15053	HPRP-173-195 SOLUTION STRUCTURE	133	X
15054	HPRP180-195 STRUCTURE	106	X
15055	Structure for the N-terminus of chromosomal replication initiation protein dnaA from M. genitalium	1104	X
15056	Antiamoebin-I in methanol solution - rapid exchange between right- and left-handed 3-10-helical conformations	163	X
15057	Solution Structrue of C-terminal Bromodomain of Brd4	1263	X
15058	1H assignment of En-6	344	X
15059	1H, 13C, and 15N Chemical Shift Assignments for the muscular LIM protein MLP/CRP3.	1500	X
15060	NMR structure of the murine DLC2 (deleted in liver cancer -2) SAM (sterile alpha motif) domain	974	X
15061	NMR assignment of a KlbA intein precursor from Methanococcus jannaschii	2293	X
15063	NMR structure of the mouse thiamine triphosphatase	2483	X
15064	apo-WT chicken Triosephosphate Isomerase (TIM)	1140	X
15065	2-PGA-bound WT chicken Triosephosphate Isomerase (TIM)	885	X
15066	apo-PGG/GGG chicken Triosephosphate Isomerase (TIM)	786	X
15067	2-PGA-bound PGG/GGG chicken Triosephosphate Isomerase (TIM)	748	X
15068	Structure-Activity Analysis of Quorum-Sensing Signaling Peptides from Streptococcus mutans	130	X
15069	Structure-Activity Analysis of Synthetic Quorum-Sensing Signal Peptides from Streptococcus mutans	111	X
15070	NMR Assignments of the apo Corynebacterium diphtheria Heme Oxygenase-G135A	952	X
15071	NMR Assignments of the apo Corynebacterium diphtheria Heme Oxygenase	870	X
15072	OSCP-NT (1-120) in complex with N-terminal (1-25) alpha subunit from F1-ATPase	1060	X
15073	NMR assignments of CO-bound ferrous Corynebacterium diphtheria Heme Oxygenase	798	X
15074	Assignment of the 1H, 15N and 13C resonances and determination of the 3D- structure of In-Between-RING (IBR) domain of Parkin	845	X
15075	Merozoite surface protein 2 (MSP2) of Plasmodium falciparum: expression, structure and amyloid formation of the conserved N-terminal domain	196	X
15076	Dynein Light Chain LC8 at pH 5.5	261	X
15077	Dynein Light Chain LC8 at pH 5.5, complex with Swa peptide	330	X
15078	Dynein Light Chain LC8 at pH 5.5, complex with IC peptide	324	X
15079	Solution NMR structure of the ygdR protein from Escherichia coli. Northeast Structural Genomics target ER382A.	552	X
15080	U2 snRNA stem I from S. cerevisiae	310			X
15081	U2 snRNA stem I from human	192			X
15082	HN,CA,CB Chemical shift assignments for apo-Rat intestinal fatty acid binding protein, Clofibric acid-Rat intestinal fatty acid binding protein complex, Fenofibric acid-Rat intestinal fatty acid binding protein complex and Tolfenamic acid-Rat intestinal fatty acid binding protein complex.	507	X
15083	NMR Structure of the Sigma-54 RpoN Domain Bound to the-24 Promoter Element	948	X	X
15084	NMR structure of cl-BABP complexed to chenodeoxycholic acid	1617	X
15085	Complete Assignment of a hypothetical portein RP4601 (NESG ID: RpT2)from Rhodopseudomonas palustris.	789	X
15086	Solution NMR structure of Hypothetical Protein Cgl2762 from Corynebacterium Glutamicum: Northeast Structural Genomics Consortium Target CgR3	1190	X
15087	SOLUTION STRUCTURE OF THE PABC DOMAIN FROM TRITICUM AEVESTIUM POLY(A)-BINDING PROTEIN	471	X
15088	Northeast Structural Genomics Consortium Target ER411	1019	X
15089	Solution NMR structure of Q8ZRJ2 from Salmonella typhimurium. Northeast Structural Genomics target StR65.	1359	X
15090	Solution NMR Structure of Salmonella typhimurium LT2 Secreted Protein STM0082: Northeast Structural Genomics Consortium Target StR109	952	X
15091	Lipid Free Mouse Apolipoprotein-AI(mAI216)NMR Backbone Assignment	1880	X
15092	1H, 13C, 15N chemical shift assignments for the human E2 ubiquitin conjugating enzyme Ubc13	1268	X
15093	preB ApoAI backbone assignment	881	X
15094	1H, 13C, and 15N Chemical Shift Assignments for CutA1 from E. coli	730	X
15095	Solution Structure of a Dodecapeptide from Alpha-Synuclein Bound with Synphilin-1	73	X
15097	Dynamics and Calcium-Dependent Actin Bundling by the two Carboxy Terminal Domains of Villin	1602	X
15098	SOLUTION STRUCTURES OF THE BRK DOMAINS OF THE HUMAN CHROMO HELICASE DOMAIN 7 AND 8, REVEALS STRUCTURAL SIMILARITY WITH GYF DOMAIN SUGGESTING A ROLE IN PROTEIN INTERACTION	674	X
15099	Solution structure of CM15 in DPC micelles	106	X
15100	NMR structure of E.coli YfgJ protein modelled with two Zn+2 bound. Northeast Structural Genomics Consortium Target ER317.	851	X
15101	Backbone 1H, 15N, and 13C Resonance Assignment and Secondary Structure Prediction of HP0495 from Helicobacter pylori	485	X
15102	IKs producing slow voltage-gated potassium channel subunit beta, KCNE1	947	X
15103	Structure of NOWA cysteine rich domain 6	42	X
15104	Structure of NOWA cysteine rich domain 8	52	X
15105	Solution Structure of the first Clip domain in PAP2 (CASP Target)	596	X
15106	Solution Structure of the second Clip domain in PAP2 (CASP Target)	540	X
15107	NMR structure of D4P/K7G mutant of GPM12	53	X
15108	NMR structure of p1 from the infectious bursal disease virus (IBDV) in dodecylphosphocholin (DPC).	318	X
15109	Solution structure of the CUL7-CPH domain from Homo Sapiens; Northeast Structural Genomics Consortium target HT1.	1186	X
15110	Solution structure of V21C/V59C Lymphotactin/XCL1	1058	X
15111	Solution Structure of the UBA Domain from Cbl-b	413	X
15112	Assignment of the reduced Cu,Zn Superoxide Dismutase from Salmonella choleraesuis	1891	X
15113	Solution Structure of the Rous Sarcoma Virus Nucleocapsid Protein:muPsi RNA Packaging Signal Complex	655	X		X
15114	Solution structure of L8A mutant of HIV-1 myristoylated matrix protein	1291	X
15115	Solution structure of antimicrobial peptide Arenicin-2 in water	140	X
15116	Solution structure of V7R mutant of HIV-1 myristoylated matrix protein	1323	X
15117	Backbone H, C, N Chemical Shifts for Influenza A NS1 (1-73) Protein Bound to dsRNA	410	X		X
15118	LPS-bound structure of a designed peptide	89	X
15120	SOLUTION STRUCTURE OF MATRIX METALLOPROTEINASE 3 (MMP-3) IN THE PRESENCE OF N-ISOBUTYL-N-[4-METHOXYPHENYLSULFONYL]GLYCYL HYDROXAMIC ACID (NNGH)	1374	X
15121	Backbone 1H, 13C and 15N resonance assignments for the 26kD human deubiquitinating enzyme UCH-L3	963	X
15122	Structure and dynamics of surfactin studied by NMR in micellar media	70	X
15123	SeV Ntail(443-501)	589	X
15124	Discovery and optimization of a natural HIV-1 entry inhibitor targeting the gp41 fusion peptide	218	X
15125	N.N.	1099	X
15126	NMR assignments of the mannitol- specific cryptic phosphotransferase enzyme IIA CmtB from Escherichia coli	1663	X
15127	Chemical shift and constraint files for the RegB ribonuclease	2767	X
15128	Solution structure of the RGS domain of human RGS14	1729	X
15129	Solution structure of the first SH3 domain of human Vinexin and its interaction with the peptides from Vinculin	710	X
15130	CA Chemical Shift Assignments for alpha-bungarotoxin (pH6.0)	152	X
15131	NMR assignment of an intrinsically disordered protein under physiological conditions: the 18.5 kDa isoform of murine myelin basic protein	1253	X
15132	The highly cooperative folding of small, naturally occurring proteins is likely the result of natural selection.	743	X
15133	Solution NMR structure of protein Uncharacterized BCR, Northeast Structural Genomics Consortium target CgR1	736	X
15134	Solution structure of phl p 3, a major allergen from timothy grass pollen	1167	X
15135	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Endosulfine alpha in the presence of SDS micelles	553	X
15136	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Endosulfine alpha	496	X
15137	The solution structure of the monomeric species of the C terminal domain of the CA protein of HIV-1	594	X
15138	13C and 15N resonance assignments for the major coat protein in Pf1 filamentous bacteriophage	245	X
15139	NMR structure of the E.coli protein NirD, Northeast Structural Genomics target ET100	1395	X
15140	Proton chemical shifts of mytilin	226	X
15141	Chemical shift assignment of TC-1	383	X
15142	Solution structure of dynein light chain 2A	1044	X
15143	1H (NH, HA, HB) Chemical Shift Assignments of the Non-Specific Lipid Transfer Protein (nsLTP1) with post translational modification, isolated from Barley Seeds	279	X
15145	1H, Chemical Shift Assignments for neurotensin in HFIP:H20 (80:20), TFE:D20(80:20), and DPC micelles	326	X
15148	HMGB1 AB boxes + basic tail backbone assignment	684	X
15149	HMGB1 Full Length backbone assignment	304	X
15150	Solution Structure and Binding Property of the Domain-swapped Dimer of ZO2PDZ2	1024	X
15152	Hydrogenase isoenzymes formation protein HypC	1065	X
15153	Mouse Itch 3rd WW domain complex with the Epstein-Barr virus latent membrane protein 2A derived peptide EEPPPPYED	560	X
15154	HtrA1 bound to an optimized peptide: NMR assignment of PDZ domain and ligand resonances	1319	X
15156	Solid-State Protein Structure Determination with Proton-Detected Triple Resonance 3D Magic-Angle Spinning NMR Spectroscopy: Beta-1 Immunoglobulin Binding Domain of Protein G (GB1)	527	X
15157	NMR structure of the UGUU tetraloop of Duck Epsilon apical stem loop of the Hepatitis B virus	29			X
15158	Solution structure of the adhesion protein Bd37 from Babesia divergens	2668	X
15159	Mouse Itch 3rd domain phosphorilated in T30	240	X
15160	Solution Structure of the Ubiquitin-Binding Zinc Finger (UBZ) Domain of the Human DNA Y-Polymerase Eta	420	X
15161	The MYND domain from human AML1-ETO	530	X
15162	Backbone Chemical Shift Assignments of Cholera Toxin Enzymatic Domain (1-167)	652	X
15163	Backbone 1H, 13C, and 15N Chemical Shift Assignments for LARG PDZ domain in complex with C-terminal octa-peptide of Plexin B1	950	X
15164	Backbone chemical shifts assignment of the soluble N-terminal region of the ATP7A	1577	X
15166	Pac1-Rshort N-terminal EC domain Pacap(6-38) complex	975	X
15167	NMR Structure of E. Coli YehR Protein. Northeast Structural Genomics Target ER538.	1732	X
15168	Backbone 1H, 13C, and 15N Chemical Shift Assignments for LARG PDZ domain	909	X
15169	The Trp-cage: Optimizing the Stability of a Globular Miniprotein	109	X
15170	Backbone assignments of DNA methyltransferase M.HhaI	967	X
15171	H1 chemical shift assignment of putative membrane-anchoring domain of alMGS (S65-L87)	232	X
15172	1H, 13C and 15N chemical shift assignments for hypothetical protein TA0095 from Thermoplasma acidophilum	1855	X
15173	The MYND domain from human AML1-ETO fused to a SMRT peptide through a TEV cleavable linker	685	X
15174	1H, alpha-13C Chemical Shift Assignments for [L-Phe44]iota-RXIA	318	X
15175	proton and alpha-carbon chemical shift of [D-Phe44]iota-RXIA	304	X
15176	Intrinsically unstructured proteins provide the specificity for protein phosphatase 1 regulation.	1268	X
15177	Resonance assignments of the metal sensor CzrA in the apo-, Zn2- and DNA-bound (42 kDa) states	713	X
15178	Backbone, C' and CB 13C, 15N and 1H chemical shift assignments for the RGS domain of the human Regulator of G-protein Signalling 3(RGS3)protein	883	X
15179	Intrinsically unstructured proteins provide the specificity for protein phosphatase 1 regulation.	1670	X
15180	Intrinsically unstructured proteins provide the specificity for protein phosphatase 1 regulation.	758	X
15189	Solution structure of the N-terminal extracellular domain of the lymphocyte receptor CD5 (CD5 domain 1)	1250	X
15190	Solution Structure of Protein HP0495 from H. pylori; Northeast structural genomics consortium target PT2; Ontario Centre for Structural Proteomics target HP0488	1157	X
15192	NMR Solution Structure, Stability, and Interaction of the Recombinant Bovine Fibrinogen alphaC-Domain Fragment	403	X
15193	1H, 13C, and 15N NMR resonance assignments of Sec95Cys MsrB1 protein	1243	X
15194	1H, 13C and 15N resonance assignment of truncated SUMO from Trypanosoma brucei	1036	X
15195	Solution Structure of an M-1 Conotoxin with a novel disulfide linkage	82	X
15196	NMR structure of the HIV-2 nucleocapsid protein	163	X
15197	1H, 15N, and 13C chemical shift assignments for CaBP1	1577	X
15198	Backbone 1H, 13C, and 15N Chemical Shift Assignments for all-Ala-HEWL	915	X
15199	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the PDZ2 PDZ3 tandemdomain of PTP-BL	867	X
15200	NMR assignment of the apo-form of a Desulfovibrio gigas protein containing a novel Mo-Cu cluster	1431	X
15201	Sequence-specific resonance assignments for OmpX in 8 M urea aqueous solution	1565	X
15202	Rub184b	753	X
15203	NMR Structure of Clostridium Perfringens Protein CPE0013. Northeast Structural Genomics Target CpR31.	996	X
15204	Backbone assignment of human IgG1 CH3 domain	1114	X
15206	Differences in the electrostatic surfaces of the type III secretion needle proteins	845	X
15207	1H, 13C and 15N resonance assignments of YajG	2101	X
15208	Embryonic Neural Inducing Factor Churchill is not a DNA-Binding Zinc Finger Protein: Solution Structure Reveals a Solvent-Exposed Beta-Sheet and Zinc Binuclear Cluster	1301	X
15209	Structure of the hDLG/SAP97 PDZ2 in complex with HPV-18 papillomavirus E6 peptide	1087	X
15210	NMR Structure of 50S Ribosomal Protein L14e from Sulfolobus Solfataricus; Northeast Structural Genomics Consortium Target SSR105.	1249	X
15211	Solution NMR structure of protein , Northeastprotein yxeF Structural Genomics Consortium target Sr500a	1559	X
15212	1H, 13C, and 15N Chemical Shift Assignments for the first Nterminal domain, RRM1, of hnRNP H	1114	X
15213	Assignments of {lambda}-IntCB bound to a DNA half-site	392	X	X
15214	MxiHCdelta5 backbone assignment	176	X
15215	Solution structure of the alternative conformation of XCL1/Lymphotactin	890	X
15217	NMR SOLUTION STRUCTURE OF YKVR PROTEIN FROM BACILLUS SUBTILIS: NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET SR358	1170	X
15218	1H and 13C Chemical shifts for the ATWLPPR peptide.	80	X
15219	Backbone 1H, 15N and 13C chemical shift assingments for human retinoid X receptor ligand-binding domain in complex with 9-cis retinoic acid and a glucocorticoid receptor interacting protein-1 peptide	942	X
15221	Solution structure of Tc32 toxin from the scorpion Tityus cambridgei	197	X
15222	PV-3C	676	X
15223	Duplex DNA containing an abasic site with an opposite G (alpha anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)	228		X
15224	Duplex DNA containing an abasic site with an opposite G (beta anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)	228		X
15225	1H, 13C, and 15N resonance assignments of domain 2 of non-structural protein 5A (NS5A) of hepatitis C virus	1114	X
15226	High resolution Solid state NMR structure of Kaliotoxin bound to Potassium channel	123	X
15227	Duplex DNA containing an abasic site with an opposite T (alpha anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)	225		X
15228	Duplex DNA containing an abasic site with an opposite T (beta anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)	225		X
15229	ATOMIC STRUCTURE OF TRANSLATION INITIATION FACTOR aIF2 beta-SUBUNIT FROM ARCHAEBACTERIA SULFOLOBUS SOLFATARICUS: HIGH RESOLUTION NMR IN SOLUTION	848	X
15230	1H, 13C and 15N resonance assignments for the small GTPase RalB in its active conformation	2192	X
15231	ErbB2TM	533	X
15232	proline-free mutant of SNase V8	1164	X
15233	1H, 15N backbone chemical shift assignment of the G130V mutant of the C terminal domain of human frataxin	218	X
15234	1H, 15N backbone chemical shift assignment of D122Y mutant of the C terminal domain of human frataxin	212	X
15235	1H, 15N backbone chemical shift assignment of the W155R mutant of the C terminal domain of human frataxin	212	X
15236	1H, 15N backbone chemical shift assignemnt of the G26K,D27S,D31A triple mutant of the protein CyaY	208	X
15237	1H, 15N chemical shift backbone assignment of the D31K mutant of the protein CyaY	200	X
15238	Duplex DNA containing an abasic site with an opposite dC (alpha anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)	205		X
15239	Duplex DNA containing an abasic site with an opposite dC (beta anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)	204		X
15240	Solution structure of the ERCC1 central domain	1482	X
15241	1H Chemical shift assignments for [Nle15] gastrin-17 in the presence of DPC micelles.	183	X
15242	FHA domain of NIPP1	1692	X
15243	1H, 15N, 13C chemical shifts of human translationally controlled tumor protein	2141	X
15244	1H, 15N chemical shift backbone assignment of the E19K,D22K mutant of the protein CyaY	204	X
15245	NMR SOLUTION STRUCTURE OF THE VILLIN HEADPIECE MUTANT G34L	219	X
15246	chemical shift assignments of PA4090 from Pseudomonas aeruginosa	1041	X
15247	1H, 13C and 15N resonance assignments of the Escherichia coli YaeT POTRA domain	1906	X
15248	Main chain NMR assignments of SBT70 in its prodomain-bound state	1103	X
15249	Sequence-Specific 1H, 13C and 15N Resonance Assignments of the Cyclic Nucleotide Binding Domain from a Cyclic Nucleotide-Gated Potassium Channel in Complex with cAMP	1684	X
15250	Main chain NMR assignments of SBT70	980	X
15252	Solution Structure of T4 Bacteriophage Helicase Uvsw.1	751	X
15253	NMR assignments of the binary hvDHFR1:folate complex	1557	X
15256	Antheraea polyphemus pheromone-binding protein 1: structure and assignments at pH 4.5.	1767	X
15257	Structural basis of RsmA/CsrA RNA recognition: Structure of RsmE bound to the Shine-Dalgarno sequence of hcnA mRNA	1042	X		X
15258	NMR solution structure of Vibrio parahaemolyticus VP2129 homodimer. Northeast Structural Genomics target VpR61.	1021	X
15259	LactococcinGa in DPC and TFE	597	X
15261	LactococcinGb in DPC and TFE	563	X
15263	1H, 13C, and 15N Chemical Shift Assignments for NAB2 N-terminal domain	1162	X
15264	Complete backbone 15N, 13C, and 1H resonance assignments for the N-terminal domain of AhpF	772	X
15265	solution structure of NESG target SsR10, Orf c02003 protein	1661	X
15266	1H, 13C, and 15N Backbone Resonance Assignments of the Carboxyl Terminal Domain of Connexin40	1208	X
15267	NMR structure of the anticoccidial peptide PW2 in DPC micelles	82	X
15268	Structure and Dynamics of Human Apolipoprotein C-III	459	X
15269	Complete resonance assignments and solution structure calcualtion of ATC2521 (NESG ID: AtT6) from Agrobacterium tumeraciens	972	X
15270	Solution structure of RPA3114, a SEC-C motif containing protein from Rhodopseudomonas palustris; Northeast Structural Genomics Consortium target RpT5 / Ontario Center for Structural Proteomics target RP3097	1434	X
15271	Solution structure of the Somatomedin B domain from vitronectin produced in Pichia pastoris	480	X
15272	The NMR solution structure of a pH sensitive,D-amino acid containing conopeptide, mr12 .	88	X
15273	A L-amino acid mutant of a D-amino acid containing conopeptide	80	X
15274	NMR chemical shift assignments for Arf-binding domain of Hdm2	458	X
15275	Soution Structure of Af54 M-domain	1081	X
15276	1H, 13C and 15N resonance assignment of 6aJL2(R25G), a highly fibrillogenic lamdaVI light chain variable domain.	1296	X
15277	Full Length Leader Protease of Foot and Mouth Disease Virus C51A Mutant	548	X
15278	Leader Protease	774	X
15279	Structure of the EH-domain of EHD1	1700	X
15280	1H, 13C and 15N resonance assignment of the oxidized form (Cys67-Cys70) of the N-terminal domain of PilB from Neisseria meningitidis	1529	X
15281	Solution NMR structure of CC0527 from Caulobacter crescentus. Northeast Structural Genomics target CcR55.	1437	X
15282	Backbone 1H Chemical Shift Assignments for N-Me-Phe5	130	X
15283	13C and 15N Chemical Shift Assignments and Secondary Structure of the B3 Immunoglobulin-Binding Domain of Streptococcal Protein G (GB3) by Magic-Angle Spinning Solid-State NMR Spectroscopy	341	X
15284	Backbone 1H Chemical Shift Assignments for N-Me-Leu8	129	X
15285	Backbone 1H Chemical Shift Assignments for N-Me-Lys11	131	X
15286	NMR structure of Bungatoxin from Bungarus Candidus (Malayan Krait venom)	395	X
15287	Backbone 1H Chemical Shift Assignments for N-Me-Phe12	128	X
15288	NMR solution structure of Bacillus subtilis YobA 21-120: Northeast Structural Genomics Consortium target SR547	1324	X
15289	1H, 15N chemical shift assignment of the THAP domain 1-81 from human THAP1 protein	641	X
15290	Solution structure of Saccharomyces cerevisiae conserved oligomeric Golgi subunit 2 protein (Cog2p)	2446	X
15291	Backbone 1H Chemical Shift Assignments for N-Me-Gly13	131	X
15292	Backbone 1H Chemical Shift Assignments for N-Me-Ser14	131	X
15293	Backbone 1H Chemical Shift Assignments for N-Me-Leu8/N-Me-Ser14	130	X
15294	Backbone 1H Chemical Shift Assignments for N-Me-Val1/N-Me-Leu8/N-Me-Ser14	136	X
15295	Solution structure At3g28950.1 from Arabidopsis thaliana	1690	X
15296	Chemical assignments of Ca-S100A1 bound to RyRP12	1045	X
15298	Beta-synuclein	753	X
15299	AgTx2-MTX Toxin	217	X
15300	1H, 15N, 13C chemical shift assignment of the THAP domain 1-90 from human THAP1 protein	748	X
15301	Solution model of crosslinked complex of cytochrome c and adrenodoxin	292	X
15302	a novel lectin-like peptide from Odorrana grahami	107	X
15303	1H, 15N, 13C resonance assignments for bb' domains of human protein disulfide isomerase (PDI)	2069	X
15304	NMR strcuture determination of the periplasmic domain of ExbD from E.coli	1198	X
15305	1H Chemical Shift Assignments for Cardiotoxin A3 from Naja Atra at Neutral pH and temperature of 318K	1102	X
15306	Solution Structure of the C2 domain of human Smurf2	1435	X
15309	1H Chemical Shift Assignments for Cardiotoxin A5 from Naja Atra at Neutral pH and temperature of 318K	1073	X
15312	Solution structure of NusB from Aquifex Aeolicus	1829	X
15313	1H, 15N and 13C backbone and side chain chemical shifts of human ASC (apoptosis-associated speck-like protein containing a CARD domain)	2331	X
15314	Solution structure of the DNA binding domain of a nucleoid-associated protein, H-NS, from the phytopathogen Xylella fastidiosa.	893	X
15315	Resonance assignments for the discoidin domain of DDR2.	1868	X
15316	Electrostatic contributions to the stability of the GCN4 leucine zipper structure.	393	X
15317	NMR Solution Structure of Colwellia psychrerythraea protein CPS_2611. Northeast Structural Genomics target CsR4.	972	X
15318	Antibacterial Peptide from Eggshell Matrix: Structure and Self-assembly of a - defensin Like Peptide from the Chinese Soft-shelled Turtle Eggshell	250	X
15319	NMR SOLUTION STRUCTURE OF THE ANTICODON OF E.coli TRNA-VAL3 WITH NO MODIFICATIONS	117			X
15320	Solution structure of UPF0350 protein VC_2471: Northeast Structural Genomics Target VcR36	1079	X
15322	1H, 13C, and 15N Chemical Shift Assignments for Chemotaxis Protein CheW	1983	X
15323	Solution structure of Manduca sexta moricin	263	X
15324	A novel domain-swapped solution NMR structure of protein RPA2121 from Rhodopseudomonas palustris	777	X
15325	C-terminal domain of ORF1p from mouse LINE-1	1127	X
15326	Backbone 13C, HN and 15N assignments for human chemerin	742	X
15327	Chemical Shift Assignments for E. coli protein YqcC: Northeast Structural Genomics Consortium target ER225	1211	X
15329	Solution NMR structure of Tubulin polymerization-promoting protein family member 3 from Homo sapiens. Northeast Structural Genomics target HR387.	2048	X
15330	Caenopore-5 -Pro cis conformer	860	X
15331	NMR SOLUTION STRUCTURE OF THE ANTICODON OF E.coli TRNA-VAL3 WITH 2 MODIFICATIONS (cmo5U34 M6A37)	122			X
15332	Solution sturcture of human MEKK3 PB1 domain cis isomer	1060	X
15333	Resonance Assignment of the human Pirh2 RING domain; Northeast Structural Genomics Consortium Target HT2B	609	X
15334	Solution Structure of the Beryllofluoride-Activated NtrC4 Receiver Domain Dimer	1320	X
15335	Structure of Staphylococcus saprophyticus CHAP domain protein. Northeast Structural Genomics Target SyR11.	1740	X
15336	1H, 13C and 15N Backbone Resonance Assignments of the Nonphosphorylated CFTR Regulatory Region	884	X
15337	Solution NMR Structure of SO0334 from Shewanella Oneidensis. Northeast Structural Genomics Target SoR75	1023	X
15338	NMR Structure of Protein YfgJ from Salmonella Typhimurium. Northeast Structural Genomics Target StR86.	912	X
15339	Solution NMR Structure of Ribosome Modulation Factor VP1593 from Vibrio parahaemolyticus. Northeast Structural Genomics Target VpR55	736	X
15340	1H, 13C, and 15N Backbone Assignments and 13C Aliphatic Sidechain Assignments for PKA Phosphorylated CFTR Regulatory Region	1115	X
15341	Solution Structure of Q5LLS5 from Silicibacter pomeroyi. Northeast Structural Genomics Consortium target SiR90.	683	X
15342	NMR SOLUTION STRUCTURE OF THE ANTICODON OF E.coli TRNA-VAL3 WITH 1 MODIFICATION (cmo5U34)	124			X
15343	Solution NMR Structure of CAPER RRM2 Domain. Northeast Structural Genomics Target HR4730A.	1214	X
15344	The solution structure of the protein coded by gene RHOS4_12090 of R. sphaeroides. Northeast structural genomics target RhR5	1184	X
15345	Solution structure of Blo t 5	970	X
15346	NMR chemical shift assignments for E. coli YejL protein: target ER309 of the Northeast Structural Genomics Consortium	1016	X
15347	Chemical Shift Assignments for protein NE0084 from Nitrosomonas europea: Northeast Structural Genomics Target NeT6	923	X
15348	Solution structure of the Bright/ARID domain from the human JARID1C protein.	1384	X
15349	Solution structure of second SH3 domain of adaptor Nck	719	X
15350	Northeast Structural Genomics Target SR478	737	X
15351	Solution structure of first SH3 domain of adaptor Nck	789	X
15352	NMR Structure of protein Q6N9A4_RHOPA:Northeast Structural Genomics Consortium Target RpT8	1030	X
15353	Solution NMR Structure of Bordetella bronchiseptica protein BB2007: Northeast Structural Genomics Consortium Target BoR54	773	X
15354	NMR Structure of protein Q60C73_METCA:Northeast Structural Genomics Consortium target McR1	858	X
15355	solution structure of human MEKK3 PB1 domain	1054	X
15356	Solution NMR Structure of Human Myeloid Differentiation Primary Response (MyD88). Northeast Structural Genomics target HR2869A.	2003	X
15357	the solution structure of SNase complex	1624	X
15358	structure of caenopore-5 (99 Pro trans)	857	X
15359	Solution structure of arenicin-1	143	X
15360	Solution Structures of a DNA Dodecamer Duplex	288		X
15361	Solution Structure of MMP20 complexed with NNGH	1802	X
15362	NMR SOLUTION STRUCTURE OF THE ANTICODON OF E.coli TRNA-VAL3 WITH 1 MODIFICATION (M6A37)	120			X
15363	A D-amino acid containing conopeptide, marmophine, from Conus marmoreus	82	X
15364	Solution Structure of Human Immunodificiency Virus Type-2 Nucleocapsid Protein	517	X
15366	Human eRF1 C-domain	635	X
15367	RgIA, a Novel Conotoxin that Blocks the nAChR	80	X
15368	RgIA, a Novel Conotoxin that Blocks the nAChR	75	X
15369	Maize Ribosome-Inactivating protein (MOD)	2978	X
15370	solution structure of the atypical PDZ-like domain of synbindin	909	X
15371	antimicrobial resistance protein	1054	X
15372	Solution Structure of the Tick Carboxypeptidase Inhibitor	793	X
15373	The prokaryotic Cys2His2 zinc finger adopts a novel fold as revealed by the NMR structure of A. tumefaciens Ros DNA binding domain	931	X
15374	Zinc substitued Rubredoxin from Desulfovibrio Vulgaris	357	X
15375	Nickel substitued Rubredoxin from Desulfovibrio Vulgaris	303	X
15376	SOLUTION STRUCTURE OF A DNA DUPLEX CONTAINING THE UNIVERSAL BASE 5-NITROINDOLE-3-CARBOXAMIDE	185		X
15377	Solution structure of human DESR1	928	X
15378	NMR structure of the S. aureus VraR DNA binding domain	660	X
15379	Sup35 NM	264	X
15380	Crystal Polymorphism of GB1 Examined by Solid-State NMR Spectroscopy and X-ray Diffraction	618	X
15381	Solution structure of the E. coli Tat proofreading chaperone protein NapD	912	X
15382	Nuclear Magnetic Resonance Studies on Huwentoxin-XI from the Chinese Bird Spider Ornithoctonus huwena	374	X
15383	1H, 13C, and 15N Chemical Shift Assignments for the N-domain of Bacillus subtilis ClpC	1807	X
15384	Four-Alpha-Helix Bundle with Designed Anesthetic Binding Pockets II: Halothane Effects on Structure and Dynamics	649	X
15385	Solution structure of F104W cardiac troponin C	1728	X
15386	Solution NMR structure of PefI protein from Salmonella typhimurium. Northeast Structural Genomics target StR82.	906	X
15388	Solution Structure of F153W cardiac troponin C	1619	X
15389	solution structure of hiv-1 gp41 fusion domain bound to DPC micelle	141	X
15390	Influenza Hemagglutinin Fusion Domain Mutant F9A	122	X
15391	Tetrameric structure of KIA7 peptide	145	X
15392	Tetrameric structure of KIA7F peptide	141	X
15393	Structure of Chz1 Complexed with H2A.Z-H2B and Eviction of Nucleosomal H2A-H2B	2669	X
15394	NMR structure of rabbit prion protein mutation S173N	1157	X
15395	SOLUTION STRUCTURE OF MATRIX METALLOPROTEINASE 3 (MMP-3) IN THE PRESENCE OF N-hydroxy-2-[N-(2-hydroxyethyl)biphenyl-4-sulfonamide] hydroxamic acid (MLC88)	300	X
15396	SOLUTION STRUCTURE OF MATRIX METALLOPROTEINASE 3 (MMP-3) IN THE PRESENCE OF 3-4'-CYANOBYPHENYL-4-YLOXY)-N-HDYDROXYPROPIONAMIDE (MMP-3 INHIBITOR VII)	300	X
15397	NH, NN, C, CA and CB chemical shift assignment of the transcriptional activation domain 1 of the nuclear hormone receptor coactivator ACTR in the free state	306	X
15398	NH, NN, C and CA chemical shift assignment of the nuclear coactivator binding domain of CBP in the free state	201	X
15399	NMR structure of rabbit prion protein mutation I214V	1614	X
15400	Backbone and side chain chemical shift assignments of the F153-to-5-flurotryptophan mutant of human cardiac troponin C	1526	X
15401	Calcium binding protein in the free form	1464	X
15402	Calcium binding protein in the calcium-binding form	1489	X
15403	Simian Foamy Virus (mac) protease structure	1234	X
15404	Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments for H. capsulatum CBP	811	X
15405	The NMR Solution Structure of Recombinant RGD-hirudin	410	X
15406	Solution structure of E.coli PapI	930	X
15407	Third SH3 domain of CD2AP	776	X
15408	NMR-detected conformational exchange observed in a computationally designed variant of protein Gb1	673	X
15409	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the cytoplasmic domain of the T cell receptor zeta chain	529	X
15410	Backbone 1H, 13C, and 15N Chemical Shift Assignments for human ubiquitin	354	X
15411	NMR structure of the talin C-terminal actin binding site	2262	X
15412	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Snu13p	1578	X
15413	High resolution NMR structure of YW12D in the presence of Lipopolysaccharide (LPS)	86	X
15415	Solution structure of Sso6901 from Sulfolobus solfataricus P2	764	X
15417	Solution Structure of the Frameshift-Inducing RNA Stem-Loop in SIV	397			X
15418	NMR structure of the S100A6 dimer in complex with a binding fragment of the Siah-1 interacting protein	799	X
15419	Solution Structure of protein RPA3401, Northeast Structural Genomics Consortium Target RpT7, Ontario Center for Structural Proteomics Target RP3384	706	X
15420	1H and 15N Chemical Shift Assignments of Recombinant Margatoxin	289	X
15421	1H and 15N Chemical Shift Assignments of Recombinant Agitoxin2	278	X
15422	Partial chemical shift assignments of KChIP4a in its Ca2+- and Mg2+-loaded form	799	X
15423	Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments for FimA	1932	X
15424	NMR Assignment of Cdc42(T35A), and Active Switch I mutant of Cdc42	1667	X
15425	Partial chemical shift assignments of the N-terminal deletion mutant KChIP4a(Delta1-42) in its Ca2+- and Mg2+-loaded form	663	X
15426	Solution NMR structure of OmpG	1149	X
15427	Chemical shift assignments of the F104-to-5-flurotryptophan mutant of cardiac troponin C	1716	X
15429	Solution-state NMR structures of apo-LFABP (Liver Fatty Acid-Binding Protein)	1492	X
15430	The chemical shift assignment of gamma subunit of phosphodiesterase	845	X
15431	NMR assignment of the periplasmic oxidoreductase DsbH from Chlamydia	1603	X
15433	Solution-State Structures of Oleate-Liganded LFABP, Protein Only	1605	X
15434	Solution-State Structures of Oleate-Liganded LFABP, Major Form of 1:2 Protein-Ligand Complex	1605	X
15435	alpha-RgIA, a Novel Conotoxin That Blocks the alpha9alpha10 nAChR	122	X
15436	alpha-RgIA, a Novel Conotoxin That Blocks the alpha9alpha10 nAChR	78	X
15437	Assignment, structure, and dynamics of de novo designed protein S836	1254	X
15438	Solution structure of IPI*	745	X
15439	URN1 FF domain yeast	397	X
15440	1H, 13C and 15N resonance assignments of the C-terminal domain of HasB from Serratia marcescens	1576	X
15441	Backbone chemical shift assignments of dynein intermediate chain IC74 residues 84-143	221	X
15442	Multienzyme Docking in Hybrid Megasynthetases	898	X
15443	Structural Study of Ac-Phe-[Orn-Pro-dCha-Trp-Arg], a Potent C5a Receptor Antagonist, by NMR	62	X
15444	solution structure of DNA binding domain of ngTRF1	1087	X
15446	2cxxc, YgiT	1322	X
15447	8F19F1 module pair from Fibronectin	173	X
15448	Backbone 1H, 13C, and 15N Chemical Shift Assignments for ClpS from Xanthomonas axonopodis pv citri	1000	X
15449	Type I rat fatty acid synthase acyl carrier protein (ACP) domain	980	X
15450	ThrA3-DKP-insulin	310	X
15451	GABPa OST domain	1123	X
15452	Backbone and sidechain 1H, 15N and 13C assignments of the human G-actin binding protein profilin II	1500	X
15453	FBP28WW2 domain in complex with the PPLIPPPP peptide	281	X
15454	allo-ThrA3 DKP-insulin	303	X
15455	AbaA3-DKP-insulin	301	X
15456	NMR Solution Structure of homodimer protein SO_2176 from Shewanella oneidensis. Northeast Structural Genomics Consortium Target SoR77.	987	X
15457	NMR Structure of the Talin Rod domain, 1655-1822	2034	X
15458	NMR Structure of the F0 domain (residues 1-85) of the Talin FERM domain	1048	X
15459	TolR	915	X
15460	High resolution structure of AK12 in the presence of Lipopolysaccharide (LPS)	64	X
15461	NMR resonance assignment of the Ccc2ab protein	620	X
15462	Solution NMR Structure of HI0947 from Haemophilus influenzae, Northeast Structural Genomics Consortium Target IR123	963	X
15463	Spatial Structure and Hydrophobic Organization Determine Membrane Activity of Latarcins, Spider Antimicrobial Peptides	156	X
15464	NMR STRUCTURE OF HUMAN INSULIN MONOMER IN 35% CD3CN ZINC FREE, 50 STRUCTURES	339	X
15465	SOLUTION STRUCTURE OF THE N-TERMINAL DOMAIN OF PH1500	1004	X
15466	STRUCTURE CHARACTERISATION OF PINA WW DOMAIN AND COMPARISON WITH OTHER GROUP IV WW DOMAINS, PIN1 AND ESS1	524	X
15467	Backbone 1H, 15N, and 13C assignments for beta phosphoglucomutase in a complex with glucose-6-phosphate and AlF4-	825	X
15468	Solution NMR structure of protein NE1242 from N. europaea. Northeast Structural Genomics Target NeT4	890	X
15469	NMR assignment of the domain 513-651 from the SARS-CoV nonstructural protein nsp3	1725	X
15470	Resonance assignment of the Calmodulin-Munc13-1 peptide complex	1962	X
15471	NMR Structure of Peptidyl-tRNA hydrolase domain protein from Pseudomonas syringae pv. tomato:Northeast Structural Genomics Consortium Target PsR211	1324	X
15473	Backbone 1H, 13C, and 15N Chemical Shift Assignments for 8M Urea Denatured State of dSUMO-3(dSMT3)	761	X
15474	1H, 15N and 13C assignment and relaxation parameters of the denatured state of Azotobacter vinelandii apoflavodoxin	1716	X
15475	1H, 13C, and 15N chemical shift assignments of the C-terminal domain of the protein YuaF from Bacillus subtilis	990	X
15476	Solution NMR structure of the folded N-terminal fragment of UPF0291 protein ynzC from Bacillus subtilis. Northeast Structural Genomics target SR384-1-46.	629	X
15477	Solution structure of the extracellular domain of Prod1, a protein implicated in proximodistal identity during amphibian limb regeneration	830	X
15478	1H and 15N resonance assignment of M7, a computationally-designed artificial protein	839	X
15479	1H, 13C and 15N Resonance Assignment for the transmembrane and cytoplasmic domains of human CD4	926	X
15480	1H assignments of W60G mutant of human beta2-microglobulin	690	X
15481	15N and 1HN assignments of the EVH1 domain of human HOMER3A	228	X
15482	Solution NMR Structure of R. sphaeroides protein RSP_1027: Northeast Structural Genomics Consortium Target RhR95.	839	X
15483	SQAPI	1160	X
15485	Segmental isotope labeling of Npl3	823	X
15486	Complete Chemical Shift Assignments and XPLOR restraints for YmoA	884	X
15487	Segmental Isotope Labeling of Npl3p	813	X
15488	Backbone 1H, 15N, 13CO and 13CA resonance assignment of ABL kinase domain in complex with imatinib	1024	X
15489	Chemical shift assignments of paenibacillin -- a novel lantibiotic with N-terminal acetylation	341	X
15490	Solution Structure of E coli NusG carboxyterminal domain	708	X
15491	Solution NMR structure of uncharacterized protein Q5E7H1 from Vibrio fischeri. Northeast Structural Genomics target VfR117.	1124	X
15492	Backbone chemical shift assignment of a glutamate receptor ligand binding domain in complexes with five partial agonists	998	X
15493	Backbone chemical shift assignment of a glutamate receptor ligand binding domain in complexes with five partial agonists	1009	X
15494	Backbone chemical shift assignment of a glutamate receptor ligand binding domain in complexes with five partial agonists	1009	X
15495	Backbone chemical shift assignment of a glutamate receptor ligand binding domain in complexes with five partial agonists	1009	X
15496	Backbone chemical shift assignment of a glutamate receptor ligand binding domain in complexes with five partial agonists	1009	X
15497	Backbone 1H, 13C, and 15N Chemical Shift Assignments for MxiD in complex with MxiM	160	X
15498	Backbone and side-chain 1H, 13C and 15N resonance assignments for the E2 conjugating enzyme, UbcH7	1488	X
15499	Solution Structure of human NEMO zinc finger	178	X
15500	Solution Structure of the EDA-ID-related C417F mutant of human NEMO zinc finger	179	X
15501	Backbone assignment of human Proliferating Cell Nuclear Antigen.	1318	X
15502	Mapping intramolecular interactions between domains in HMGB1 using a tail-truncation approach	352	X
15503	Backbone 1H, 13C, and 15N Chemical Shift Assignments for MxiM(28-142)	426	X
15504	Structural characterization of the type III pilotin-secretin interaction in Shigella flexneri by NMR spectroscopy	1561	X
15505	CypB	866	X
15506	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the intrinsically disordered translocation domain of colicin N	406	X
15507	Chemical Shift Assignments for Legionella pneumophila Mip bound to rapamycin	1602	X
15508	Chemical shift values for the innermost lipoyl domain of E. coli PDH complex	361	X
15509	NMR Solution Structure of PARC CPH Domain. NESG Target HR3443B/SGC-Toronto	1116	X
15510	N-terminal SH3 domain of human Nckalpha	1680	X
15511	1H,13C and 15N chemical shift assignments for stereo-array isotope labelled (SAIL) C-terminal dimerization domain of SARS coronavirus nucleocapsid protein	1045	X
15512	1H, 13C, and 15N NMR chemical shift assignments of the palladin Ig3 domain	1268	X
15513	1H, 13C and 15N Resonance Assignemnt of HIV-1 VpU cytoplasmic domain	532	X
15514	Assignment of backbone 1H, 13C and 15N resonances of human IgG1 Fc (51.4 kDa)	963	X
15515	NMR STRUCTURAL STUDIES OF THE ANTIBIOTIC LIPOPEPTIDE DAPTOMYCIN IN DHPC MICELLES	62	X
15517	1H, 13C, and 15N Chemical Shift Assignments for ca-free rat alpha-parvalbumin	1272	X
15518	1H, 15N, 13CO, 13Calpha and 13Cbeta Chemical Shift Assignments of Human Peroxisome Proliferator-Activated Receptor Gamma Ligand-Binding Domain Bound to GW1929	1260	X
15519	Backbone chemical shift assigment of chicken osteopontin	800	X
15520	SOLUTION STRUCTURE OF ENGRAILED HOMEODOMAIN L16A MUTANT	675	X
15521	Backbone Dynamics from 15N NMR Relaxation Measurements of the Rat Thyroid Transcription Factor 1 Homeodomain	187	X
15522	Solution structure of pUL89(580-600) from Human Cytomegalovirus at pH 6.8.	300	X
15524	1H and 15N Resonance assignments for the human RLIP76 Ral binding domain	479	X
15525	1H, 13C and 15N Resonance assignments for the human RLIP76 Ral binding domain and RalB in complex	2961	X
15527	1H, 13C, and 31P Chemical Shift Assignments for 14-mer Base Pair Non-self Complementary DNA Duplex ( Mbp1_14) which Contains the Consensus Binding Site of the Yeast Transcription Factor Mbp-1	368		X
15528	Solution structure of the protease-resistent domain of Xenopus ePABP2	1299	X
15529	Back bone chemical shifts of B. subtillis protein YkuJ, Northeast Structural Genomics Consortium Target SR360.	277	X
15530	Solution structure of Mj0056	1657	X
15531	1H 13C and 15N chemical shift for human Granulocyte Macrophage Colony-Stimulating Factor	1150	X
15532	Structure of the Wilms Tumor Suppressor Protein Zinc Finger Domain Bound to DNA	220	X
15533	Structure of the Wilms' Tumor Suppressor Protein Zinc Finger Domain Bound to DNA	236	X	X
15534	Solution Structure of the UBA domain from c-Cbl	630	X
15535	Solution NMR structures of two designed proteins with 88% sequence identity but different fold and function	648	X
15536	Solution structure of Engrailed homeodomain WT	733	X
15537	Solution NMR structures of two designed proteins with 88% sequence identity but different fold and function	671	X
15538	Structure of a high affinity anti-NFkB RNA aptamer	480			X
15539	Backbone 1H, 13C, and 15N NMR assignments for the Cyanothece 51142 protein A1KYE3 - a protein in the DUF683 family associated with nitrogen fixation.	473	X
15540	1H, 15N, 13C Assignments of the C-terminal chromatin binding domain of the 43kDa subunit of chloroplast signal recognition particle	1249	X
15541	NMR study of the interaction of HscB with apo-IscU	1443	X
15542	SOLUTION NMR STRUCTURE OF UNCHARACTERIZED LIPOPROTEIN yajI FROM Escherichia coli: NORTHEAST STRUCTURAL GENOMICS TARGET ER540	1886	X
15543	Solution conformation of RNA-bound NELF-E RRM	825	X		X
15544	Solution structure of designed peptide YW12D in the presence of SDS micelle	84	X
15545	1H 13C and 15N chemical shift for the human FLN29	1315	X
15546	Chemical Shift Assignment of the Transmembrane Helices of DsbB by 3D Magic Angle Spinning NMR	258	X
15547	Solution structure of ubiquitin domain N-terminal to S27a ribosome subunit from Giardia lamblia	787	X
15548	Backbone assignment of stefin B monomer	465	X
15549	Solution Structure of Human C6orf115 Protein	1064	X
15550	Solution structure of hPCIF1 WW domain	575	X
15551	Backbone 1H and 15N Chemical Shift Assignments for Dok1 PTB domain	232	X
15552	Beta3 Integrin Cytoplasmic Tail 1H and 15N Chemical Shift Assignments	460	X
15553	1H, 13C and 15N resonance assignments from the Gal_lectin domain of mouse Latrophilin-1 GPCR	1281	X
15554	Structure and Chemical Shift Assignment for the Eps15EH2-Stonin2 complex	1609	X
15555	NMR structure of human Serine protease inhibitor Kazal type II (SPINK2)	345	X
15557	1H, 13C, and 15N Chemical Shift Assignment for actin depolymerizing and dynamics regulatory protein from Leishmania donovani	1598	X
15558	1H, 13C and 15N resonance assignments of C2 domain of milk fat globule-EGF-factor 8-L	1792	X
15559	NS4A(40-69)	332	X
15560	1H, 13C, and 15N NMR assignments of an engineered intein based on Mycobacterium tuberculosis RecA	1714	X
15561	NMR resonance assignments for Ca2+-bound DREAM	918	X
15562	Solution Structure of S. cerevisiae PDCD5-like Protein Ymr074cp	1287	X
15563	Backbone 1H, 13C and 15N chemical shift assignment of N-terminal end (1-85) of human SRC	437	X
15564	GFT NMR based resonance assignment of membrane proteins: application to subunit c of E. coli F1F0 ATP synthase in LPPG micelles	916	X
15565	Human Neuroglobin HelixF	404	X
15566	POLYMERASE LAMBDA BRCT DOMAIN	1005	X
15567	Structure of the second PDZ domain of NHERF-1	999	X
15568	Solution NMR Structure of uncharacterized Lipoprotein B from Nitrosomona europaea. Northeast Structural Genomics Target NeR45A.	1859	X
15569	SOLUTION STRUCTURE OF MSIN3A PAH1 DOMAIN	875	X
15570	SOLUTION STRUCTURE OF THE MSIN3A PAH1-SAP25 SID COMPLEX	1466	X
15571	NMR STRUCTURE OF RNA DUPLEX	323			X
15572	NMR STRUCTURE OF RNA DUPLEX CONTAINING SINGLE ADENOSINE BULGE	304			X
15573	SOLUTION STRUCTURE OF 50S RIBOSOMAL PROTEIN LX FROM Methanobacterium thermoautotrophicum, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET TR80	977	X
15574	NMR solution structure of KP-TerB, a tellurite resistance protein from Klebsiella pneumoniae	1898	X
15575	Solution Structure of the Tandem WW Domains of FBP21	803	X
15576	Ubiquitin-like domain of NFATC2IP. Northeast Structural Genomics Consortium Target hr5627.	895	X
15577	C Repressor	1198	X
15578	Evidence of reciprocical reorientation of the catalytic and hemopexin-like domains of full-length MMP-12	3693	X
15579	NS2(1-27)	270	X
15580	NS4A(1-21)	198	X
15581	N-terminal domain of Mason-Pfizer monkey virus capsid protein, CA 1-140	1594	X
15582	NS3(10-24)	148	X
15583	Solution structure of N-terminal Fowlicidin-1 in the presence of LPS	101	X
15584	NMR STRUCTURE OF PUTATIVE-tRNA HYDROLASE DOMAIN FROM SALMONELLA TYPHIMURIUM: NORTH EAST STRUCTURAL GENOMICS CONSORTIUM TARGET STR220	1702	X
15585	Solution structure of protein ATU1810 from Agrobacterium tumefaciens; Northeast Structural Genomics Target AtR23; Ontario Center for Structural Proteomics Target ATC1776	1185	X
15586	alpha-RgIA, a Novel Conotoxin that Blocks the nAChR	74	X
15587	1H, 13C and 15N resonance assignment of Urm1 from Trypanosoma.brucei	1112	X
15589	Backbone H, N and CA Chemical Shift Assignments for ApoMb(1-77) in Complex with DnaK Binding Domain	139	X
15590	Merozoite surface protein 2 in 10 mM HOAc	1256	X
15591	NMR structure of the ubiquitin associated (UBA) domain of p62 (SQSTM1). RDC refined	624	X
15592	NMR structure of the ubiquitin associated (UBA) domain of p62 (SQSTM1) in complex with ubiquitin. RDC refined	619	X
15593	Solution structure of human protein C6orf130, a putative macro domain	1866	X
15594	Rapid Measurement of Pseudocontact Shifts in Paramagnetic Proteins by GFT NMR Spectroscopy	254	X
15595	A novel solution NMR structure of protein yst0336 from Saccharomyces/Northest Structural Genomics Consortium Target YT51/Ontario Center for Structural Proteomics	1820	X
15596	NMR Solution structure of Human MIP-3alpha/CCL20	535	X
15597	glutathione peroxidase-type tryparedoxin peroxidase, oxidized form	1724	X
15598	glutathione peroxidase-type tryparedoxin peroxidase, reduced form	1675	X
15599	1H, 13C and 15N Assignments of Human Phosphohistidine Phosphatase 1 (PHPT1)	1172	X
15601	Chemical shift assignments for Atra-PBP1	1065	X
15602	1H, 13C and 15N chemical shift assignments of human PARP-1 domain C	1434	X
15603	SOLUTION NMR STRUCTURE OF LIPOPROTEIN SPR FROM ESCHERICHIA COLI K12. NORTHEAST STRUCTURAL GENOMICS TARGET ER541-37-162	1612	X
15604	Solution NMR structure of Ssl0352 protein from Synechocystis sp. - Northeast Structural Genomics Consortium target SgR42	780	X
15605	HIV-1 gp41 Membrane Proximal Ectodomain Region peptide in DPC micelle	288	X
15606	SOCS box elonginBC ternary complex	1582	X
15607	Putative 32 kDa myrosinase binding protein At3g16450.1 from Arabidopsis	2463	X
15608	NMR STRUCTURE OF PROTEIN VPA0419 FROM VIBRIO PARAHAEMOLYTICUS: NORTHEAST STRUCTURAL GENOMICS TARGET VPR68.	1090	X
15609	solution structure of 50S ribosomal protein L28 from Thermotoga maritima: Northeast Structural Genomics consortium target VR97	711	X
15610	Solution NMR Structure of BH09830 from Bartonella henselae Modeled with One Zn+2 Bound, Northeast Structural Genomics Consortium Target BnR55.	908	X
15611	Solution NMR structure of Nitrite reductase [NAD(P)H] small subunit from Erwinia carotovora, Northeast Structural Genomics Consortium target EwR120.	1505	X
15612	Extended Polypeptide Linkers Establish the Spatial Architecture of a Pyruvate Dehydrogenase	232	X
15613	SOLUTION STRUCTURE OF THE BIS-C2-2-NAPHTHYLPYRROLO[2,1-c][1,4]BENZODIAZEPINE (DA046) DNA ADDUCT: THE MOLECULAR BASIS FOR DNA HELIX STABILIZATION.	121		X
15614	Solution structure of the complex between E.coli NusA-AR2 and RNAP-aCTD	1886	X
15615	NMR Structure of the F0F1 double domain (residues 1-202) of the Talin FERM domain	2303	X
15616	NMR Structure of the F1 domain (residues 86-202) of the Talin FERM domain	1453	X
15617	Northeast Structural Genomics Consortium Target YG1 (Alg13), Chemical Shift Assignments	1611	X
15618	NMR ASSIGNMENT OF THE DOMAIN 527-651 OF THE SARS-COV NONSTRUCTURAL PROTEIN NSP3	1536	X
15620	Cam-HrTH-II	92	X
15621	Cam-HrTH-I	90	X
15622	Solution structure of an antilipopolysaccharide factor from shrimp	709	X
15623	1H, 13C, and 15N Chemical Shift Assignments for Ca2+-bound CaBP1	1585	X
15624	Structure of Calmodulin complexed with the Calmodulin Binding Domain of Calcineurin	2026	X
15625	NMR Structure of the VBS3 domain (residues 1815-1973) of Talin	1799	X
15626	backbone assignment of yeast (Saccharomyces cerevisiae) ARF1 ,non-myristoylated, GDP-bound	609	X
15627	1H, 13C and 15N resonance assignment of the C103S mutant of the N-terminal domain of DsbD from Neisseria meningitidis	1431	X
15628	Solution structure of S. aureus PrsA-PPIase	1379	X
15629	Conformation A configuration delta 7 and 8 and Conformation B Configuration lambda 4 of the Metal-Bound Pyoverdine PvdI, a siderophore of Pseudomonas aeruginosa	248	X
15632	Solution structure of C-terminal effector domain of putative two-component-system response regulator involved in copper resistance from Klebsiella pneumoniae	1159	X
15633	Structure of a locked SDF1 dimer	1619	X
15634	Solution Structure of Putative Ferrous Iron Transport Protein C (FeoC) of Klebsiella pneumoniae	917	X
15635	Structure of SDF1 in complex with the CXCR4 N-terminus containing a sulfotyrosine at postition 21	2478	X
15636	Structure of SDF1 in complex with the CXCR4 N-terminus containing no sulfotyrosines	2478	X
15637	Structure of SDF1 in complex with the CXCR4 N-terminus containing sulfotyrosines at postitions 7, 12 and 21	2481	X
15638	Backbone 1H, 15N and 13C assignment of Rv1567c, an integral membrane protein from Mycobacterium tuberculosis	332	X
15639	1H-NMR Chemical shifts and vicinal coupling constants (3JHNHa) for 17-residue peptide corresponding to the segment within ice nucleation protein of X. campestris pv. campestris	103	X
15640	1H-NMR Chemical shifts and vicinal coupling constants (3JHNHa) for 17-residue peptide corresponding to the segment within ice nucleation protein of X. campestris pv. campestris	102	X
15641	1H-NMR Chemical shifts and vicinal coupling constants (3JHNHa) for 24-residue peptide corresponding to the segment within ice nucleation protein of Erwinia uredovora, Erwinia herbicola	151	X
15642	Solution structure of the aminoterminal domain of E. coli NusG	1410	X
15643	Backbone chemical shift assignments for ketopantoate reductase (KPR) from E. coli	1321	X
15644	1H, 15N and 13C chemical shift assignments for Rds3 protein	1344	X
15645	NMR STRUCTURE OF A MUTANT COLICIN E7 IMMUNITY PROTEIN IM7 WITH AN EXTENDED HELIX III	1139	X
15646	NMR analysis of the closed conformation of syntaxin-1	1567	X
15647	1H chemical shift and NMR structure of Herpes simplex virus type 1 (HSV-1)fusion peptide gH626-644	140	X
15648	1H chemical shift and NMR structure of Herpes simplex virus type 1 (HSV-1)fusion peptide R642S gH626-644	135	X
15649	1H chemical shift and NMR structure of Herpes simplex virus type 1 (HSV-1)fusion peptide L627S gH626-644 mutation L(627)S	130	X
15650	Solution structure of CaM complexed to DRP1p	709	X
15651	NMR structure of the transmembrane domain of the Outer Membrane Protein A from Klebsiella pneumoniae in DHPC micelles.	1202	X
15652	Solution NMR structure of the uncharacterized protein from Rhodospirillum rubrum gene locus Rru_A0810. Northeast Structural Genomics Target RrR43.	1202	X
15653	Backbone 1H, 13C, and 15N NMR Assignments of the Tail Domain of Vinculin	796	X
15654	NMR Chemical Shift Assignments of Insulin-like Growth Factor-I (IGF-I)	513	X
15655	Solution structure of CopK, a periplasmic protein involved in copper resistance in Cupriavidus metallidurans CH34	897	X
15656	Apical Stem Loop Duck HBV	554			X
15658	The actinorhodin holo acyl carrier protein from S. coelicolor	1031	X
15659	The actinorhodin apo acyl carrier protein from S. coelicolor	1031	X
15660	NMR assignment of the arenaviral protein Z from Lassa fever virus	951	X
15661	Solution NMR Structure of protein hp1203 from Helicobacter pylori 26695	1393	X
15662	1H, 13C, and 15N resonance assignments of murine amelogenin, an essential enamel biomineralization protein.	1470	X
15663	Almost Complete Chemical Shift Assignments for a new calcium binding protein, EhCaM	1386	X
15664	1H, 13C, and 15N chemical shift assignments of the C-terminal domain of the protein YqiJ from Escherichia coli	1170	X
15665	CONFIRMATIONAL ANALYSIS OF THE BROAD-SPECTRUM ANTIBACTERIAL PEPTIDE, RANTUERIN-2CSA: IDENTIFICATION OF A FULL LENGTH HELIX-TURN-HELIX MOTIF	215	X
15666	Mutant Collision E7 protein IM7 with an extended helix III in M Urea	351	X
15667	Solution structure of Fowlicidin-1 (LK19) in the presence of LPS	124	X
15669	Sequence-specific 1H, 13C and 15N resonance assignments of the GRP1 PH domain	1481	X
15670	Solution structure of the free TAF3 PHD domain	816	X
15671	Solution structure of the TAF3 PHD domain in complex with a H3K4me3 peptide	889	X
15672	MMLV p12-CA(NTD)	472	X
15673	NMR solution structure of PisI	1122	X
15674	Solution NMR structure of the chromobox protein homolog 7	709	X
15676	NMR Studies of a Pathogenic Mutant (D178N) of the Human Prion Protein	1053	X
15677	Solubilization of transmembrane proteins in water: structural studies of a water-soluble analogue of the potassium channel KcsA	1268	X
15678	Chemical Shift assignment of SeR13 from Staphylococcus Epidermidis, North East Structural Genomics Consortium Target SeR13	924	X
15679	3D NMR structure of domain cC0 of cardiac myosin bonding protein C (MyBP-C)	967	X
15680	Sequence-specific 1H, 13C and 15N backbone resonance assignments of the 34kDa catalytic domain of human PTPN7	1256	X
15681	CPAP PN2-3 module	1353	X
15682	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Epidermal Growth Factor-like 2 domain from Microneme Protein 6 (Toxoplasma gondii)	604	X
15683	Solution NMR Structure of the folded C-terminal fragment of YiaD from Escherichia coli, Northeast Structural Genomics Consortium Target ER553.	1755	X
15684	rat lipocalin 2	1990	X
15685	Backbone and side chain 1H, 13C, and 15N Chemical Shift Assignments for the complex of Epidermal Growth Factor-like 2 domain from Microneme Protein 6 (Toxoplasma gondii) with the Galectin-like domain of Microneme protein 1	2113	X
15687	Automated NMR Structure of the TA0895 by FAPSY	886	X
15688	Automated NMR Structure of the TA0956 by FAPSY	1110	X
15689	Automated NMR Structure of the UBB by FAPSY	1001	X
15690	The solution structure of the complex between MNK1 and HAH1 mediated by Cu(I)	1608	X
15691	Structure of the DBD domain of E. coli antitoxin RelB	414	X
15692	Backbone assignment of MIC1-CT from Toxoplasma gondii in complex with EGF3 from TgMIC6	866	X
15693	Solution structure of Human Pax8 Paired Box Domain	1612	X
15694	Apple Domains 1 and 2 from Toxoplasma gondii microneme protein 4	1806	X
15695	Solution NMR structure of the chromobox protein homolog 4	747	X
15697	Mutational and Structural Analysis of Stem-loop IIId of the Hepatitis C Virus and GB Virus B Internal Ribosome Entry Sites	179			X
15698	Solution Structure of the Apo C terminal domain of Lethocerus troponin C isoform F1	716	X
15700	solution struture of human N-terminal domain of pirh2/Northeast Structure Genomics Consortium (NESG) target HT2A	1484	X
15701	solution struture of human C-terminal domain of pirh2/Northeast Structural Genomics Consortium (NESG) target HT2C	877	X
15702	Solution NMR Structure of Bordatella pertussis protein BP2786, a Mth938-like domain: Northeast Structural Genomics Consortium target BeR31	1503	X
15703	Soluble form of human earliest activation antigen of leukocytes CD69	409	X
15704	Ca2+-S100A1-RyRP12	98	X
15705	Pseudo Contact shifts and RDCs of Galectin-3 with C-terminal LBT tagged at a proton frequency of 600MHz.	34	X
15706	Backbone Chemical Shift Assignments for DPF inhibited Mature Subtilisin E	1280	X
15707	NMR solution structure of the split PH domain from Phospholipase C gamma 2	1474	X
15708	Structure of the N-terminal domain of the Y4 receptor in SDS and DPC micelles	537	X
15710	Structural Basis of PxxDY Motif Recognition in SH3 Binding	749	X
15711	Backbone chemical shift assignements for monomeric apoSOD1	742	X
15712	Backbone chemical shift assignements for monomeric apoSOD1 - variant A4V	665	X
15713	Backbone chemical shift assignements for monomeric apoSOD1 - variant G85R	646	X
15714	Backbone chemical shift assignements for monomeric apoSOD1 - variant D90A	446	X
15715	NMR Assignments of Methionine Sulfoxide Reductase B2 from Homo sapiens	1460	X
15716	1H, 15N, 13C resonance assignment of the AlgE6R1 subunit from the Azotobacter vinelandii Mannuronan C5-epimerase	1595	X
15717	SOLUTION STRUCTURE OF A CYANOBACTERIAL PHYTOCHROME GAF DOMAIN IN THE RED LIGHT-ABSORBING GROUND STATE	1490	X
15718	Solution Structure of the inner DysF domain of human myoferlin	1497	X
15719	Assignment of the central region (131-28) of human h1 calponin	815	X
15720	Solution structure of Arabidopsis thaliana protein At1g70830, a member of the major latex protein family	1868	X
15721	Solution structure of protein ATU1203 from AGROBACTERIUM TUMEFACIENS. NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) target ATT10, Ontario Center for Structural Proteomics target ATC1183	639	X
15722	1H, 13C and 15N Resonance Assignments of Ca2+ bound collagen-binding domain derived from a clostridial collagenase	1118	X
15723	NMR assignment of the nonstructural protein nsp3(1066-1181) from SARS-CoV	1450	X
15726	Backbone 1H, 13C, and 15N Chemical Shift Assignments for La NTD	974	X
15727	Full 1H, 13C, and 15N Chemical Shift Assignments for La NTD complexed with 5'UUUU RNA	2066	X		X
15728	NMR structures of dimeric transmembrane domain of the receptor tyrosine kinase EphA1 in lipid bicelles at pH 4.3	463	X
15729	Solution Structure of Tick Carboxypeptidase Inhibitor at pH 3.5	410	X
15730	Solution structure of the folded domain of intermediate IIIa of Tick Carboxypeptidase Inhibitor	220	X
15731	Solution structure of the folded domain of intermediate IIIb of Tick Carboxypeptidase Inhibitor	226	X
15732	1H, 13C, and 15N backbone resonance assignments of the bright domain of the histone demethylase JARID 1B	906	X
15733	Solution structure of Lamin B Receptor Tudor domain	751	X
15734	Solution Structure of cGMP-binding GAF domain of Phosphodiesterase 5	1765	X
15735	truncated AcrA from Campylobacter jejuni for glycosylation studies	1201	X
15736	Full length human frataxin	1400	X
15737	Solution structure of an N-glycosylated protein using in vitro glycosylation	1332	X			X
15738	Carbon storage regulator from Helicobacter pylori	449	X
15739	Hydramacin-1: Structure and antibacterial activity of a peptide from the basal metazoan Hydra	574	X
15740	Structure ensemble Backbone and side-chain 1H, 13C, and 15N Chemical Shift Assignments, 1H-15N RDCs and 1H-1H nOe restraints for protein K7 from the Vaccinia virus	1698	X
15741	1H, 15N and 13C resonance assignment of imidazole glycerol phosphate (IGP) synthase protein HisF from Thermotoga maritima	1198	X
15742	CsmA	433	X
15743	Sequence specific 1H, 13C and 15N resonance assignment of Hahellin from Hahella chejuensis, a putative member of the bg-crystallin superfamily	991	X
15744	Backbone assignment of lipid-free human apolipoprotein E (apoE)	1155	X
15745	Solution structure of stem-loop alpha; of the hepatitis B virus post-transcriptional regulatory element	390			X
15746	Bpp3783_115-220	1019	X
15747	Structural and Functional Characterization of TM IX of the NHE1 Isoform of the Na+/H+ Exchanger	332	X
15748	D,L-Peptide Foldamers: A Beta-Hairpin/Beta-Helical Structure in Methanol	162	X
15749	D,L-Peptide Foldamers: A Curved Structure in PBS	168	X
15750	Solution NMR structure of the folded 79 residue fragment of Lin0334 fromListeria innocua. Northeast Structural Genomics Consortium target LkR15.	1061	X
15751	SYNTHESIS, STRUCTURE AND ACTIVITIES OF AN ORAL MUCOSAL ALPHA-DEFENSIN FROM RHESUS MACAQUE	188	X
15752	Structure of a Glycosylphosphatidylinositol-anchored Domain from a Trypanosome Variant Surface Glycoprotein	276	X
15753	Structure of a Glycosylphosphatidylinositol-anchored Domain from a Trypanosome Variant Surface Glycoprotein	298	X
15755	NMR Solution structure of the C-terminal domain (T94-Y172) of the human centrin 2 in complex with a repeat sequence of human Sfi1 (R641-T660)	659	X
15756	1H, 13C and 15N backbone chemical shift assignments of the 2FNI-3FNI module pair from human fibronectin	336	X
15757	1H, 13C and 15N assignment for eosinophil cationic protein	1649	X
15758	1H, 13C and 15N backbone chemical shift assignments of the 4FNI-5FNI module pair from human fibronectin	369	X
15759	1H, 13C and 15N backbone chemical shift assignments of the 3FNIII module from human fibronectin	338	X
15760	Solution structure of a cytoskeletal protein complex	1685	X
15761	Chemical shift assignments for JHP0511 (HP0564) from Helicobacter pylori.	660	X
15762	NMR Structure of Protein yiiS from Shigella flexneri: Northeast Structural Genomics Consortium Target SfR90	1205	X
15763	The solution structure of human Mia40	699	X
15764	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Ca2+-Binding Domain 1 of the Na+/Ca2+ Exchanger in the Absence of Ca2+	610	X
15765	Solution Structure of a Tetrahaem Cytochrome from Shewanella Frigidimarina	474	X
15766	human calpastatin Domain 1	627	X
15767	Backbone Resonance Assignments of the N-terminal half of hepatitis core protein	253	X
15768	Backbone Resonance Assignments of the N-terminal half of hepatitis core protein	253	X
15769	1H,13C, and 15N resonance assignment of the ubiquitin like domain (UBL) of Dsk2p.	1028	X
15770	1H, 13C and 15N chemical shifts for the Myxococcus xanthus CarS1 antirepressor protein	1657	X
15773	Analysis of Site-specific Histidine Protonation in Human Prolactin	134	X
15774	Rv1761c	571	X
15775	Backbone chemical shift assignment for the transmembrane and C-terminal domains of amyloid precursor protein (APP C99)	482	X
15776	Pfu Rpp21 structure and assignments	1003	X
15777	Solution Structure of IG-Like Domain 23 from Human Filamin A	1093	X
15778	Structure of the tyrosine-O-sulfated C5a receptor N-terminus in complex with the immune evasive protein CHIPS.	1348	X
15779	Backbone 1H, 13C and 15N assignments for ginkbilobin-2 with C-terminal His6-tag	645	X
15780	NMR structure of adenosine bulged RNA duplex with C:G-A triple	131			X
15781	NMR structure of uridine bulged RNA duplex	273			X
15782	1H, 13C and 15N chemical shifts of the sylvatic Dengue 1 Envelope Protein Domain III, strain P72-1244	1290	X
15783	acidic fibroblast growth factor solution structure in the FGF-1-C2A binary complex: key component in the fibroblast growthfactor non-classical pathway	1190	X
15784	1H, 13C, and 15N Chemical Shift Assignments for NikA(1-51)	568	X
15785	C2A domain of synaptototagmin I solution structure in the FGF-1-C2A binary complex: key component in the fibroblast growthfactor non-classical pathway	1535	X
15786	1H,13C and 15N NMR assignments of duck HBV primer loop of the epsilon encapsidation signal	522			X
15787	1H and 15N chemical shift assignments for HINT1 protein	579	X
15788	X-ray crystallographic and Solution State NMR Spectroscopic Investigations of NADP+ Binding to Ferredoxin-NADP Reductase (FPR) from Pseudomonas aeruginosa	1128	X
15789	Chemical shift assignments for human MCFD2	1985	X
15790	NMR STRUCTURE OF THE N-TERMINAL COILED COIL DOMAIN OF THE ANDES HANTAVIRUS NUCLEOCAPSID PROTEIN	1182	X
15791	Solution NMR Structure of UPF0339 Protein SO3888 from Shewanella Oneidensis. Northeast Structural Genomics Consortium Target SoR190	1353	X
15792	talin-F2F3	346	X
15793	CopR Repressor Structure	689	X
15795	NMR structure of the c-terminal domain of a multiprotein bridging factor 1 (MBF1) of Trichoderma reesei	1111	X
15796	E2-c-Cbl recognition is necessary but not sufficient for ubiquitination activity	1086	X
15797	Solution structure of Tpx in the reduced state	1883	X
15798	Solution structure of Tpx in the oxidized state	1895	X
15799	HIV-1 Gag p6 C-terminal	146	X
15800	Backbone and side-chain 1H, 13C, and 15N Chemical Shift Assignments for Human Galectin-1	1334	X
15801	ArsR DNA Binding Domain	1092	X
15802	1H, 13C, and 15N resonance assignments of a RNA binding protein GSP13 from Bacillus subtilis	1542	X
15803	RalB in complex with its effector RLIP76	2232	X
15804	Solution NMR Structure of M. thermoautotrophicum protein MTH_1000, Northeast Structural Genomics Consortium Target TR8	1738	X
15805	NMR structure of protein PF0246 from Pyrococcus furiosus: target PfR75 from the Northeast Structural Genomics Consortium	1180	X
15806	1H and 15N Chemical Shift Assignments and Experimental NMR Restraints for the Neurotrypsin Kringle Domain	557	X
15807	The Solution Structure of gpV, the Major Tail Protein from Bacteriophage Lambda	1602	X
15808	Assignment of the 1H, 13C and 15N resonance of the Calponin Homology-2 domain of alpha-actinin-4	1306	X
15809	myristoylated yeast ARF1, GDP bound	1190	X
15810	Solution structure of uncharacterized protein PA1076 from Pseudomonas aeruginosa. Northeast Structural Genomics Consortium (NESG) target PaT3, Ontario Center for Structural Proteomics target PA1076.	1399	X
15811	Solution structure of 30S ribosomal protein S27A from Thermoplasma acidophilum	628	X
15812	NMR Structure of FeoA-like protein from Clostridium acetobutylicum: Northeast Structural Genomics Consortium Target CaR178	1065	X
15813	1H, 13C and 15N resonance assignments of the ribosome binding domain of E. coli Trigger Factor	1365	X
15814	1H, 13C and 15N resonance assignments of the domain 5 of ABP-120 from Dictyostelium in native and 8M urea-denatured states.	1699	X
15816	Solution NMR Structure of Allochromatium vinosum DsrR: Northeast Structural Genomics Consortium Target OP5	1218	X
15817	Type III antifreeze protein isoform HPLC-12	691	X
15818	Type III antifreeze protein isoform HPLC-12	219	X
15819	Solution NMR Structure of the replication Factor A Related Protein from Methanobacterium thermoautotrophicum. Northeast Structural Genomics Target TR91A.	1339	X
15820	RRM1 of hnRNPLL	484	X
15821	Structure of uncharacterized protein MJ1198 from Methanocaldococcus jannaschii. Northeast Structural Genomics Target MjR117B	987	X
15822	NMR solution structure of A3DK08 protein from Clostridium thermocellum: Northeast Structural Genomics Consortium Target CmR9	881	X
15823	Solution NMR structure of protein Atu0742 from Agrobacterium Tumefaciens. Northeast Structural Genomics Consortium (NESG0) target AtT8. Ontario Center for Structural Proteomics target ATC0727.	1487	X
15824	Bank Vole Prion Protein (121-231)	913	X
15825	Solution NMR Structure of Putative Lipoprotein from Pseudomonas syringae Gene Locus PSPTO2350. Northeast Structural Genomics Target PsR76A.	695	X
15826	1H, 13C and 15N assignment of the Yellow Fluorescent Protein (YFP) Venus	1668	X
15827	Solution structure of antimicrobial peptide MSI-594, derived from Magainin-2 and Malittin, in the presence of LPS.	150	X
15828	NMR Structure for PF0385	799	X
15829	SOLUTION NMR STRUCTURE OF SAG0934 from Streptococcus agalactiae. NORTHEAST STRUCTURAL GENOMICS TARGET SaR32[1-108].	1411	X
15830	chemical shift assignments and heteronuclear NOE of the N-terminal domain of the human Y1-receptor	285	X
15831	chemical shift assignments and heteronuclear NOE of the N-terminal domain of the human Y2-receptor	86	X
15832	chemical shift assignments and heteronuclear NOE of the N-terminal domain of the human Y5-receptor	96	X
15833	NMR CHEMICAL SHIFT ASSIGNMENTS OF PUTATIVE UNCHARACTERIZED PROTEIN. FROM METHANOCALDOCOCCUS JANNASCHII, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET GsR195	743	X
15834	Solution NMR structure of FeoA protein from Chlorobium tepidum. Northeast Structural Genomics Consortium target CtR121	1202	X
15835	Solution NMR structure of protein encoded by gene BPP1335 from Bordetella parapertussis: Northeast Structural Genomics Target BpR195	2137	X
15836	Solution NMR structure of protein encoded by MTH693 from Methanobacterium thermoautotrophicum: Northeast Structural Genomics Consortium target tt824a	1085	X
15837	NMR CHEMICAL SHIFT ASSIGNMENTS OF IRON(II) TRANSPORT PROTEIN A FROM CLOSTRIDIUM THERMOCELLUM , NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET VR131	1879	X
15839	Solution structure of protein yiiF from Shigella flexneri serotype 5b (strain 8401) . Northeast Structural Genomics Consortium target sft1	904	X
15840	Chemical Shift assignment of RhR2 from Rodobacter Sphaeroides, North east Structural Genomics Consortium Target SeR13	576	X
15841	Solution NMR Structure of Protein FeoA from Clostridium thermocellum, Northeast Structural Genomics Consortium Target CmR17	1040	X
15843	Solution NMR Structure of the N-Terminal Domain of Protein ECA1580 from Erwinia carotovora, Northeast Structural Genomics Consortium Target EwR156A	854	X
15844	NMR Solution Structure of a Thiamine Biosynthesis Protein from Geobacter Metallireducens: Northeast Structural Genomics Consortium Target GmR137	886	X
15845	Mouse Prion Protein (121-231) with Mutation S170N	898	X
15846	NMR solution Structure of Membrane associated protein from Bacillus cereus: Northeast Structural Genomics Consortium Target: BcR97A	1295	X
15847	Solution NMR Structure of XF2673 from Xylella fastidiosa. Northeast Structural Genomics Consortium Target XfR39	1138	X
15848	Solution NMR Structure of Putative N-Acetyl Transferase YhhK from E. coli Bound to Coenzyme A: Northeast Structural Genomics Consortium Target ET106	1313	X
15849	SOLUTION NMR STRUCTURE OF the second OB-fold domain of replication protein A from Methanococcus maripaludis. NORTHEAST STRUCTURAL GENOMICS TARGET MrR110B.	1263	X
15850	Solution NMR Structure of Putative Lipoprotein from Bacillus cereus Ordered Locus BC_2438. Northeast Structural Genomics Target BcR103A.	1211	X
15851	NMR structure of calcium-loaded STIM1 EF-SAM	1672	X
15852	Solution structure of CaM complexed to DAPk peptide	704	X
15853	Local and global structure of the monomeric subunit of the potassium channel KcsA probed by NMR	1647	X
15854	NMR solution structure of the supramolecular adduct between a liver cytosolic bile acid binding protein and a bile acid-based Gd(III)-chelate	1465	X
15855	NMR assignment of human Growth Arrest and DNA Damage alpha protein (Gadd45a)	1770	X
15856	NMR solution structure of the d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5(gamma)	308			X
15857	NMR solution structure of the d3'-hairpin including EBS1 together with IBS1 of the group II intron Sc.ai5(gamma)	396			X
15858	NMR solution structure of the exon/intron binding site 1 (EBS1/IBS1) of the group II intron Sc.ai5(gamma)	153			X
15859	NMR solution structure of the d3'-stem closed by a GAAA tetraloop of the group II intron Sc.ai5(gamma)	252			X
15860	NMR solution structure of modified DNA containing imidazole nucleosides at acidic, neutral and basic pH	502		X
15863	Solution structure of EAS D15 truncation mutant	489	X
15864	Solution structure of 1-112 fragment of human programmed cell death 5 protein	1352	X
15865	Detailed Structural Characterization of Unbound Protein Phosphatase 1 Inhibitors	550	X
15866	CIN85 Sh3-C domain in complex with ubiquitin	230	X
15867	1H, 13C and 15N resonance assignment of 9.7 M urea-denatured GED of dynamin	1008	X
15868	1H, 13C and 15N resonance assignment of guanidine-denatured GED of dynamin	1080	X
15869	NMR Assignments of HIV-2 TAR RNA	618			X
15870	The domain features of the peripheral stalk subunit H of the methanogenic A1AO ATP synthase and the NMR solution structure of H1-47	549	X
15871	Solution Structure of XACb0070 from Xanthonomas axonopodis pv citri	883	X
15873	Solution Structure of Human Supervillin Headpiece	677	X
15874	Solution Structure of Human Supervillin Headpiece, Minimized Average	677	X
15875	Backbone Chemical Shift Assignments and Relaxation Data for S. pombe Aps1d2-19	821	X
15876	Human LL-37 Structure	179	X
15877	LC3 p62 complex structure	1776	X
15878	Yersinia pseudotuberculosis type III secretion effector YopE.	604	X
15879	Protein folding on a highly rugged landscape: Experimental observation of glassy dynamics and structural frustration	239	X
15880	Structure of Rab11-FIP2 C-terminal Coiled-coil Domain	401	X
15881	NMR assignment of Prespore Specific Antigen - a cell surface adhesion glycoprotein from Dictyostelium discoideum	1318	X
15882	1H, 15N, 13C backbone assignment of the SPF45 UHM domain	388	X
15883	Backbone and 13C and 1H assignments for acid unfolded state and urea unfolded state of CTL9	645	X
15884	Backbone 1H, 13C, and 15N Chemical Shift Assignments for CTL9 native state at pH 3.8	609	X
15885	Backbone assignment of the UHM domain of Puf60 in the free form	395	X
15887	1H, 15N chemical shifts of the UHM domain of Puf60 in complex with U2AF65(85-112)	168	X
15888	1H, 15N chemical shifts of the UHM domain of Puf60 in complex with SF1(1-25)	184	X
15889	1H, 15N chemical shifts of the UHM domain of Puf60 in complex with SF3b155(194-229)	186	X
15890	1H, 15N chemical shifts of the UHM domain of Puf60 in complex with SF3b155(317-357)	188	X
15891	1H, 15N chemical shifts of the UHM domain of Puf60 in complex with Prp16(201-238)	194	X
15892	Backbone 1HN and 15N Assignments for Native Human alpha-Lactalbumin	230	X
15893	Mechanism of metal delivery to the CuA center in terminal oxidases from bacteria: a redox m nage- -trois	2041	X
15894	Mechanism of metal delivery to the CuA center in terminal oxidases from bacteria: a redox m nage- -trois	1436	X
15895	Solution structures of apo form PCuA (cis conformation of the peptide bond involving the nitrogen of P14)	1424	X
15896	Solution structures of copper loaded form PCuA (trans conformation of the peptide bond involving the nitrogen of P14)	1456	X
15897	Solution structures of copper loaded form PCuA (cis conformation of the peptide bond involving the nitrogen of P14)	1456	X
15898	H1, C13, 31P chemical shifts of dGCGAAAGC	121		X
15899	1H, 13C and 15N backbone chemical shift assignments of the C-terminal CH domain of human alpha-parvin	471	X
15900	MMP23, a metalloprotease with a toxin-like potassium channel blocking domain and immunomodulatory role with relevance in prostate cancer	270	X
15901	Backbone 1H, 13C, and 15N Chemical Shift Assignments for D+PHS, a hyperstable variant of SNase, at pH 4.66	554	X
15902	Solution NMR structure of the OB domain of Ta0387 from Thermoplasma acidophilum. Northeast Structural Genomics Consortium target TaR80b.	1317	X
15903	1H, 15N and 13C backbone and side chain resonance assignment of Rv0008c, an integral membrane protein from Mycobacterium tuberculosis	1095	X
15911	NMR backbone assignments of the periplasmic loop P2 of the MalF subunit of the maltose ATP binding cassette transporter	643	X
15912	Solution Structure of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase	3936	X
15913	Solution Structure of the IsdC NEAT domain bound to Zinc Protoporphyrin	1339	X
15914	Backbone 1H, 13C and 15N Chemical Shift Assignments for Binder of Arl2 (BART)	1615	X
15915	NMR structure of the human tRNALys3 bound to the HIV genome Loop I	252			X
15916	Solution NMR structure of protein ATU0232 from AGROBACTERIUM TUMEFACIENS. Northeast Structural Genomics Consortium (NESG) target AtT3. Ontario Center for Structural Proteomics target ATC0223.	664	X
15917	TEM-1 BETA-LACTAMASE VARIANT ALLOSTERICALLY REGULATED BY KANAMYCIN	1709	X
15918	Backbone 1H, 13C, and 15N Chemical Shift Assignments for M-crystallin (calcium bound form) in presence of 4 M Gdn-Hcl	368	X
15919	NMR structure of a complex formed by the C-terminal domain of human RAP74 and a phosphorylated peptide from the central domain of the FCP1	1019	X
15921	1H, 13C and 15N assignment of a double transmembrane domain from human Y4 receptor, a G-protein coupled receptor	531	X
15922	Solution structure of the PPIL1 bound to a fragment of SKIP	1881	X
15924	Filamin A Ig-like domains 16-17	2036	X
15925	Filamin A Ig-like domains 18-19	2232	X
15926	N-terminal domain of the Bacillus subtilis helicase-loading protein DnaI	885	X
15927	1H, 13C, 15N NMR resonance assignments of the actinoporin Sticholysin I	1942	X
15928	Human ARNT C-Terminal PAS Domain, 3 Residue IB slip	1386	X
15930	Sequence-specific 1H, 15N, and 13C resonance assignments and relaxation parameters for the whole region 4 of Escherichia coli RNA polymerase sigma70 subunit in 10% TFE	726	X
15931	Deletions in a surface loop divert the folding of a protein domain into a metastable dimeric form	567	X
15932	Solution Structure of the Catalytic Domain of Procaspase-8	2477	X
15933	NOGO66 in DPC.	699	X
15934	Backbone 1H, 13C, and 15N Chemical Shift Assignments for M-crystallin (calcium bound form) in presence of 6 M Gdn-Hcl	160	X
15935	Pfu RPP29d17-RPP21V14 complex	2326	X
15936	Sequence-specific 1H, 15N, resonance assignments of nine 1H-{15N} HSQC spectras for the whole region 4 of Escherichia coli RNA polymerase sigma70 subunit recorded at TFE concentrations increasing in the range of 0-30%	2000	X
15937	Solution structure of the equine infectious anemia virus p9 gag protein	242	X
15938	p190-A RhoGAP FF1 domain	787	X
15939	Solution Structure of FOXO3a Forkhead domain	1060	X
15940	Association of subunit d (Vma6p) and E (Vma4p) with G (Vma10p) and the NMR solution structure of subunit G (G1-59) of the Saccharomyces cerevisiae V1VO ATPase	682	X
15941	Solution structure of a zinc-binding methionine sulfoxide reductase	1594	X
15942	1H, 13C and 15N assignments for rrm2 domain of PABP1	1085	X
15943	Solution NMR Structure of protein of unknown function yegP from E. coli. Ontario Center for Structural Proteomics target EC0640_1_123 Northeast Structural Genomics Consortium Target ET102.	1270	X
15944	Structural Basis for the Regulation of p53 Function by p300	1368	X
15945	MDM2 N-terminal domain	497	X
15946	Solution structure of a paralog-specific Mena binder by NMR	206	X
15948	1H, 13C, and 15N Chemical Shift Assignments for the RING finger of the E3 ubiquitin ligase Arkadia (RNF111)	828	X
15949	1H, 15N, 13C Resonance Assignments of the Reduced and Active Form of Human Protein Tyrosine Phosphatase, PRL-1	928	X
15950	solution structure of E.Coli SlyD	1948	X
15951	HCV p7 tm2	310	X
15952	S100A13-C2A	1532	X
15953	H55K mutant of LC8 at pH 6.7 from Drosophila Melanogaster	347	X
15954	human eIF5A	1606	X
15955	Green Proteorhodopsin	740	X
15956	NMR structure analysis of a BMP receptor	1106	X
15957	Solution structure of the HIV-1 p6 C-terminal domain	146	X
15958	NMR Structure of Shq1p N-terminal domain	1457	X
15959	Backbone 1H and 15N Chemical Shift Assignments for the Phosphotyrosine Binding Domain of Insulin Receptor Substrate 1 in the Apo and Phosphopeptide Bound Forms	214	X
15960	Solution structure of human acidic fibroblast growth factor in complex with anti-angiogenic drug inositol hexaphosphate (IP6)	1163	X
15961	Backbone and Side chain 1H, 13C, and 15N Chemical Shift Assignments for Microneme protein 2 Associated protein	2049	X
15962	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the heme bound form of Truncated HasAp.	853	X
15963	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the heme bound form of Full-Length HasAp.	954	X
15964	Solution structure of Oxidised ERp18	1760	X
15965	Structural Transitions of the N Terminus of a Short Non-Muscle Tropomyosin upon Binding to the C Terminus in Solution	437	X
15966	Solution NMR structure of integral membrane protein DsbB	839	X
15967	Structural characterization of IscU and its interaction with HscB	154	X
15968	Backbone chemical shift assignments for the UBA domain of Swa2p	185	X
15969	Heteronuclear NMR assignments for the dimeric human hepatitis B virus core protein under capsid dissociating conditions	524	X
15970	SOLUTION STRUCTURE OF THE LSM DOMAIN OF DROSOPHILA MELANOGASTER TRAL (TRAILER HITCH)	938	X
15971	SOLUTION STRUCTURE OF THE LSM DOMAIN OF DROSOPHILA MELANOGASTER TRAL (TRAILER HITCH)	1007	X
15972	1H, 13C and 15N resonance assignments of the PDZ of MAST205 in complex with the C-terminal tail from the rabies virus glycoprotein	1140	X
15973	HGF-binding peptide-10	164	X
15974	Chemical shifts of the b-b'-x region of human protein disulfide isomerase	623	X
15975	Sequence-specific 1H, 15N, and 13C resonance assignments and relaxation parameters for the whole region 4 of Escherichia coli RNA polymerase sigma70 subunit in 30% TFE	1196	X
15977	Backbone and side chain 1H, 13C and 15N chemical shifts for the C-terminal domain of CdnL from Myxococcus xanthus	1452	X
15978	Lipopolysaccharide Bound Structures of the Active Fragments of Fowlicidin-1, a Cathelicidin Family of Antimicrobial and Antiendotoxic Peptide from Chicken, Determined by Transferred Nuclear Overhauser Effect Spectroscopy	101	X
15979	Lipopolysaccharide Bound Structures of the Active Fragments of Fowlicidin-1, a Cathelicidin Family of Antimicrobial and Antiendotoxic Peptide from Chicken, Determined by Transferred Nuclear Overhauser Effect Spectroscopy	124	X
15980	Lipopolysaccharide Bound Structures of the Active Fragments of Fowlicidin-1, a Cathelicidin Family of Antimicrobial and Antiendotoxic Peptide from Chicken, Determined by Transferred Nuclear Overhauser Effect Spectroscopy	64	X
15981	Solution NMR Structure of Cgi121 from Methanococcus jannaschii. Northeast Structural Genomics Consortium Target MJ0187	1970	X
15983	NMR SOLUTION STRUCTURE FOR ShK-192: A POTENT KV1.3-SPECIFIC IMMUNOSUPPRESSIVE POLYPEPTIDE	336	X
15986	Chemical Shift Assignments of the Fibronectin 8-9FnI Domain Pair in Complex with a Type-I Collagen Peptide	346	X
15987	NMR structure of plasmid copy control protein ORF56 from sulfolobus islandicus	427	X
15988	TonB2 PROTEIN FROM Vibrio anguillarum	1015	X
15989	Solution NMR structure of the R2R3 DNA binding domain of Myb1 protein from protozoan parasite Trichomonas vaginalis	1403	X
15990	Structure of the Core Binding Domain of sigma54	884	X
15991	Structure of the Core Binding Domain of sigma54	1520	X
15992	Solution structure of Vm24 synthetic scorpion toxin.	224	X
15993	1H-15N Backbone Chemical shifts Of the C-terminal part of the Phosphoprotein (XD) of Measle Virus	86	X
15994	1H-15N Backbone Chemical shifts Of the C-terminal part of the Phosphoprotein (XD) of Measle Virus in complex with C-terminal Part of the Nucleoprotein (Ntail)	86	X
15995	Structure of TM1_TM2 in LPPG micelles	959	X
15996	1H, 15N and 13C resonance assignment of the pair of Factor-I like modules of the complement protein C7	1676	X
15997	NMR STRUCTURE OF DIMERIZATION DOMAIN OF HUMAN RIBOSOMAL PROTEIN P2	854	X
15998	Chemical shifts of the b'-x region of human protein disulfide isomerase	383	X
15999	Solution NMR structure of HTH_XRE family transcriptional regulator BT_p548217 from Bacteroides thetaiotaomicron. Northeast Structural Genomics Consortium Target BtR244.	980	X
16000	Solution structure of the nucleocapsid-binding domain of the measles virus phosphoprotein	289	X
16001	SOLUTION STRUCTURE OF DNA BINDING DOMAIN OF E. COLI ARAC	1294	X
16002	cytoskeletal complex	1177	X
16003	Backbone 1H, 13C, and 15N Chemical Shift Assignments for brain abundant protein 1 (BASP1)	758	X
16005	EphA2 dimeric structure in the lipidic bicelle at pH 5.0	505	X
16006	NMR structure of the protein TM1112	1181	X
16007	NMR structure of the protein TM1367	1596	X
16008	Solution structure of the SARS-unique domain-C from the nonstructural protein 3 (nsp3) of the severe acute respiratory syndrome coronavirus	823	X
16009	NMR resonance assignment of DnaE intein from Nostoc punctiforme	1726	X
16010	How do Proteins Form Amyloid? Insight from the NMR Spectroscopic Characterization of 13C, 15N-labeled Ribonuclease A in 40% Acetic Acid	696	X
16011	NMR Spectroscopic Characterization of 13C, 15N-labeled Ribonuclease A in urea 8M	463	X
16012	Solution NMR structure of BNIP3 transmembrane peptide dimer in detergent micelles	501	X
16014	Structure of protein complex	1719	X
16015	Structure of protein complex	1509	X
16016	NMR structure of TM0212 at 40 C	1346	X
16018	Solution Structure of Hirsutellin A from Hirsutella thompsonii	783	X
16019	NMR Structure of the protein TM1081	1362	X
16020	Magic-Angle-Spinning Solid-State NMR Structure of Influenza A M2 Transmembrane Domain	62	X
16021	NMR assignments of juvenile hormone binding protein in complex with JH III	2891	X
16022	Tetramer of KIA7W peptide	202	X
16023	Tetramer of KIA7H peptide	161	X
16024	NMR structrure of gallium subsituted ferredoxin	694	X
16025	Solution structure of the beta-E domain of wheat Ec-1 metallothionein	311	X
16026	ENHANCING THE ACTIVITY OF INSULIN BY STEREOSPECIFIC UNFOLDING	337	X
16027	ENHANCING THE ACTIVITY OF INSULIN BY STEREOSPECIFIC UNFOLDING	320	X
16028	NMR structure of delta-toxin from Staphylococcus aureus in CD3OH	206	X
16029	Solution NMR structure of ubiquitin-like domain of Arabidopsis thaliana protein At2g32350. Northeast Structural Genomics Consortium target AR3433A	1099	X
16030	Solution structure of protein BPP2914 from Bordetella parapertussis. Northeast Structural Genomics Consortium target BpR206	1298	X
16031	Nav1.5 C-terminal EF-Hand Domain	720	X
16032	Nav1.2 C-terminal EF-Hand Domain	1196	X
16033	Solution structure and dynamics of S100A5 in the apo states	1160	X
16034	Solution structure and dynamics of S100A5 in the Ca2+ -bound states	1163	X
16035	Sequence-specific 1H, 13C and 15N backbone resonance assignments of BamC, a component of the outer membrane protein assembly machinery in Escherichia coli	1533	X
16037	BlrP1 BLUF	1897	X
16038	NMR Structure of the phosphorylated form of OdhI, pOdhI.	1483	X
16039	NMR structure of the unphosphorylated form of OdhI, OdhI.	1115	X
16040	Solution structure of onconase C87A/C104A	853	X
16041	FLNCCPGCCMEP_ReAsH_motif	66	X
16042	human brain-type fatty acid binding protein (hb-FABP	1435	X
16043	The solution structure of Bacillus subtilis SR211 by NMR spectroscopy	1282	X
16044	N-terminal backbone assignment of the polyoma virus large T antigen	809	X
16045	1H, 13C, and 15N Chemical Shift Assignments for the C-terminal EF-Hand domain of human cardiac sodium channel NaV1.5	1150	X
16046	human brain-type fatty acid binding protein (hb-FABP bound to docosahexaenoic acid (DHA))	1368	X
16047	human brain-type fatty acid binding protein (hb-FABP bound to elaidic acid	1396	X
16048	human brain-type fatty acid binding protein (hb-FABP bound to oleic acid (OLA))	1392	X
16049	human brain-type fatty acid binding protein (hb-FABP bound to linoleic acid (LNA))	1392	X
16050	Ca-S100A1 interacting with TRTK12	1130	X
16051	Solution NMR structure of the OB domain (residues 67-166) of MM0293 from Methanosarcina mazei. Northeast Structural Genomics Consortium target MaR214a.	1351	X
16052	Assignment of 1HN, 13C, and 15N chemical shift resonances for the STAS domain of Rv1739c, a putative sulfate transporter of Mycobacterium tuberculosis	1506	X
16053	Attachment of an NMR-invisible solubility enhancement tag (INSET) using a sortase-mediated protein ligation method	862	X
16054	Dimeric solution structure of the DNA loop d(TGCTTCGT)	83		X
16055	Dimeric solution structure of the cyclic octamer d(pCGCTCCGT)	79		X
16056	STRUCTURAL AND FUNCTIONAL ANALYSIS OF TM XI OF THE NHE1 ISOFORM OF THE NA+/H+ EXCHANGER	254	X
16057	NMR structure of protein gp15 of bacteriophage SPP1	1141	X
16058	SOLUTION STRUCTURE OF THE FACTOR H BINDING PROTEIN	2818	X
16059	Paramecium bursaria Chlorella virus 1 (PBCV1) DNA ligase (holo form)	1229	X
16060	Loop 3 of Short Neurotoxin II is an Additional Interaction Site with Membrane-Bound Nicotinic Acetylcholine Receptor as Detected by Solid-State NMR Spectroscopy	332	X
16061	Solution Structure of HybE from Escherichia coli	1890	X
16062	NMR solution structure of the pheromone En-1 of Euplotes nobilii at -1.5 C	439	X
16063	Solution structure of ILK/PINCH complex	2718	X
16064	Solution NMR structure of Bacteroides fragilis protein BF1650. Northeast Structural Genomics Consortium target BfR218	1208	X
16065	Structure of E. coli toxin RelE(R81A/R83A)mutant in complex with antitoxin RelBc (K47-L79) peptide	1616	X
16066	Structure of E. coli toxin RelE(R81A/R83A) mutant in the free state	1229	X
16067	Backbone assignment of RelB antitoxin C-terminal peptide (RelBc) in the RelE-free state	128	X
16068	gp16	913	X
16069	Resonance assignments for PilZ from Xanthomonas citri	370	X
16070	Apo Pin1 WW Domain	200	X
16071	Mouse prion protein fragment 90-231 at pH 7.0	643	X
16072	Solution NMR structure of SSP0047 from Staphylococcus saprophyticus. Northeast Structural Genomics Consortium Target SyR6.	1525	X
16073	Solution structure of cycloviolacin O2	181	X
16074	Solution structure of micelle-bound kalata B2	163	X
16075	Mouse prion protein fragment mPrP[M129V](91-231) at pH 7.0	518	X
16076	Mouse prion protein fragment mPrP[P102L](91-231) at pH 7.0	522	X
16077	Mouse prion protein fragment mPrP[P105L](91-231) at pH 7.0	522	X
16078	Mouse prion protein fragment mPrP[A117V](90-231) at pH 7.0	524	X
16079	Mouse prion protein fragment mPrP[A113V,A115V,A118V](90-231) at pH 7.0	639	X
16080	Mouse prion protein fragment mPrP[K119I,H111I](90-231) at pH 7.0	526	X
16082	solution structure of FAPP1 PH domain	1328	X
16083	Northeast Structural Genomics Consortium (NESG), target MrR121A	1048	X
16084	SOLUTION STRUCTURE OF TETRATRICOPEPTIDE REPEAT DOMAIN PROTEIN SRU_0103 FROM SALINIBACTER RUBER, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET SrR115C	1064	X
16085	1H, 13C, 15N Chemical Shift Assignment for Saccharomyces cerevisiae Acyl Carrier Protein.	2075	X
16087	Solution structure of the antifungal protein PAF from Penicillium chrysogenum	226	X
16088	Apo Pin1 WW Domain	200	X
16089	Solution NMR structure of ribosomal protein sso0164 from Sulfolobus solfataricus. NortheastStructural Genomics Consortium (NESG) target SsT4	1407	X
16090	NMR Structure of a Monomeric Folding Intermediate Reveals the Structural Basis for Rapid Assembly of an Evolutionary Optimized Trimerization Module	218	X
16091	SOLUTION STRUCTURE OF 30S RIBOSOMAL PROTEIN S8E; FROM Methanothermobacter thermautotrophicus, NORTHEASTSTRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET TR71D	1062	X
16093	Solution structure of protein SRU_2040 from Salinibacter ruber (strain DSM 13855). Northeast Structural Genomics Consortium target SrR106	1457	X
16094	solution structure of anntoxin	336	X
16096	SOLUTION NMR STRUCTURE OF THE OB-FOLD DOMAIN OF HEME CHAPERONE CCME FROM DESULFOVIBRIO VULGARIS. NORTHEAST STRUCTURAL GENOMICS TARGET DVR115G.	1097	X
16097	NMR solution structure of an uncharacterized protein from Chlorobium tepidum. Northeast Structural Genomics target CtR107	1677	X
16098	Solution structure of Apo-form YjaB from Escherichia coli	1781	X
16099	Solution NMR Structure of KAZAL-1 domain from Human Follistatin-related protein 3 (FSTL-3). Northeast Structural Genomics Target HR6186A.	788	X
16100	Solution NMR Structure of the C-Terminal Domain of Protein DR_A0006 from Deinococcus radiodurans, Northeast Structural Genomics Consortium Target DrR147D	1436	X
16101	NMR solution Structure of O64736 protein from Arabidopsis thaliana:Northeast Structural Genomics Consortium MEGA Target AR3445A	978	X
16102	Solution NMR Structure of the Integrase-Like Domain from Bacillus cereus Ordered Locus BC_1272. Northeast Structural Genomics Target BcR268F	1474	X
16103	1H, 13C, and 15N chemical shift assignments for murine FAIM-CTD	1019	X
16104	THE DYNAMIC ALPHA-HELIX STRUCTURE OF MICELLE-BOUND HUMAN AMYLIN.	236	X
16105	THE DYNAMIC ALPHA-HELIX STRUCTURE OF MICELLE-BOUND HUMAN AMYLIN.	236	X
16107	Solution NMR structure of F5/8 type C-terminal domain of a putative chitobiase from Bacteroides thetaiotaomicron. Northeast Structural Genomics Consortium target BtR324B	1976	X
16108	Backbone and side-chain assignment of the lipidated and non-lipidated forms of the meningococcal outer membrane protein LP2086	2106	X
16109	Solution Structure of human ubiquitin-like domain of Herpud2_9_85, Northeast Structural Genomics Consortium (NESG) target HT53A	1002	X
16110	Solution structure of the conserved C-terminal dimerization domain of Borealin	758	X
16111	Sequence-specific 1H, 15N and 13C resonance assignments of Art v 1: a proline-rich allergen of Artemisia vulgaris pollen	1002	X
16112	Solution structure of a K+-channel voltage-sensor paddle motif	205	X
16113	H, 13C, and 15N Chemical Shift Assignments of Protein yppE from Bacillus subtilis. Northeast Structural Genomics Consortium Target SR213	1303	X
16114	Solution structure of a Ubiquitin/UIM fusion protein	1113	X
16115	Solution Structure of an SH3-like Domain from p80-Coilin	859	X
16116	NMR structures of GA95 and GB95, two designed proteins with 95% sequence identity but different folds and functions	654	X
16117	NMR structures of GA95 and GB95, two designed proteins with 95% sequence identity but different folds and functions	655	X
16118	Solution structure of PFE0790c, a putative bolA-like protein from the protozoan parasite Plasmodium falciparum: A Structural Genomics Center for Infectious Disease (SSGCID) community request.	1093	X
16119	Structure of the human Shwachman-Bodian-Diamond syndrome protein, SBDS	2498	X
16120	Sequence-specific 1H, 13C, and 15N resonance assignment of the Autophagy-related Protein Atg 8	1317	X
16121	Structure of Archaeal L14e Ribosomal Protein from Sulfolobus sulfataricus	1195	X
16122	HCV NS4B(227-254)	259	X
16123	Backbone 1H, 13C, and 15N Chemical Shift Assignments for d+PHS/V66K SNase	503	X
16124	Solution structure of RppH from Escherichia coli	2011	X
16126	Solution structure of HypA protein	1437	X
16127	Solution Structure of the SAP30 zinc finger motif	818	X
16129	The NMR structure of the TC10 and Cdc42 interacting domain of CIP4	1287	X
16130	Backbone 1H, 13C, and 15N Chemical Shift Assignments for colicinN Tdomain residues 40-76 in complex with unlabbeled TolAIII	150	X
16131	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Colicin N Tdomain residues 40-76	174	X
16133	Backbone 1H, 13C, and 15N Chemical Shift Assignments for TolAIII residues 296-421	299	X
16134	Backbone 1H, 13C, and 15N Chemical Shift Assignments for tolaIII residues296-421in complex with unlabelled colicin N Tdomain	289	X
16135	Sequence-specific 1H, 15N, and 13C resonance assignments of the 23.7 kDa homodimeric toxin CcdB from Vibrio fischeri.	1177	X
16136	NMR assignment of jerdostatin from Trimeresurus jerdonii	404	X
16137	NMR structure of the first SAM domain from AIDA1	729	X
16138	NMR solution structure of metal-modified DNA	332		X
16139	NMR solution structure of the CASKIN SH3 domain	684	X
16140	[Sec13,Sec14]-kappa-hexatoxin-Hv1c	214	X
16141	NMR solution structure of the HACS1 SH3 domain	697	X
16142	Structure of SDF-1/CXCL12	907	X
16143	Structure of SDF-1/CXCL12	906	X
16144	Backbone and side chain 1H, 13C, and 15N NMR assignments for the organic hydroperoxide resistance protein (Ohr) from Burkholderia pseudomallei, Seattle Structural Genomics Center for Infectious Disease (SSGCID) target BupsA.00074	1438	X
16145	Structure of SDF-1/CXCL12	905	X
16146	Backbone resonance assignment of Staphylococcal Enterotoxin H	810	X
16147	NMR assignments of oxidised thioredoxin from Plasmodium falciparum	1281	X
16148	NMR structure of Plantaricin K in DPC-micelles	287	X
16149	Plantaricin K in TFE	359	X
16150	NMR assignment of jerdostatin mutant R24K from Trimeresurus jerdonii	437	X
16151	NMR assignment of jerdostatin from Trimeresurus jerdonii, with deletion of two residues (N45 G46) from the C-terminal end	412	X
16152	NMR assignment of jerdostatin mutant R24K from Trimeresurus jerdonii, with deletion of two residues (N45 G46) from the end C-terminal	421	X
16153	Structure of the transcription repressor SvtR08 (gp08) from the hyperthermophilic archaeal virus SIRV1	750	X
16154	Solution NMR structure of the OB domain (residues 67-166) of MM0293 from Methanosarcina mazei. Northeast Structural Genomics Consortium target MaR214a.	1352	X
16155	Solution NMR structure of protein HS00059 from Homo Sapiens. Northeast Structural Genomics Consortium (NESG) target HT98A.	1091	X
16156	Solution Structure of the Coiled-coil Domain of Synphilin-1	491	X
16157	alpha-amylase inhibitor Parvulustat (Z-2685) from Streptomyces parvulus	732	X
16158	Beta1D Integrin Cytoplasmic Tail 1H and 15N Chemical Shift Assignments	117	X
16159	Beta1A Integrin Cytoplasmic Tail 1H and 15N Chemical Shift Assignments	447	X
16160	1H, 13C, and 15N Chemical Shift Assignments for Myosin Phosphatase Trageting Subunit 1 (residues 1-98)	823	X
16161	Solution NMR Structure of a domain from a Putative Phage Integrase Protein BF2284 from Bacteroides fragilis, Northeast Structural Genomics Consortium Target BfR257C	1146	X
16162	Beta1D Integrin Cytoplasmic Tail (Polyhistidine-Tagged) 1H and 15N Chemical Shift Assignments	510	X
16163	NMR structure of the N-terminal domain of kindlin1	1279	X
16164	Solution structure of XcpT, the main component of the type 2 secretion system of Pseudomonas aeruginosa	1218	X
16165	1H, 15N and 13C backbone resonance assignments of domain 2 (D2) of the non-structural 5A protein (NS5A) from the JFH1 Hepatitis C virus (HCV) strain.	437	X
16166	1H, 15N and 13C backbone resonance assignments of domain 3 of the non-structural 5A (NS5A) protein from Hepatitis C Virus (Con1)	421	X
16167	NMR data for FXYD4 in micelles	319	X
16168	STRUCTURE OF THE NA,K-ATPASE REGULATORY PROTEIN FXYD1 IN MICELLES	670	X
16169	Barnase low pressure reference	390	X
16170	Barnase high pressure structure	387	X
16171	Barnase bound to d(CGAC), low pressure	356	X
16172	Barnase bound to d(CGAC) high pressure	356	X
16173	The structure of the cataract causing P23T mutant of human gamma-D crystallin	2018	X
16174	15N, 13C and 1H resonance assignments for the Rv0287-Rv0288 complex	1830	X
16175	Backbone assignments for odorant binding protein 1	1420	X
16176	Prp40 FF4 domain	807	X
16177	Backbone and sidechain chemical shift assignments for E73 from SSV-RH	760	X
16178	MeVamp-4	174	X
16179	Structure of the C-terminal domain of EHD1 with FNYESTNPFTAK	1264	X
16180	Structure of the C-terminal domain of EHD1 in complex with FNYESTNPFTAK	1273	X
16181	Structure of the C-terminal domain of EHD1 with FNYESTGPFTAK	1269	X
16182	The solution conformation of the leader sequence of the prepropeptide for the microcin-like patellamides	255	X
16183	Tammar Wallaby Prion Protein (121-230)	1387	X
16184	Mouse Prion Protein (121-231) with Mutations Y225A and Y226A	911	X
16185	Mouse Prion Protein (121-231) with Mutation V166A	924	X
16186	Solution NMR structure of PSPTO_3016 from Pseudomonas syringae. Northeast Structural Genomics Consortium target PsR293.	1569	X
16187	Backbone 1H Chemical Shift Assignments for FP1	225	X
16188	NMR structure of Rv2175c	1519	X
16189	Structure of the amino-terminal domain of human FK506-binding protein 3 / Northeast Structural Genomics Consortium Target HT99A	918	X
16190	Structure of the N-terminal domain of human cardiac troponin C bound to calcium ion and to the inhibitor W7	84	X
16191	NMR-Assignments of a Cytosolic Domain of the C-Terminus of Polycystin-2	1017	X
16192	NMR structure of the first qRRM of hnRNP F in complex with AGGGAU G-tract RNA	1045	X		X
16193	Structure of the second qRRM domain of hnRNP F in complex with a AGGGAU G-tract RNA	1134	X		X
16194	Structure of the third qRRM domain of hnRNP F in complex with a AGGGAU G-tract RNA	1097	X		X
16195	Resonance assignments of the human AKAP13 PH domain and stabilizing DH helix	2281	X
16196	Solution Structure of the acetyl Actinorhodin Acyl Carrier Protein from Streptomyces coelicolor	1024	X
16197	NMR Solution Structures of malonyl ACP from the actinorhodin polyketide synthase in Streptomyces coelicolor	1031	X
16198	1H, 13C and 15N backbone and side chain chemical shift assignments of N-terminal domain of Tim23.	1004	X
16199	NMR Solution Structures of butyryl-ACP (a non-polar, non pathway intermediate) from the actinorhodin polyketide synthase in Streptomyces coelicolor	1030	X
16200	NMR Solution Structures of hexanoyl ACP (a non natural intermediate) from the actinorhodin polyketide synthase in Streptomyces coelicolor	1013	X
16201	NMR Solution Structures of octanoyl ACP (a non-natural intermediate) from the actinorhodin polyketide synthase in Streptomyces coelicolor	1031	X
16202	NMR Solution Structures of 3-oxo-butyl-ACP, an intermediate mimic from the actinorhodin polyketide synthase in Streptomyces coelicolor	1024	X
16203	NMR Solution Structures of 3,5-dioxohexyl ACP (a triketide mimic) from the actinorhodin polyketide synthase in Streptomyces coelicolor	1031	X
16204	Backbone 1H, 13C, and 15N Chemical Shift Assignments for apo HisJ and holo HisJ	1530	X
16205	Backbone 1H, 13C, and 15N Chemical Shift Assignments for apo HisJ and holo HisJ	1581	X
16206	THE RRM DOMAIN IN GW182 PROTEINS CONTRIBUTES TO MIRNA-MEDIATED GENE SILENCING	1030	X
16207	NmerA	679	X
16208	NmerAHg	685	X
16209	Solution Structure of JARID1A C-terminal PHD finger	565	X
16210	Solution structure of JARID1A C-terminal PHD finger in complex with H3(1-9)K4me3	624	X
16211	Solution structure of putative prolyl isomerase PpiD from E.Coli	798	X
16212	Dimeric solution structure of the DNA loop d(TCGTTGCT)	81		X
16213	A Complete NMR Spectral Assignment of the MESD Protein	2066	X
16214	Zn finger protein YBIL from E.Coli; NESG target ET107; OCSP target EC0402	1013	X
16215	Refined solution structure of des-pyro Glu brazzein	629	X
16216	Solution structure of protein ITSN1 from Homo sapiens. Northeast Structural Genomics Consortium target HR5524A	1212	X
16217	Backbone 1H, 13CA, and 15N Chemical Shifts Assignments and 15N T1 and T2 Relaxation Parameters for the N-terminal (1-119) Fragment of sperm whale apomyoglobin	108	X
16218	Backbone 1H, 13CA, and 15N Chemical Shifts Assignments and 15N T1 and T2 Relaxation Parameters for the N-terminal (1-119) Fragment of sperm whale apomyoglobin in the presence of DnaK-beta	108	X
16219	Solution structure of SH3 domain of PTK6	768	X
16221	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Collagen Binding domain of MMP2	255	X
16222	NMR Structure of Aflatoxin Formamidopyrimidine alpha-anomer in duplex DNA	220		X
16223	Aflatoxin Formamidopyrimidine alpha anomer in single strand DNA	46		X
16225	Solution Structure of cis-5R,6S-thymine glycol opposite complementary adenine in duplex DNA	251		X
16226	Solution Structure of cis-5R,6S-thymine glycol opposite complementary guanine in duplex DNA	230		X
16228	1H, 13C, and 15N chemical shift assignments for stereo-array labeled (SAIL) ubiquitin	815	X
16229	1H, 13C, and 15N Chemical Shift Assignments for ring1B C-terminal domain/ cbx7 CBOX complex	421	X
16230	Solution Structure of Yeast Prp24-RRM2 Bound to a Fragment of U6 RNA	1100	X		X
16231	Solution Structure of a Pathogen Recognition Domain from a Lepidopteran Insect, Plodia interpunctella	1225	X
16233	1H, 13C, 15N Chemical Shift Assignments for Eimeria tenella microneme protein 3 mar1a domain	1278	X
16235	Solution structure of linear kalata B1 (loop 6)	166	X
16236	Bruno RRM3+	1331	X
16237	Solution structure of the amino-terminal domain of OmpATb, a pore forming protein from Mycobacterium tuberculosis.	2296	X
16238	Solution NMR structure of VC_A0919 from Vibrio cholerae. Northeast Structural Genomics Consortium Target VcR52.	1231	X
16239	Plantaricin J in DPC-micelles	284	X
16240	Solution structure of full-length SlyD from E.coli	1677	X
16241	Plantaricin J in TFE	295	X
16243	Backbone NH Assignments for Prp24-RRM23	316	X
16244	Backbone NH Assignments for Prp24-RRM23 Bound to AGAGAU RNA	262	X		X
16245	Assignment of the 1H and 15N Resonances of Escherichia coli IscU.	196	X
16246	Resonance Assignments for Yeast Prp24-RRM2	861	X
16247	NMR solution structure of the b30-82 domain of subunit b of Escherichia coli F1FO ATP synthase	587	X
16248	PknB-phosphorylated Rv1827	1848	X
16249	The carboxy-terminal non-repetitive domain of a spider dragline silk protein regulates nucleation of silk assembly	1525	X
16250	NMR solution structure of the EH 1 domain from human intersectin-1 protein. Northeast Structural Genomics Consortium target HR3646e.	1205	X
16251	Solution NMR structure of a phage integrase SSP1947 fragment 59-159 from Staphylococcus saprophyticus, Northeast Structural Genomics Consortium Target SyR103B	1379	X
16252	1H, 13C, 15N Chemical shift assignments of A13 homeodomain	788	X
16253	NMR chemical shift assignments for Rv2377c, a MbtH-like protein from Mycobacterium tuberculosis: A Structural Genomics Center for Infectious Disease (SSGCID) community request	582	X
16254	NMR Structure of human alpha defensin HNP-1	145	X
16255	Solution Structure Of Protein Nmul_A0922 From Nitrosospira multiformis. Northeast Structural Genomics Consortium Target Hr5524a.	1183	X
16256	Drosha RNA Binding Domain	785	X
16257	Nogo66 at pH4.0	305	X
16258	Solution Structure of RCL	1679	X
16259	Beta7 Integrin Cytoplasmic Tail 1H and 15N Chemical Shift Assignments	468	X
16260	NMR assignments of FK506 binding domain from Plasmodium vivax	1474	X
16261	1H, 15N, 13C assignments of the Riphicephalus (Boophilus) microplus antimicrobial protein microplusin	846	X
16262	NMR solution structure of the N-terminal domain of the DNA polymerase alpha p68 subunit	868	X
16263	Backbone and sidechain 1H, 15N and 13C assignments of the NLRP7 Pyrin domain	1231	X
16264	Solution structure of Glutaredoxin from Brucella melitensis. Seattle Structure Genomics Center for Infectious Disease (SSGCID) (Target ID BrabA.00079.a)	990	X
16265	Complete backbone 15N, 13C and 1H resonance assignments for the oxidized form of the N-terminal domain of AhpF	765	X
16266	Solution Structure of RPP29-RPP21 complex from Pyrococcus furiosis	2482	X
16267	Solution NMR structure of tungsten formylmethanofuran dehydrogenase subunit D from Archaeoglobus fulgidus, Northeast Structural Genomics Consortium target AtT7	1711	X
16268	Human cannabinoid receptor-2 helix 6	245	X
16269	n-NafY. N-terminal domain of NafY	828	X
16270	SOLUTION STRUCTURE OF THE S. AUREUS SORTASE A-SUBSTRATE COMPLEX	1810	X
16271	A PH domain within OCRL bridges clathrin mediated membrane trafficking to phosphoinositide metabolis	1454	X
16272	Solution NMR structure of an O6-methylguanine DNA methyltransferase family protein from Vibrio parahaemolyticus. Northeast Structural Genomics Consortium target VpR247.	1358	X
16273	A PH domain within OCRL bridges clathrin mediated membrane trafficking to phosphoinositide metabolism	1950	X
16274	SLBP PAPA peptide	127	X
16275	Apelin17 bound to DPC micelles	216	X
16276	NMR structure of the SO2144 H-NOX domain from Shewanella oneidensis in the Fe(II)CO ligation state	2069	X
16277	Solution structure of the Actuator domain of the copper-transporting ATPase ATP7A	1450	X
16278	NMR structure of the H103G mutant SO2144 H-NOX domain from Shewanella oneidensis in the Fe(II)CO ligation state	1804	X
16279	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the yeast Hsp90 Middle Domain	1073	X
16280	d(GAGCTC)2 assignments	35		X
16281	d(GAGCTC)2 plus dqdppn	35		X
16282	d(AGAGCTCT)2 assignments	55		X
16283	1.7-mm microcryoprobe solution NMR structure of an O6-methylguanine DNA methyltransferase family protein from Vibrio parahaemolyticus. Northeast Structural Genomics Consortium target VpR247.	1357	X
16284	NMR structure of the oxidized yeast TOR1 FATC domain bound to DPC micelles at 318K	393	X
16285	Solution structure of a PDZ protein	1240	X
16286	d(CGAGCTCG)2 assignments	53		X
16287	d(AGAGCTCT)2 plus dqdppn 1:2 assignments	46		X
16288	d(CGAGCTCG)2 plus dqdppn 1:2 assignments	41		X
16289	d(GCTATAGC)2 assignments	55		X
16290	d(GCTATAGC)2 1:1 complex with dqdppn assignments	42		X
16291	d(AGAGCTCT)2 plus Ru ligand 1:2 assignments	40		X
16292	d(CGAGCTCG)2 plus Ru ligand 1:2 assignments	43		X
16293	Solution structure of CA150 FF1 domain and FF1-FF2 interdomain linker	1270	X
16294	1H (NH, HA, HB, other) Chemical Shift Assignments of Peach Pru p 3, Non-Specific Lipid Transfer Protein (nsLTP) isolated from Peach fruit skin	332	X
16295	The solution struture of the reduced yeast TOR1 FATC domain bound to DPC micelles at 298K	388	X
16296	NMR Assignment of the Intrinsically Disordered C-terminal Region of Homo sapiens FCP1 in the Unbound State	829	X
16297	AIDA-1 SAM domain tandem	1413	X
16298	Solution NMR structure of the domain N-terminal to the integrase domain of SH1003 from Staphylococcus haemolyticus. Northeast Structural Genomics Consortium Target ShR105F (64-166).	1430	X
16299	NMR assignment of a 48 kDa tetramer of the T1 domain of the mammalian voltage gated potassium channel Kv1.4	420	X
16300	intrinsically unfolded alpha-synuclein	626	X
16301	intrinsically unfolded alpha-synuclein variant SaS	492	X
16302	SLAS-bound alpha-synuclein	644	X
16303	SLAS-bound SaS synuclein variant	646	X
16304	SLAS-bound beta-synuclein	588	X
16305	1H, 13C and 15N assignments of a camelid nanobody directed against human alpha-synuclein	1265	X
16306	1H, 15N, and 13C resonance assignments of the 2/2 hemoglobin from the cyanobacterium Synechococcus sp. PCC 7002 in the ferric bis-histidine state	1429	X
16307	1H, 15N, and 13C resonance assignments of the 2/2 hemoglobin from the cyanobacterium Synechococcus sp. PCC 7002 in the ferric bis-histidine state	1783	X
16309	15N, 13C cL-BABP T91C holo	467	X
16310	Backbone assignment of the mutant cL-BABP T91C	778	X
16311	Solution structure of the complex of VEK-30 and plasminogen kringle 2	1466	X
16312	Solution NMR structure of a domain from a putative phage integrase protein Nmul_A0064 from Nitrosospira multiformis, Northeast Structural Genomics Consortium Target NmR46C.	1346	X
16313	NMR Solution Structure of a Tubulin folding cofactor B obtained from Arabidopsis thaliana: Northeast Structural Genomics Consortium target AR3436A	1003	X
16314	Three-Dimensional NMR Structure of Rat Islet Amyloid Polypeptide in DPC micelles.	212	X
16315	NMR structure of fragment 87-196 from the putative phage integrase IntS of E. coli: Northeast Structural Genomics Consortium target ER652A	1337	X
16316	NMR structure of IntB phage-integrase-like protein fragment 90-199 from Erwinia carotova subsp. atroseptica: Northeast Structural Genomics Consortium target EwR217E	1405	X
16317	Solution structure of human interleukin-33	1745	X
16318	NMR Structure of CBP TAZ2 and Adenoviral E1A Complex	1472	X
16319	The solution structure of the circular bacteriocin carnocyclin A (CclA)	743	X
16320	Solution structure of an archaeal protein SSO6904 from hyperthermophilic Sulfolobus solfataricus	1232	X
16321	Backbone 1H, 13C and 15N resonance assignments for the E2 conjugating enzyme, UbcH8	1046	X
16322	Extracellular CD147 (EMMPRIN): Isoforms -2	720	X
16323	SLBP RBD 30-mer peptide	169	X
16325	Chemical shift assignments of the second domain of the listeria protein Lin2157, Northeast Structural Genomics Consortium target Lkr136b	1007	X
16327	DsbA wild type oxidized	866	X
16328	the S173N variant of rabbit prion protein (91-228)	1155	X
16329	1H, 15N and 13C chemical shift assignments for the oxidised form of the DsbA oxidoreductase from Staphylococcus aureus	1836	X
16330	1H, 15N and 13C chemical shift assignments for the reduced form of the DsbA oxidoreductase from Staphylococcus aureus	814	X
16332	pH dependent structures of LAH4 in micellar environmnet:mode of acting	174	X
16333	pH dependent structures of LAH4 in micellar environment: mode of acting	164	X
16334	Sequence specific backbone resonance assignment of Neuronal Calcium Sensor 1(NCS1) in non-myristoylated form.	1530	X
16335	Solution structure of protein YlbL (BSU15050) from Bacillus subtilis, Northeast Structural Genomics Consortium target sr713a	869	X
16336	Solution Structure Of Protein NMB1076 From Neisseria meningitidis. Northeast Structural Genomics Consortium Target MR101B.	1408	X
16337	Backbone resonance assignments for the aminoglycoside phosphotransferase(3')-IIIa	1063	X
16338	Solution NMR structure of the N-terminal Ubiquitin-like Domain from Tubulin-binding Cofactor B, CG11242, from Drosophila melanogaster. Northeast Structural Genomics Consortium Target FR629A (residues 8-92).	1057	X
16339	NMR structures of a designed Cyanovirin-N homolog lectin; LKAMG	1080	X
16340	100% complete assignment of non-labile 1H, 13C, and 15N signals for calcium-loaded Calbindin D9K P43G	1043	X
16341	The inactive form of the retroviral protease of the murine intracisternal particle, inMIA-14 PR	686	X
16342	Backbone 1H, 13C, 15N and 13C-beta Chemical Shift Assignments for alpha-synuclein at pH 3	635	X
16343	NMR STRUCTURE OF HUMAN INSULIN MUTANT GLU-B21-D-GLU, HIS-B10 ASP PRO-B28-LYS, LYS-B29-PRO, 20 STRUCTURES	332	X
16344	Solution structure and backbone dynamics of the ribosomal protein S6wt.	765	X
16345	Solution structure and backbone dynamics of the permutant P54-55	1156	X
16347	Solution NMR structure of protein ATC0852 from Agrobacterium tumefaciens. Northeast Structural Genomics Consortium (NESG) target AtT2.	1358	X
16348	SOLUTION STRUCTURE OF DEAD RINGER-LIKE PROTEIN 1 (AT-RICH INTERACTIVE DOMAIN-CONTAINING PROTEIN 3A) FROM HOMO SAPIENS, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET HR4394C	1711	X
16349	SOLUTION STRUCTURE OF C-terminal Domain of Tyrosine-protein kinase ABL2 FROM HOMO SAPIENS, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET HR5537A	1610	X
16350	NMR solution structure of the pheromone En-A1 from Euplotes nobilii	538	X
16352	Solution NMR structure of protein AF2094 from Archaeoglobus fulgidus. Northeast Structural Genomics Consotium (NESG) target GT2	1122	X
16353	SOLUTION STRUCTURE OF SH2 DOMAIN OF PROTO-ONCOGENE TYROSINE-PROTEIN KINASE FER FROM HOMO SAPIENS, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET HR3461D	1411	X
16354	NMR solution structure of the N terminal domain of subunit E (E1-52) of A1AO ATP synthase from Methanocaldococcus jannaschii	584	X
16355	NMR Solution Structure of a Putative Uncharacterized Protein obtained from Arabidopsis thaliana: Northeast Structural Genomics Consortium target AR3449A	975	X
16356	Structure of a two-G-tetrad intramolecular G-quadruplex formed by a variant human telomeric sequence in K+ solution	210		X
16357	Solution NMR Structure of a dimeric protein of unknown function from Methanobacterium thermoautotrophicum, Northeast Structural Genomics Consortium Target TR5	1284	X
16359	chemical shift assignment of West Nile protease in the absence of inhibitor	400	X
16360	1H, 13C and 15N NMR sequence-specific resonance assignments and relaxation parameters for human apo-S100A1(aa) in the reduced form	1191	X
16361	NMR structure of the p62 PB1 domain	1132	X
16362	1H, 13C and 15N NMR assignments of StnII-R29Q, a defective lipid binding mutant of the sea anemone actinoporin Sticholysin II.	1732	X
16363	Solution structure of the Nuclear coactivator binding domain of CBP	657	X
16364	Solution NMR structure of FHA domain of Mb1858 from Mycobacterium bovis. Northeast Structural Genomics Consortium Target MbR243C (24-155).	1677	X
16365	Solution NMR structure of yeast protein YOR252W [residues 38-178]: Northeast Structural Genomics Consortium target YT654	1422	X
16366	Solution NMR structure of Themotoga maritima protein TM1076: Northeast Structural Genomics Consortium target VT57	1745	X
16367	NMR Evidence for differential phosphorylation-dependent interactions in WT and DeltaF508 CFTR	987	X
16368	Solution NMR structure of the homodimeric winged helix-turn-helix DNA-binding domain (fragment 1-100) Mb0332 from Mycobacterium bovis, a possible ArsR-family transcriptional regulator. Northeast Structural Genomics Consortium Target MbR242E.	1267	X
16370	Solution NMR Structure of the Ig-like C2-type 2 Domain of Human Myotilin. Northeast Structural Genomics Target HR3158.	1297	X
16371	Solution Structure Of Protein DSY2949 From Desulfitobacterium hafniense. Northeast Structural Genomics Consortium Target DhR27	1643	X
16372	Solution structure of protein af2351 from Archaeoglobus fulgidus. Northeast Structural Genomics Consortium target AtT9/Ontario Center for Structural Proteomics Target af2351	1651	X
16373	Solution NMR structure of an integrase domain from protein SPA4288 from Salmonella enterica, Northeast Structural Genomics Consortium Target SlR105H	1294	X
16374	Solution Structure of C-terminal domain of reduced NleG2-3 (residue 90-191) from Pathogenic E. coli O157:H7. Northeast Structural Genomics Consortium and Midwest Center for Structural Genomics target ET109A	1257	X
16375	Solution Structure of C-terminal domain of oxidized NleG2-3 (residue 90-191) from Pathogenic E. coli O157:H7. Northeast Structural Genomics Consortium and Midwest Center for Structural Genomics target ET109A	1257	X
16376	Solution NMR structure of the monomeric W187R mutant of A/Udorn NS1 effector domain. Northeast Structural Genomics target OR8C[W187R].	1741	X
16377	RpR325/RPA3574 from Rhodopseudomonas palustris	830	X
16378	Chemical shift assignment of GtR34C from Geobacillus thermodenitrificans. North East Structural Genomics Consortium Target GtR34C	923	X
16379	Solution structure of Interleukin 1a	1381	X
16380	NMR solution structure of A2LD1 (gi:13879369)	1575	X
16381	Sequence-specific resonance assignments of human VDAC-1 in LDAO micelles	1224	X
16382	Solution NMR structure of the Rhodanese-like domain from Anabaena sp Alr3790 protein. Northeast Structural Genomics Consortium Target NsR437A	1534	X
16384	Solution NMR Structure of protein yutD from B.subtilis, Northeast Structural Genomics Consortium Target Target SR232	1077	X
16385	Solution NMR structure of the CARDB domain of PF1109 from Pyrococcus furiosus. Northeast Structural Genomics Consortium target PfR193A	1400	X
16386	Solution NMR Structure of the EGF-like 1 Domain of Human Fibulin-4. Northeast Structural Genomics Target HR6275.	738	X
16387	Solution NMR Structure of denovo designed ferrodoxin fold like protein, Northeast Structural Genomics Consortium Target Target OR15	1030	X
16388	NMR Solution structure of a diflavin flavoprotein A3 from Nostoc sp. PCC 7120, Northeast Structural Genomics Consortium Target NsR431C	1780	X
16389	Solution NMR structure of protein of unknown function (NP_247299.1) from Methanococcus jannaschii	1261	X
16390	NMR solution structure of human ubiquitin-like domain of ubiquilin 1, Northeast Structural Genomics Consortium (NESG) target HT5A	951	X
16391	13C and 15N Chemical Shift Assignments for human alphaB-crystallin	673	X
16393	NMR Evidence for differential phosphorylation-dependent interactions in WT and deltaF508 CFTR	506	X
16394	NMR Evidence for differential phosphorylation-dependent interactions in WT and deltaF508 CFTR	228	X
16395	Assignments of M.HhaI bound with hemimethylated DNA	1109	X
16396	The solution structure of CBD of human MCM6	1272	X
16397	Solution structure of SCA7 zinc finger domain from human ataxin-7 protein	540	X
16398	1H, 13C and 15N Chemical Shift Assignment for the Psb27 Protein of Synechocystis PCC 6803	1114	X
16399	Role of Trp-Trp interactions in Trpzip beta-hairpin formation, structure and stability	82	X
16400	SOLUTION STRUCTURE OF AN ABC COLLAGEN HETEROTRIMER REVEALS A SINGLE-REGISTER HELIX STABILIZED BY ELECTROSTATIC INTERACTIONS	69	X
16401	Separation of Inhibitor and Substrate Binding Locations in the Globin Dehaloperoxidase	644	X
16402	Solution structure of SCA7 zinc finger domain from human Ataxin-7-L3 protein	979	X
16403	SOLUTION STRUCTURE OF GLUTAREDOXIN FROM Bartonella henselae str. Houston. Seattle Structure Genomics Center for Infectious Disease (SSGCID)	959	X
16404	Solution structure of human ubiquitin conjugating enzyme Ube2g2	1966	X
16405	Solution Structure of the Tandem UIM Domain of Ataxin-3 Complexed with Ubiquitin	415	X
16406	Solution structure of peptidyl-prolyl cis-trans isomerase from Burkholderia pseudomallei. Seattle Structure Genomics Center for Infectious Disease (SSGCID)	1179	X
16407	Role of Trp-Trp interactions in Trpzip beta-hairpin formation, structure and stability	86	X
16408	Cu(I)-bound CopK	847	X
16409	Backbone 1H, 15N, and 13C assignments for beta phosphoglucomutase in a ternary complex with alpha-galactose 1-phosphate and MgF3-	835	X
16411	Solution structure of Rtt103 CTD interacting domain	1736	X
16412	Solution structure of Rtt103 bound to CTD peptide	1531	X
16413	C17orf37 Human 9606 Eukaryota Matazoa Homo sapiens	1313	X
16424	Solution Structure of BamE, a component of the outer membrane protein assembly machinery in Escherichia coli	972	X
16425	Interdomain RRM packing contributes to RNA recognition in the rna15, hrp1, anchor RNA 3' processing ternary complex	922	X		X
16426	NMR-derived structure of residues 29-138 of murine Ets-1, containing the PNT domain, along with phosphorylated Thr38 and Ser41	1419	X
16428	The structure of the KlcA and ArdB proteins show a novel fold and antirestriction activity against Type I DNA restriction systems in vivo but not in vitro.	1605	X
16430	1H, 13C, 15N backbone resonance assginments of Nep1 from Methanococcus jannaschii	1978	X
16431	Complex of HIV-2 TAR RNA and a synthetic tripeptide in a 1:2 stoichiometry	465	X		X
16435	Solution structure of native Leech-dreived tryptase inhibitor, LDTI	269	X
16436	Solution structure of intermediate IIa of Leech-derived tryptase inhibitor, LDTI	262	X
16437	Solution structure of intermeidate IIa of Leeck-derived tryptase inhibitor, LDTI.	253	X
16438	Solution structure of intermeidate IIa of Leeck-derived tryptase inhibitor, LDTI.	246	X
16439	Combined high- and low-resolution techniques reveal compact structure in central portion of factor H despite long inter-modular linkers	1381	X
16440	Solution structure of the nucleotide binding domain of the human Menkes protein in the ATP-free form	2021	X
16441	Solution structure of the nucleotide binding domain of the human Menkes protein in the ATP-bound form	2046	X
16442	Solution structure of At3g03773.1 protein from Arabidopsis thaliana	1863	X
16443	NMR Solution structures of fully oxidised cytochrome c3 from Desulfovibrio desulfuricans ATCC 27774	647	X
16444	NMR Chemical Shifts of GB1-SC35	1851	X
16445	Backbone and side chain 1H, 13C, 15N chemical shift assignments for K2	502	X
16446	Chemical shift assignments for Ncs1p	1818	X
16447	Structural tightening and interdomain communication in the catalytic cycle of phosphoglycerate kinase	1786	X
16448	Resonance assignments of the SH3 domain of phosphatidylinositol-3-kinase (PI3-SH3) in amyloid fibril form determined by MAS NMR spectroscopy	315	X
16449	Structure of the XPF-single strand DNA complex	707	X	X
16450	Backbone and side chain 1H, 13C, 15N chemical shift assignments for YSK2	1122	X
16451	Structural tightening and interdomain communication in the catalytic cycle of phosphoglycerate kinase	1411	X
16452	NMR structure of the C-terminal domain of pUL89	460	X
16463	Backbone and side-chain 1H, 13C and 15N resonance assignments of LEN, a human immunoglobulin kIV light-chain variable domain	1214	X
16464	Structural tightening and interdomain communication in the catalytic cycle of phosphoglycerate kinase	1775	X
16465	CALMODULIN WRAPS AROUND ITS BINDING DOMAIN IN THE PLASMA MEMBRANE CA2+ PUMP ANCHORED BY A NOVEL 18-1 MOTIF	2177	X
16466	Solution structure and functional characterization of human plasminogen kringle 5	564	X
16467	The Solution structure of the eTAFH domain of AML1-ETO complexed with HEB peptide	1324	X
16468	High-resolution solution structure of the ASIC1a blocker PcTX1	476	X
16470	Backbone 1H, 13C, and 15N Chemical Shift Assignments for ShcA PTB Domain	570	X
16471	Backbone 1H, 13C, and 15N Chemical Shift Assignments for IQGAP1 (401-533)	467	X
16472	NMR Solution Structure of SH2 Domain of the Human Tensin Like C1 Domain Containing Phosphatase (TENC1)	1213	X
16473	Solution structure of zinc-substituted rubredoxin B (Rv3250c) from Mycobacterium tuberculosis. Seattle Structural Genomics Center for Infectious Disease(SSGCID)target MytuD.01635a	727	X
16475	Assignment of 1H, 13C and 15N backbone resonances of Escherichia coli LpxC bound to L-161,240	1625	X
16476	Solution structure of protein Atu0922 from A. tumefaciens. Northeast Structural Genomics Consortium target AtT13. Ontario Center for Structural Proteomics target ATC0905.	1465	X
16477	Solution structure of the transmembrane proximal region of the hepatis C virus E1 glycoprotein.	205	X
16478	Solution structure of UBA domain of XIAP	1306	X
16479	1H and 13C resonance assignments of a guanine sensing riboswitch's terminator hairpin	209			X
16480	NMR solution structure of double module LA45 of LDLR	997	X
16482	Solution Structure of complement repeat CR17 from LRP-1	486	X
16483	Fusion construct of CR17 from LRP-1 and ApoE residues 130-149	1112	X
16484	NMR structure of CIP75 UBA domain	599	X
16485	Solution structure of the THAP zinc finger of THAP1 in complex with its DNA target	1337	X	X
16486	Solution NMR structure of the ACT domain from GTP pyrophosphokinase of Chlorobium tepidum. Northeast Structural Genomics Consortium Target CtR148A	1092	X
16487	Backbone 1H, 15N and 13C chemical shift assignments for HCV-1b Core+1/S polypeptide.	253	X
16489	NMR structure of pep46 from the infectious bursal disease virus (IBDV) in CD3OH/CDCl3 (1/1)	292	X
16490	Solution structure of protein sf3929 from Shigella flexneri 2a. Northeast Structural Genomics Consortium target SfR81/Ontario Center for Structural Proteomics Target sf3929	1069	X
16491	Solution structure of peptidyl-prolyl cis-trans isomerase from Burkholderia pseudomallei complexed with Cycloheximide-N-ethylethanoate. Seattle Structure Genomics Center for Infectious Disease (SSGCID)	1201	X
16492	The Structure of Anti-TRAP	628	X
16493	Backbone and side chain 1H chemical shift assignments for acidic fibrobast growth factor bound to inositol hexasulfate	873	X
16494	Backbone and side chain 1H chemical shift assignments for acidic fibrobast growth factor	848	X
16495	Solution Structure of PYD peptide from ErbB2	100	X
16496	PLATELET INTEGRIN ALFAIIB-BETA3 TRANSMEMBRANE- CYTOPLASMIC HETEROCOMPLEX	1528	X
16497	1H, 13C, and 15N Chemical Shift Assignments for the Integrin AlphaIIb-Beta3 Transmembrane Complex	736	X
16498	Solution NMR structure of CLOLEP_01837 (fragment 61-160) from Clostridium leptum. Northeast Structural Genomics Consortium Target QlR8A.	1334	X
16499	(1-77)Apomyoglobin	379	X
16500	(1-119)Apomyoglobin	565	X
16501	(1-153)Apomyoglobin	686	X
16502	Backbone and side chain 1H chemical shift assignments for acidic fibrobast growth factor bound to 1,3,6-naphthalenetrisulfonate	790	X
16503	Ribonuclease A in 40% acetic acid and 8M urea pH 2	1182	X
16504	Human cannabinoid receptor 1 - helix 7/8 peptide	260	X
16505	NMR structure of the octarepeat region of prion protein bound to pentosan polysulfate	471	X
16506	Back bone chemical shift assignments of the acyl-intermediates of fatty acid synthesis pathway of P. falciparum	278	X
16507	NMR structure of mouse Par3-PDZ3 in complex with VE-Cadherin C-terminus	1477	X
16508	NMR chemical shift assignments of lipid-bound synaptobrevin	1179	X
16509	Complement Repeats 16 17 and 18 from LRP-1	395	X
16510	The solution structure of the first PHD finger of autoimmune regulator in complex with non-modified histone H3 tail reveals the antagonistic role of H3R2 methylation	790	X
16511	A Doppel alpha-helix Peptide Fragment Mimics the Copper(II) Interactions with the whole Protein	159	X
16512	NMR chemical shift of synaptobrevin fragment 60-116	406	X
16514	NMR chemical shifts of soluble synaptobrevin (1-96) in buffer and in DPC micelle	891	X
16515	Solution structure of mouse Par-3 PDZ2 (residues 450-558)	1136	X
16516	Backbone and 13Cb chemical shifts for human AP endonuclease 1 (APE1) residues 39-318	1240	X
16517	Solution structure of an arsenate reductase (ArsC) related protein from Brucella melitensis. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target BrabA.00007.a.	1409	X
16518	Backbone resonance assignments for oxidised Trypanosoma cruzi glutathione peroxidase	945	X
16519	Solution structure of human SDF1-alpha H25R	910	X
16520	Solution structure of humar Par-3b PDZ2 (residues 451-549)	1108	X
16521	NMR solution structure of CV_2116 from Chromobacterium violaceum.Northeast Structural Genomics Consortium Target CvT4(1-82)	1047	X
16522	A Doppel alpha-helix Peptide Fragment Mimics the Copper(II) Interactions with the whole Protein	314	X
16523	Backbone 1H, 13C, and 15N Chemical Shift Assignments and heteronuclear NOEs for pfColA	1212	X
16524	NMR solution structures of hexanoyl-ACP from the Streptomyces coelicolor Fatty Acid Synthase	918	X
16525	NMR solution structures of 3-oxooctanyl-ACP from Streptomyces coelicolor Fatty Acid Synthase	918	X
16526	NMR solution structures of 3-hydroxyoctanoyl-ACP from Streptomyces coelicolor Fatty Acid Synthase	901	X
16527	NMR solution structures of 2-octenoyl-ACP from Streptomyces coelicolor Fatty Acid Synthase	917	X
16528	NMR solution structures of octanoyl-ACP from Streptomyces coelicolor Fatty Acid Synthase	912	X
16529	Back bone chemical shift assignments of the octanoyl-ACP of P. falciparum fatty acid synthesis pathway	282	X
16530	Back bone chemical shift assignments of the decanoyl-ACP of P. falciparum fatty acid synthesis pathway	273	X
16531	Back bone chemical shift assignments of the dodecanoyl-ACP of P. falciparum fatty acid synthesis pathway	280	X
16532	Back bone chemical shift assignments of the tetradecanoyl-ACP of P. falciparum fatty acid synthesis pathway	273	X
16533	Back bone chemical shift assignments of the hexadecanoyl-ACP of P. falciparum fatty acid synthesis pathway	138	X
16534	DICER LIKE protein	845	X
16536	Structure of the E1064A mutant of the N-domain of Wilson Disease Associated Protein	1529	X
16537	Backbone assignment of the 26 kDa neuron-specific ubiquitin carboxyl-terminal hydrolase L1 (UCH-L1)	1095	X
16538	15N, 13C and 1H Resonance Assignments of the Middle MA-3 Domain of the Tumour Suppressor Protein Pdcd4	1907	X
16539	Solution structure of nasonin-1	185	X
16540	Solution structure of nasonin-1M	193	X
16541	Assignment of the Orphan Nuclear Receptor Nurr1 by NMR	957	X
16542	15N, 13C and 1H Backbone Resonance Assignments for the Complete Tandem MA-3 Region of the Tumour Suppressor Protein Pdcd4	1181	X
16543	Backbone 1H and 15N Chemical Shifts for Disordered alpha-Synuclein	266	X
16544	RECQL4 AMINO-TERMINAL DOMAIN	672	X
16545	Solution NMR structure of protein CV0237 from Chromobacterium violaceum. Northeast Structural Genomics Consortium (NESG) target CvT1.	869	X
16546	Backbone 1H and 15N Chemical Shifts for Disordered A30P alpha-Synuclein	264	X
16547	Backbone 1H and 15N Chemical Shifts for Disordered E46K alpha-Synuclein	266	X
16548	Backbone 1H and 15N Chemical Shifts for Disordered A53T alpha-Synuclein	266	X
16549	Solution NMR structure of the Mus81 N-terminal HhH. Northeast Structural Genomics Consortium target MmT1A	855	X
16550	Specific motifs of the V-ATPase a2-subunit isoform interact with catalytic and regulatory domains of ARNO	156	X
16551	Specific motifs of the V-ATPase a2-subunit isoform interact with catalytic and regulatory domains of ARNO	172	X
16555	1H, 15N and 13C assignments of the dimeric C-terminal domain of HIV-1 capsid protein	931	X
16556	Solution NMR structure of Streptomyces coelicolor SCO3027 modelled with Zn+2 bound. Northeast Structural Genomics Consortium Target RR58.	669	X
16557	Solution Structure Of Protein SOS-response transcriptional repressor, LexA From Eubacterium rectale. Northeast Structural Genomics Consortium Target ErR9A	981	X
16558	MAGI-1 PDZ1	1569	X
16559	MAGI-1 PDZ1 / E6CT	1421	X
16560	Solution NMR Structure of uncharacterized protein from gene locus NE0665 of Nitrosomonas europaea. Northeast Structural Genomics Target NeR103A	1135	X
16561	Solution NMR structure of a Bacterial Ig-like (Big_3) domain from Bacillus cereus. Northeast Structural Genomics Consortium target BcR147A.	1187	X
16562	SOLUTION NMR STRUCTURE OF DE NOVO DESIGNED ROSSMANN 2x2 FOLD PROTEIN, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET OR16	1430	X
16563	Solution NMR structure of Lin0431 protein from Listeria innocua. Northeast Structural Genomics Consortium Target LkR112	1372	X
16564	NMR Structure of Agrobacterium tumefaciens protein Atu1219: Northeast Structural Genomics Consortium target AtT14	1164	X
16565	apo-WT yeast Triosephosphate Isomerase (TIM)	629	X
16566	D-G3P-bound WT yeast Triosephosphate Isomerase (TIM)	316	X
16567	1H, 13C, and 15N chemical shift assignments for the RNA recognition motif of Nab3	637	X
16568	Solution Structure of Domain IV from the YbbR family protein of Desulfitobacterium hafniense	979	X
16569	Solution NMR structure of the N-terminal domain of cg2496 protein from Corynebacterium glutamicum. Northeast Structural Genomics Consortium Target CgR26A	1637	X
16570	NMR Structure of YbbR family protein Dhaf_0833 (residues 32-118) from Desulfitobacterium hafniense DCB-2: Northeast Structural Genomics Consortium target DhR29B	1165	X
16571	NMR assignments of the DNA binding domain of ML4 protein from Mesorhizobium loti	1069	X
16572	NMR solution structure of Lamin-B1 protein from Home sapiens: Northeast Structural Genomics Consortium target, HR5546A(438-548)	1356	X
16574	HUMAN NEDD4 3RD WW DOMAIN COMPLEX WITH THE HUMAN T-CELL LEUKEMIA VIRUS 1 GAG-PRO POLIPROTEIN DERIVED PEPTIDE SDPQIPPPYVEP	567	X
16575	HUMAN NEDD4 3RD WW DOMAIN COMPLEX WITH EBOLA ZAIRE VIRUS MATRIX PROTEIN VP40 DERIVED PEPTIDE ILPTAPPEYMEA	443	X
16576	Solution Structure Of Protein BH0266 From Bacillus halodurans. Northeast Structural Genomics Consortium Target BhR97a	1234	X
16577	Backbone Chemical Shift Assignments of Mouse HOXA13 DNA Binding Domain in Complex with DNA Duplex	423	X	X
16578	Solution NMR structure of the apo form of a ribonuclease H domain of protein DSY1790 from Desulfitobacterium hafniense, Northeast Structural Genomics target DhR1A.	1364	X
16585	Solution structure of SNase140	1679	X
16586	Backbone assignment of 3F5 heavy chain antibody fragment in its free form	370	X
16587	Chemical shifts of a native-like folding intermediate of beta2-microglobulin	463	X
16588	NMR Assignment of the C-terminal Domain of yeast Aha-1	629	X
16589	peptide_ptha	295	X
16590	protein x	694	X
16591	1H and 15N chemical shifts for the immune inhibitory receptor LAIR-1 collagen binding domain	664	X
16592	Solution NMR structure of a domain from BT9727_4915 from Bacillus thuringiensis, Northeast Structural Genomics Consortium Target BuR95A	516	X
16593	1H, 15N and 13C chemical shifts for the apo form of F98N-flavodoxin from Anabaena PCC7119	713	X
16594	Solution structure of DnaK suppressor protein from Agrobacterium tumefaciens C58. Northeast Structural Genomics Consortium target AtT12/Ontario Center for Structural Proteomics Target atc0888	1320	X
16595	HIV Fusion Peptide in Cholesterol-Rich Membranes	70	X
16596	First PBZ domain of human APLF protein	937	X
16597	Influenza Virus Fusion Peptide in Membranes without Cholesterol at pH 5.0	63	X
16598	1H, 13C and 15N backbone resonance assignments of cTEM-17m, a TEM-1/PSE-4 class A beta-lactamases chimera	1136	X
16599	Backbone resonance assignments of clytin	1293	X
16600	Backbone resonance assignments of cgGFP	1182	X
16601	kkgf	239	X
16602	1H, 13C and 15N Chemical Shift Assignment Assignment of Human Membrane Protein KCNE3 in LMPC micelles	463	X
16603	Solution Structure of apo-IscU	1321	X
16604	1H, 13C, 15N chemical shift sssignments of the artificial neomycin-sensing riboswitch in complex with tobramycin	458			X
16605	MAUROCALCINE IN D CONFIGURATION FROM SCORPIO MAURUS PALMATUS	254	X
16606	SOLUTION STRUCTURE OF THE KI O18/O8 Y87H IMMUNOGLOBULIN LIGHT CHAIN VARIABLE DOMAIN	2610	X
16607	SOLUTION STRUCTURE OF THE AL-09 H87Y IMMUNOGLOBULIN LIGHT CHAIN VARIABLE DOMAIN	2624	X
16608	NMR Structure of Proinsulin	922	X
16609	1H, 13C, 15N chemical shift sssignments of the artificial neomycin-sensing riboswitch in complex with ribostamycin	490			X
16610	Solution structure of the N-terminal domain (residues 1-111) of Brugia malayi asparaginyl-tRNA synthetase	1431	X
16611	Phosphorylation of SUMO-interacting motif by CK2 enhances Daxx SUMO binding activity.	1410	X
16612	Solid-state NMR structure of the M2 transmembrane peptide of the influenza A virus in DMPC lipid bilayers bound to deuterated amantadine	36	X
16613	SARS Coronavirus-unique domain (SUD): Three-domain molecular architecture in solution and RNA binding	2283	X
16614	1H, 13C and 15N resonance assignments of a highly-soluble murine interleukin-3 analogue with wild-type bioactivity	1376	X
16615	Backbone assignment of E. coli HU protein	391	X
16616	assignment for the I214V variant of rabbit prion protein (91-228)	1375	X
16617	Solution structure of Avian Thymic Hormone	1267	X
16618	NMR structure of the J-domain (residues 2-72) in the Escherichia coli CbpA	885	X
16619	Sequence-specific 1H, 13C, and 15N resonance assignments of Diva (Boo), an apoptosis regulator of the Bcl-2 family	1957	X
16620	Solution NMR structure of zinc binding N-terminal domain of ubiquitin-protein ligase E3A from Homo Sapience. Northeast Structural Genomics Consortium (NESG) target HR3662A.	709	X
16621	1H, 13C, and 15N chemical shift assignment of KCNE3 in isotropic bicelles	475	X
16622	Bergerac-SH3: frustation induced by stabilizing the folding nucleus	897	X
16623	The U-box domain of mus musculus E4B	841	X
16624	Solution Structure of an Acyl Carrier Protein Domain from Fungal Type I Polyketide Synthase	1059	X
16626	Backbone and stereospecific beta-sidechain assignments of 1H, 13C and 15N for Ubiquitin Unfolded in 8M Urea, pH2.5.	549	X
16627	Backbone and stereospecific beta-sidechain assignments of 1H, 13C and 15N for Protein G Unfolded in 7.4M Urea, pH 2.0.	426	X
16628	Sequence-specific 1H, 13C and 15N resonance assignments of the nucleotide-free wildtype cyclic nucleotide binding domain from a cyclic nucleotide-activated K+ channel	1604	X
16629	solution structure of Helicobacter pylori SlyD	1899	X
16630	1H, 13C and 15N NMR assignments of StnII-Y111N, a mutant of the sea anemone actinoporin Sticholysin II	2169	X
16632	Kalirin DH1 NMR structure	4978	X
16633	Solution structure of Bv8	443	X
16634	Backbone Dynamics and Global Effects of an Activity Enhancing Mutation in Minimized Mtu RecA Inteins	264	X
16635	Solution structure of the N-terminal domain of Bacillus subtilis delta subunit of RNA polymerase	1272	X
16636	NMR solution structure of the DNA binding domain of Competence protein A	758	X
16637	Solution Structure of extended PDZ2 Domain from NHERF1 (150-270)	1463	X
16638	Solution Structure of human sodium/ hydrogen exchange regulatory factor 1(150-358).	2173	X
16639	Structure of a complex between domain V of beta2-glycoprotein I and the fourth ligand-binding module from LDLR determined with Haddock.	208	X
16640	Solution NMR Structure of 26S protease regulatory subunit 8 from H.sapiens, Northeast Structural Genomics Consortium Target Target HR3102A	907	X
16641	RDC refined solution structure of the first SH3 domain of CD2AP	294	X
16642	High resolution structure of the second SH3 domain of CD2AP	428	X
16643	RDC refined high resolution structure of the third SH3 domain of CD2AP	403	X
16646	Solution structure of the RBD1,2 domains from human nucleolin	1996	X
16647	Solution NMR structure of SH3 domain from CPF_0587 (fragment 415-479) from Clostridium perfringens. Northeast Structural Genomics Consortium (NESG) Target CpR74A.	865	X
16648	Solution NMR Structure of a Conserved Hypothetical Membrane Lipoprotein Obtained from Ureaplasma parvum: Northeast Structural Genomics Consortium Target UuR17A (139-239)	1403	X
16649	Solution NMR structure of the PCP_red domain of light-independent protochlorophyllide reductase subunit B from Chlorobium tepidum. Northeast Structural Genomics Consortium Target CtR69A	732	X
16652	Solution NMR Structure of asl3597 from Nostoc sp. PCC7120. Northeast Structural Genomics Consortium Target ID Nsr244.	1043	X
16653	1H, 13C and 15N resonance assignment of the PDZ domain of HtrA from Streptococcus pneumonia	1291	X
16654	Solution structure of the human mitochondrial tRNAMet ASL containing the 5-formylcytidine modification in position 34	130			X
16655	Solution structure of the Human Mitochondrial tRNAMet	126			X
16656	Solution NMR structure of the Q251Q8_DESHY(21-82) protein from Desulfitobacterium Hafniense. Northeast Structural Genomics Consortium Target DhR8C.	840	X
16657	Assignment and structural characterization of intrinsically disordered CDK inhibitor Sic1 from yeast	512	X
16658	Heterodimeric association of Transmembrane domains of ErbB1 and ErbB2 receptors Enabling Kinase Activation	1090	X
16659	Assignment and structural characterization of intrinsically disordered CDK inhibitor phosphoSic1 from yeast	321	X
16660	SOLUTION CONFORMATION OF SUBSTANCE P IN WATER COMPLEXED WITH NK1R	88	X
16661	Pf ACP with Transit Peptide	476	X
16662	Solution NMR structure of apo Sterol Carrier Protein - 2 from Aedes aegypti (AeSCP-2)	1289	X
16663	NMR STRUCTURE OF HUMAN INSULIN MUTANT GLY-B8-D-ALA, HIS-B10-2 ASP PRO-B28-LYS, LYS-B29-PRO, 20 STRUCTURES	343	X
16664	Backbone 1H, 13C and 15N resonance assignments for lysozyme from bacteriophage lambda	768	X
16665	Solution NMR structure of Sterol Carrier Protein - 2 from Aedes aegypti (AeSCP-2) complex with C16 fatty acid (palmitate)	1275	X
16666	Sequence-specific 1H, 15N and 13C resonance assignments of Sugarcane defensin 5 (Sd5).	784	X
16667	Structure of the insecticidal toxin TaITX-1	552	X
16668	GTPase RhoA-GDP	901	X
16669	GTPase RhoA GTPgS	548	X
16670	NMR structure of the apoptosis- and inflammation-related NALP1 pyrin domain	987	X
16671	Mechanism for the selective interaction of C-terminal EH-domain proteins with specific NPF-containing partners	1280	X
16672	NMR structures of TM domain of the n-Acetylcholine receptor b2 subunit	1558	X
16673	backbone resonance assignment for the class A beta-lactamase Bacillus licheniformis BS3	1293	X
16674	NMR Solution structures of fully reduced cytochrome c3 from Desulfovibrio desulfuricans ATCC 2777	556	X
16675	The NMR structure of protein-glutaminase from Chryseobacterium proteolyticum	2249	X
16676	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Oryctin	683	X
16677	Inter-molecular interactions in a 44 kDa interferon-receptor complex detected by asymmetric back-protonation and 2D NOESY	1950	X
16678	1H, 13C and 15N Chemical Shift Assignments for Sensory Rhodopsin II	2773	X
16679	1H, 13C and 15N assignment of the C terminal domain of GNA2132 from Neisseria meningitidis	1477	X
16680	Solution structure of human stem cell transcription factor Nanog	1128	X
16681	Solution NMR Structure of the SH3 Domain from the p85beta subunit of Phosphatidylinositol 3-kinase from H.sapiens. Northeast Structural Genomics Consortium Target HR5531E.	966	X
16682	Lipocalin Q83 is a Siderocalin	1349	X
16683	RRM domain of mRNA export adaptor REF2-I bound to HSV-1 ICP27 peptide	1835	X
16684	Structural homology between the C-terminal domain of the PapC usher and its plug	895	X
16685	NMR resonance assignment of the major extracytoplasmic domain of MreC from Bacillus subtilis	1901	X
16686	Solution NMR structure of mucin-binding domain of protein lmo0835 from Listeria monocytogenes. Northeast Structural Genomics Consortium Target LmR64A	1218	X
16687	1H, 13C and 15N assignments of the dimeric regulatory subunit (ilvN) of E.coli AHAS I	1132	X
16688	Solution NMR structure of the CPE1231(468-535) protein from Clostridium perfringens. Northeast Structural Genomics Consortium Target CpR82B.	912	X
16689	Backbone and side chain 1H, 15N and 13C assignments for a thiol-disulphide oxidoreductase from the Antarctic bacterium Pseudoalteromonas haloplanktis TAC125	2456	X
16690	Backbone 1H, 13C and 15N chemical shift assignments for the prolyl isomerase Ess1 from Candida albicans	828	X
16691	Solution NMR Structure of Probable 30S Ribosomal Protein PSRP-3 (Ycf65-like protein) from Synechocystis sp. (strain PCC 6803), Northeast Structural Genomics Consortium Target Target SgR46	1273	X
16692	Solution NMR structure of a domain of protein A6KY75 from Bacteroides vulgatus, Northeast Structural Genomics target BvR106A	842	X
16693	Solution Structure of a Novel hKv1.1 inhibiting scorpion toxin from Mesibuthus tamulus	290	X
16694	Solution Structure of the Second Bromodomain of Human Polybromo in complex with an acetylated peptide from Histone 3	1339	X
16695	Backbone Assignments for the HIV-1 Integrase Core Domain (residues 50-212)	805	X
16696	HSV-1 ICP27 (REF-interation) peptide backbone assignment in free form	226	X
16697	RRM domain of mRNA export adaptor REF2-I backbone assignment	551	X
16698	HVS ORF57 8-120 backbone assignment	1105	X
16699	1H Chemical Shift Assignments for gH617-644 fusion peptide from HSV-1 gH protein	207	X
16700	1H Chemical Shift Assignments for gH626-639 fusion peptide from HSV-1 gH protein	94	X
16701	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the C-terminal domain of Stt3p	1187	X
16703	SPI2	393	X
16704	SPI2 (T7Y)	250	X
16705	SPI2 (T7A)	369	X
16706	1H, 13C, and 15N chemical shift assignments for H2H2, a mini prion protein	685	X
16707	Spatial structure of Lch-alpha peptide from two-component lantibiotic Lichenicidin VK21	311	X
16708	1H,13C,15N assignments of RNA recognition motifs 1 and 2 of BRUNOL-3	2056	X
16709	Spatial structure of Lch-beta peptide from two-component lantibiotic system Lichenicidin VK21	254	X
16710	Backbone and C-beta chemical shifts of Spider Roll, NESG target OR24	249	X
16711	NMR structure of the protein NP_415897.1	1340	X
16712	1H, 13C and 15N backbone and side-chain chemical shift assignments for oxidized desulthioredoxin	1364	X
16713	1H, 13C and 15N backbone and side-chain chemical shift assignments for reduced desulthioredoxin	1371	X
16714	Structure of a human Xist RNA A-repeat AUCG tetraloop hairpin essential for X-inactivation	282			X
16715	1H, 13C, and 15N Chemical Shift Assignments for human Vaccinia-Related Kinase-1 Lysozyme	3545	X
16716	Backbone chemical shifts of NI3C_Mut5 DARPin	594	X
16717	Backbone chemical shifts of NI3C DARPin	578	X
16718	Backbone chemical shifts of NI2C DARPin	510	X
16719	Solution structure of Cytotoxic T-Lymphocyte Antigent-2(CTLA-2) like protein, Crammer	639	X
16720	Horse prion protein	921	X
16721	Solution structure of BRD1 PHD1 finger	673	X
16722	mPrP_D167S	1291	X
16723	mPrP_D1567D_N173K	1297	X
16726	Resonance assignment of myristoylated Neuronal Calcium Sensor 1(NCS1) in membrane bound form.	1248	X
16727	The solution structure of the monomeric antimicrobial peptide culbertcidin	319	X
16729	NMR assignment of Salmonella typhimurium tip protein SipD	1340	X
16731	Solution Structure of a putative disulphide-isomerase from Bacteroides thetaiotaomicron	1561	X
16732	NMR structure of the PASTA domain 1 and 2 of Mycobacterium tuberculosis of PknB	1446	X
16733	NMR structure of the PASTA domain 2 and 3 of Mycobacterium tuberculosis of PknB	1422	X
16734	NMR structure of the PASTA domain 3 and 4 of Mycobacterium tuberculosis of PknB	1416	X
16735	NMR resonance assignment of the apo C-terminal polypeptide of the Anthrax Lethal Factor catalytic domain	440	X
16736	NMR STRUCTURE OF P62 PB1 DIMER DETERMINED BASED ON PCS	384	X
16737	1H,13C and 15N chemical shift assignment for NMB1343 apoprotein	1767	X
16738	solution structure of human vaccinia related kinase1(VRK1)	3545	X
16739	1H, 13C, and 15N Chemical Shift Assignments for plectasin	397	X
16740	Amide assignments for Paracoccus denitrificans amicyanin-ZnII.	194	X
16741	Backbone assignments for Paracoccus denitrificans amicyanin-CuI.	479	X
16742	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Unfolded Bovine Pancreatic Ribonuclease A	429	X
16743	Three dimensional structure of HuPrP(90-231 M129 Q212P)	1699	X
16744	Structure and identification of ADP-ribose recognition motifs of APLF and role in the DNA damage response	1005	X
16745	1H and 13C Chemical Shift Assignments for Antimicrobial Peptide Sm-AMP-1.1a	280	X
16746	Chemical shift assignment of GmR58A from Geobacter metallireducens. Northeast Structural Genomics Consortium Target GmR58A	1277	X
16747	Glycocin A	416	X
16748	Complete 1H, 13C, and 15N Chemical Shift Assignments for AafA-dsc	1687	X
16749	Backbone Assignments of the PX Domain of Noxo1b	662	X
16750	backbone chemical shifts assignments of acid-denatured c-src SH3 with increasing urea concentration	1506	X
16764	HALOTHANE BINDS TO DRUGGABLE SITES IN CALCIUM-CALMODULIN: Solution Structure of halothane-CaM N-terminal domain	1797	X
16766	Solution Structure of the human BLM HRDC domain	1085	X
16767	Human Regenerating Gene Type IV (REG IV) PROTEIN, P91S mutant	1473	X
16768	EGF	494	X
16769	Solution structure of the par toxin Fst in DPC micelles	193	X
16770	NMR solution structure of a soluble PrgI mutant from Salmonella Typhimurium	992	X
16771	Integrin beta3 subunit in a disulfide linked alphaIIb-beta3 cytosolic domain	672	X
16772	SOLUTION STRUCTURE OF CI-MPR ligand-free domain 5	1608	X
16773	SOLUTION STRUCTURE OF CI-MPR domain 5 bound to N-acetylglucosaminyl 6-phosphomethylmannoside	1620	X
16774	Solution structure of the Mycobacterium tuberculosis protein Rv0543c, a member of the DUF3349 superfamily. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target MytuD.17112.a	1183	X
16775	Mesencephalic astrocyte-derived neurotrophic factor (MANF)	1847	X
16776	C-terminal domain of mesencephalic astrocyte-derived neurotrophic factor (MANF)	749	X
16777	nmr chemical shift of hahellin in 8 M urea	618	X
16778	Solution structure of the CBX7 chromodomain in complex with a H3K27me2 peptide	1001	X
16779	Backbone 1H, 13C, and 15N Chemical Shift Assignments for LMO2(LIM2)-Ldb1(LID)	1254	X
16780	1H, 15N, 13C resonance assignments for CobR	893	X
16781	Backbone chemical shift assignments for the microtubule binding domain of the Dictyostelium discoideum dynein heavy chain	596	X
16782	Solution NMR structure of Photosystem II reaction center Psb28 protein from Synechocystis sp.(strain PCC 6803), Northeast Structural Genomics Consortium Target SgR171	1451	X
16783	Smr in bicelles	416	X
16784	solution structure of conotoxin mr3c	91	X
16785	solution structure of cis-4-hydroxyproline contained conotoxin cis-mr3c	86	X
16786	solution structure of 4-hydroxyproline contained cis-conomarphin	89	X
16787	NMR assignments for Thermus thermophilus Rieske protein at pH 5.2 at the reduced state	597	X
16788	Solution structure of NusE:NusG-CTD complex	1458	X
16789	Solution NMR structure of human ubiquitin specific protease Usp7 UBL domain (residues 537-664). NESG target hr4395c/ SGC-Toronto	1513	X
16790	Solution NMR structure of uncharacterized protein CV0863 from Chromobacterium violaceum. NESG target CvT3. OCSP target CV0863.	1353	X
16791	solution NMR structure of yaiA from Escherichia Eoli. Northeast Structural Genomics Target ER244	784	X
16792	Solution NMR Structure of SAP domain of MKL/myocardin-like protein 1 from H.sapiens, Northeast Structural Genomics Consortium Target Target HR4547E	742	X
16794	NMR Solution Structure of Q7A1E8 protein from Staphylococcus aureus: Northeast Structural Genomics Consortium target: ZR215	840	X
16795	Solution NMR of Putative excisionase from Klebsiella pneumoniae, Northeast Structural Genomics Consortium Target Target KpR49	850	X
16796	Solution NMR structure of the Cdt1 binding domain(CBD) in complex with the MCM6 binding domain (MBD)	1264	X
16797	Structure of the three-Cys2His2 domain of mouse testis zinc finger protein	307	X
16798	1H, 15N and 13C backbone resonance assignments of domain 3 of the non-structural 5A (NS5A) protein from Hepatitis C Virus (JFH-1)	500	X
16799	1H, 15N and 13C backbone resonance assignments of domain 3 of the non-structural 5A (NS5A) protein from Hepatitis C Virus (JFH-1) in presence of 50%TFE	493	X
16800	1H, 15N and 13C backbone resonance assignments of domain 3 of the non-structural 5A (NS5A) protein from Hepatitis C Virus (Con1) in presence of 50%TFE	416	X
16801	Structure of residues 160-235 of putative peptidoglycan binding protein lmo0835 from Listeria monocytogenes: target LmR64B of the Northeast Structural Genomics Consortium	916	X
16802	Solution structure of N-terminal domain of CcmH from Escherichia.coli	962	X
16803	1H, 13C and 15N backbone and side chain resonance assignment of the human RANTES-E66S mutant in a dimeric form	850	X
16804	NMR assignments for Thermus thermophilus Rieske protein at pH 5.2 in oxidized state	598	X
16805	Solution NMR of the specialized acyl carrier protein (RPA2022) from Rhodopseudomonas palustris, Northeast Structural Genomics Consortium Target RpR324	1210	X
16806	Solution NMR Structure of the Slr1183 protein from Synechocystis sp. PCC 6803. Northeast Structural Genomics Consortium Target Target SgR145.	1149	X
16807	Solution NMR Structure of the Holo Form of a Ribonuclease H domain from D.hafniense, Northeast Structural Genomics Consortium Target Target DhR1A	1327	X
16808	Solution NMR Structure of Cyclin-dependent kinase 2-associated protein 1 (CDK2-associated protein 1; oral cancer suppressor Deleted in oral cancer 1, DOC-1) from H.sapiens, Northeast Structural Genomics Consortium Target Target HR3057H	683	X
16809	Ensemble Structures of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase.	3776	X
16810	Solution NMR Structure of the N-terminal domain of protein PG_0361 from P.gingivalis, Northeast Structural Genomics Consortium Target Target PgR37A	1937	X
16811	Solution Structure of Bacillus anthracis Sortase A (SrtA) Transpeptidase	1700	X
16812	data-driven model of MED1:DNA complex	509	X	X
16813	Solution NMR structure of the parkin Ubl domain in complex with the endophilin-A1 SH3 domain	1389	X
16814	Structure of the three-Cys2His2 domain of mouse testis zinc finger protein	304	X
16815	Structure of the three-Cys2His2 domain of mouse testis zinc finger protein	285	X
16816	Solution NMR Structure of SAP domain of MKL/myocardin-like protein 1 from H.sapiens, Northeast Structural Genomics Consortium Target Target HR4547E	742	X
16817	Solution structure of dermcidin-1L, a human antibiotic peptide	344	X
16818	Solution structure of a novel Ubiquitin-binding domain from Human PLAA (PUBD, Gly76-Pro77 trans isomer)	770	X
16819	The solution structure of the dimeric culbertcidin	263	X
16822	Solution structure of Bacillus anthracis dihydrofolate reductase	1368	X
16824	Solution Structure of the GTPase Binding Domain of WASP in Complex with EspFU, an EHEC Effector	1283	X
16831	Solution structure of C-domain of Lsr2	542	X
16832	Structure of C-terminal domain from mtTyrRS of A. nidulans	1477	X
16833	Minimal Constraint Solution NMR Structure of Translationally-controlled tumor protein (TCTP) from C.elegans, Northeast Structural Genomics Consortium Target Target WR73	1275	X
16834	NMR structure of fully methylated GATC site	137		X
16835	The NMR structure of the autophagy-related protein Atg8	1497	X
16837	HAV 3C C24S	808	X
16838	Backbone 1H, 13C, and 15N chemical shift assignments of the extracellular domain of tissue factor	951	X
16839	Solution structure of the human chemokine CCL27	1167	X
16840	1H, 15N and 13C resonance assignment of Darcin, a Major Urinary Protein of the mouse	2169	X
16841	Chemical Shift Assignments of Fibronectin 6FnI1-2FnII7FnI	1669	X
16842	1H and 15N resonance assignments for fully reduced triheme cytochrome PpcA from Geobacter sulfurreducens	506	X
16843	Seeing the Invisible: Structures of Excited Protein States by Relaxation Dispersion NMR	212	X
16845	Cementoin backbone chemical assignment and spin relaxation	159	X
16846	Central B domain of Rv0899 from Mycobacterium tuberculosis	1422	X
16847	Assignments for LC8 bound to a peptide corresponding to residues 233-249 of neuronal Nitric Oxide Synthase	177	X
16848	Solution structure of a novel Ubiquitin-binding domain from Human PLAA (PFUC, Gly76-Pro77 cis isomer).	771	X
16849	NMR Structure of Ni Substitued Desulfovibrio vulgaris Rubredoxin	304	X
16850	Thioredoxin	1152	X
16851	The structure of E-protein activation domain 1 bound to the KIX domain of CBP/p300 elucidates leukemia induction by E2A-PBX1	1206	X
16852	Solution structure of a fully modified 2'-F/2'-OMe siRNA construct	231			X
16853	NMR structure of the transmembrane and cytoplasmic domains of human CD4	926	X
16854	an eye lens fragment from human alpha-crystallin	82	X
16856	Solution Structure of acyl carrier protein from Borrelia burgdorferi, Seattle Structural Genomics Center for Infectious Disease (SSGCID) consortium	1007	X
16857	Human Jagged-1, exon 6	288	X
16858	Solution Structures of the double PHD fingers of human transcriptional protein DPF3b bound to a histone H3 peptide containing acetylation at lysine 14	1297	X
16859	Solution structure of the double PHD (plant homeodomain) fingers of human transcriptional protein DPF3b bound to a histone N-terminal H3 peptide	1301	X
16860	Solution NMR structure of holo acyl carrier protein from Geobacter metallireducens refined with NH RDCs. Northeast Structural Genomics Consortium Target GmR141.	1072	X
16861	Solution structure of the double PHD (plant homeodomain) fingers of human transcriptional protein DPF3b bound to a histone H4 peptide containing acetylation at lysine 16	1279	X
16862	Chemical shift assignments of CaBP1 with 3 Ca2+ bound	1354	X
16863	1H, 13C and 15N backbone and side chain resonance assignments of the N-terminal domain of the histidine kinase inhibitor KipI from Bacillus subtilis	1209	X
16864	Sequence Specific 1H, 13C and 15N backbone resonance assignments of uvi31+ from Chlamydomonas reinhardtii	1006	X
16865	Solution structure of the double PHD (plant homeodomain) fingers of human transcriptional protein DPF3b bound to a histone H4 peptide containing N-terminal acetylation at serine 1	1282	X
16866	VAMP7(1-118):ISOLATED LONGIN DOMAIN	216	X
16867	VAMP7(1-180):CYTOPLASMIC DOMAIN OF VAMP7.	234	X
16868	Solution structure of the aminoterminal domain of E. coli NusA	1495	X
16869	Backbone assignment of the catalytic core of a Y-family DNA polymerase	883	X
16870	1H, 13C, and 15N resonance assignments of the N-terminal domain of human Tubulin Cofactor C	1275	X
16871	Solution structure of the second PDZ domain from human zonula occludens-1: A dimeric form with 3D domain swapping	1043	X
16872	Mcm10 C-terminal DNA binding domain	1025	X
16873	NMR determination of protein pKa values in the solid state	1223	X
16874	The solution structure of rat Lipocalin-type Prostaglandin D Synthase	1617	X
16876	1HN, 1HA, 13CA, 13CB, 13CO and 15N Chemical Shift Assignments for Intrinsically Disordered Dehydrin ERD14	1042	X
16877	Simultaneous recognition of HIV-1 TAR RNA bulge and loop sequences by cyclic peptide mimics of Tat protein	330	X		X
16878	NMR Structure of AIRE PHD Finger	528	X
16879	Chemical shift assignments of the 3rd PDZ domain of protein tyrosine phosphatase basophil like (PTP-BL)	1101	X
16880	Solution Structure of UBM2 of murine Polymerase iota in Complex with Ubiquitin	1469	X
16881	Solution NMR structure of of Streptomyces coelicolor polyketide cyclase SCO5315: Northeast Structural Genomics Consortium target RR365	1821	X
16882	Solution Structure of the Ubiquitin-Binding Motif of Human Polymerase Iota	1232	X
16883	the N-terminal domain of human H-REV107	1434	X
16884	1H, 13C and 15N Chemical Shift assignments for RRM3 of Brunol-3.	1064	X
16885	Solution Structure of UBM1 of murine Polymerase iota in Complex with Ubiquitin	1463	X
16886	NS2 [27-59]	390	X
16887	Backbone 1H, 13C, 15N Chemical Shift Assignments for HIV-2 unmyristoylated matrix protein	1243	X
16888	Solution structure of the HIV-2 myristoylated Matrix protein	1278	X
16889	Solution structure of HIV-2 myrMA bound to di-C4-PI(4,5)P2	1278	X
16890	Structure of G61-101	461	X
16891	Backbone 1H, 13C and 15N Chemical Shift Assignments for the free alpha chain of human haemoglobin	445	X
16892	NS2 [60-99]	297	X
16893	MDM4 binds ligands via an induced fit mechanism in which disordered regions become structured	347	X
16894	MDM4 binds ligands via an induced fit mechanism in which disordered regions become structured	410	X
16895	The solution structure of UBB+1, frameshift mutant of ubiquitin B	1117	X
16897	The solution structure of MTH1821	1118	X
16898	Backbone 1H, 13C and 15N Chemical Shift Assignments for the alpha chain of human haemoglobin bound to alpha-haemoglobin stabilizing protein (AHSP)	344	X
16899	The solution structure of the mutant of UBL domain of UBLCP1, I5M.	978	X
16900	MDM4 binds ligands via an induced fit mechanism in which disordered regions become structured	467	X
16901	Solution structure of the relaxin-like factor	865	X
16902	Backbone 1H, 15N, 13C and ile, leu, val sidechain CH3 Chemical Shift assignments for Aagglutinin-like ALS1 N-terminal domain	1779	X
16904	Backbone assignment of human alpha-synuclein in viscous 2 M glucose solution	652	X
16905	Sma0114	1257	X
16907	The hemagglutinin fusion peptide (H1 subtype) at pH 7.4	246	X
16908	The high resolution structure of Ubiquitin like domain of UBLCP1	900	X
16909	1H, 13C, and 15N Chemical Shift Assignments for IRTKS-SH3 and EspFu-R47 complex	924	X
16910	Assignment of HN,HA,HB,N,CA,CB and C' of the STAS domain of motor protein Prestin (Anion Transporter SLC26A5)	946	X
16911	Chemical Shift Assignments from PfEMP1: Structured Core	1063	X
16912	Delta subunit of RNA polymerase from Bacillus subtilis	2126	X
16913	The solution structure of the squash aspartic acid proteinase inhibitor (SQAPI)	1095	X
16914	Solution strcture of UBX domain of human UBXD2 protein	925	X
16915	Human Insulin Mutant A22Gly-B31Lys-B32Arg	351	X
16916	Backbone 1H,13C, and 15N assignments of Streptococcus pneumoniae mevalonate diphosphate decarboxylase (spMDD) in complex with mevalonate 5-diphosphate (DPM) and AMPPCP	1415	X
16917	Receiver domain of sensor histidine kinase CKI1RD of Arabidopsis thaliana	631	X
16918	Mg(2+)-bound receiver domain of sensor histidine kinase CKI1RD of Arabidopsis thaliana	647	X
16919	Backbone 1H,13C, and 15N assignments of Streptococcus pneumoniae mevalonate diphosphate decarboxylase (spMDD) in apo-state	1368	X
16920	NMR structure of human Tra2beta1 RRM in complex with AAGAAC RNA	1025	X		X
16921	1H, 13C, 15N chemical shifts for the bacterial cell division regulator MinE.	1112	X
16922	Backbone structure of the membrane domain of E. coli histidine kinase receptor KdpD	461	X
16923	Solution Structure of Smurf2 WW2 and WW3 bound to Smad7 PY peptide Smad7 PY motif containing peptide	1217	X
16925	Ligand Induced Changes in FKBP12 ps-ns Dynamics: The Free Enzyme	631	X
16926	NMR Structure of Escherichia coli BamE, a Lipoprotein Component of the beta-Barrel Assembly Machinery Complex	872	X
16927	Solution structure of SuR18C from Streptococcus thermophilus. Northeast Structural Genomics Consortium Target SuR18C	1099	X
16928	1H, 13C and 15N chemical shift assignment of the N-terminal domain of the voltage-gated potassium channel-hERG	1265	X
16929	NMR structure and calcium-binding properties of the tellurite resistance protein TerD from Klebsiella pneumoniae	2218	X
16930	Chemical shift assignments of the Talin F2 domain (residues 196-309)	569	X
16931	Ligand Induced Changes in FKBP12 ps-ns Dynamics: The Rapamycin-Bound Enzyme	619	X
16932	Chemical shift assignments of the Talin F2F3 domain (residues 196-405)	603	X
16933	Ligand Induced Changes in FKBP12 ps-ns Dynamics: FKBP12 in complex with rapamycin and the FRB domain from mTOR	373	X
16934	Solution NMR structure of the PBS linker domain of phycobilisome linker polypeptide from Anabaena sp. Northeast Structural Genomics Consortium Target NsR123E	1905	X
16935	Solution structure of the PECAM-1 cytoplasmic tail with DPC	479	X
16936	Solution structure and dynamic analysis of chicken MBD2 methyl binding domain bound to a target methylated DNA sequence	959	X	X
16937	apoWCBD4-6	1121	X
16939	WT alpha-synuclein fibrils	314	X
16940	Backbone 1H, 13C, 15N assignments for hirugen bound PPACKed thrombin	1031	X
16941	Recognition of HIV TAR RNA by peptide mimetic of Tat protein	275	X		X
16942	Solution NMR Structure () from B.subtilis, Northeast Structural Genomics Consortium Target Target SR518	1539	X
16943	Solution structure of the leader sequence of the patellamide precursor peptide, PatE1-34	242	X
16944	Chemical shift assignment of CpR82G from Clostridium perfringens. North East Structural Genomics Consortium Target CpR82g.	647	X
16945	solution structure of Ca-free chicken parvalbumin 3 (CPV3)	1300	X
16946	15N, 13C and 1H Resonance Assignments of the PAS domain of hERG (KV11.1)	1536	X
16947	Backbone structure of the membrane domain of E. coli histidine kinase receptor ArcB	916	X
16948	Resonance assignments of GTPase effector domain of Dynamin in the aprotic solvent deuterated Dimethyl Sulfoxide	1157	X
16949	PDZ3 of ZO-1	389	X
16950	The Structure of RNA Internal Loops with Tandem AG Pairs: 5'AAGU/3'UGAA	147			X
16951	The Structure of RNA Internal Loops with Tandem AG Pairs: 5'GAGC/3'CGAG	167			X
16952	The Structure of RNA Internal Loops with Tandem AG Pairs: 5'UAGA/3'AGAU	139			X
16953	The Structure of RNA Internal Loops with Tandem AG Pairs: 5'UAGG/3'GGAU	108			X
16954	Structure of the AML1-ETO Nervy Domain - PKA(RIIa) complex and its contribution to AML1-ETO activity	1501	X
16955	solution structure of calcium-bound CPV3	1294	X
16956	NMR assignments of 1H, 13C, 15N resonance in C-terminal subunit from Azotobacter vinelandii mannronan C5-epimerase 6 (AlgE6R3)	1905	X
16957	Solution structure of the voltage-sensing domain of KvAP	2327	X
16958	1H, 13C and 15N chemical shift assignments for ZCCHC9	1376	X
16959	Chemical shift assignments of the Talin F1F2 double domain (residues 86-303 (delta D139-D168))	928	X
16960	Solution structure of GxTX-1E	206	X
16961	Solution NMR structure of Dsy0195(21-82) protein from Desulfitobacterium Hafniense. Northeast Structural Genomics Consortium Target DhR8C.	840	X
16963	Structure of the scorpion toxin U1-Liotoxin-Lw1a	253	X
16964	Solid-state NMR assignment of the globular domain of HET-s(1-227) prion protein in microcrystalline form.	1022	X
16965	Backbone NMR assignment of the globular domain of HET-s(1-227) prion protein.	555	X
16966	Insights into protein-protein and enzyme-substrate interactions in modular polyketide synthases	710	X
16967	Solution structure of MAST2-PDZ complexed with the C-terminus of PTEN	1166	X
16968	The Solution Structure of a Conformationally Restricted Fully Active Derivative of the Human Relaxin-like Factor (RLF)	677	X
16969	Structural basis for homodimerization of the Src-associated during mitosis, 68 kD protein (Sam68) Qua1 domain	508	X
16970	Solution structure of the Bem1p SH3-CI domain from L.elongisporus in complex with Ste20p peptide	1620	X
16971	backbone and sidechain 1H, 13C, and 15N assignments for F-plasmid TraI 381-569	1999	X
16977	Resonance assignment of nsp7a from arterivirus	1445	X
16978	1H, 15N, 13C chemical shifts and structure of CKR-brazzein	539	X
16979	Solution structure of Enzyme IIB subunit of PTS system from Escherichia coli K12. Northeast Structural Genomics Consortium target ER315/Ontario Center for Structural Proteomics target ec0544	1329	X
16980	RDC and RCSA refinement of an A-form RNA: Improvements in Major Groove Width	77			X
16981	NMR Structure of the SARS Coronavirus Nonstructural Protein Nsp7 in Solution at pH 6.5	1016	X
16982	Backbone assignment of the D-allose binding protein from Escherichia coli in the apo form	1307	X
16983	The solution structure of the PHD3 finger of MLL	758	X
16984	Backbone assignments of D-allose binding protein from Escherichia coli in the complex form with D-allose	1138	X
16986	N-terminal domain of the DP1 subunit of an archaeal D-family DNA polymerase	792	X
16988	Solution NMR Structure of a domain of adhesion exoprotein from Pediococcus pentosaceus, Northeast Structural Genomics Consortium Target PtR41O	947	X
16989	Solution structure of the RRM domain of CYP33	945	X
16991	Solution NMR Structure of the N-terminal Domain of Putative ATP-dependent DNA Helicase RecG-related Protein from Nitrosomonas europaea, Northeast Structural Genomics Consortium Target NeR70A	1827	X
16992	1H,13C,15N backbone and sidechain assignment of human Raf kinase inhibitor protein from Escherichia coli	2055	X
16994	Calmodulin, C-terminal domain, F92E mutant	936	X
16995	Solution structure of a bolA protein (ECH_0303) from Ehrlichia chaffeensis, the causative agent of human monocytic ehrlichiosis. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target EhchA.10365.a	785	X
16996	Backbone 1H, 13C, and 15N Chemical Shift Assignments for human Rad51D from 1 to 83	1000	X
16997	Solution structure of protein SF1141 from Shigella flexneri 2a. Northeast Structural Genomics Consortium (NESG) TARGET SFT2.	1405	X
16998	Solution NMR Structure of Transcription factor NF-E2 subunit's DNA binding domain from Homo sapiens, Northeast Structural Genomics Consortium	956	X
16999	Solution structure of protein CV0426 from Chromobacterium violaceum. NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET CVT2.	1117	X
17000	Structure of E1-69 of Yeast V-ATPase	697	X
17001	ASIP(80-132, P103A, P105A, Q115Y, S124Y)	303	X
17002	Solution NMR structure of the protein YP_510488.1	1037	X
17003	Vpr(1-20) Vpr(21-40) Vpr(25-40)	316	X
17005	Three-dimensional structure of a truncated phosphoribosylanthranilate isomerase (residues 255-384) from Escherichia coli	1482	X
17006	Solution structure of alpha-mannosidase binding domain of Atg19	1417	X
17007	Solution structure of alpha-mannosidase binding domain of Atg34	1303	X
17008	Solution NMR Structure of Peptide methionine sulfoxide reductase msrB from Bacillus subtilis, Northeast Structural Genomics Consortium Target SR10	872	X
17009	Sequence specific backbone assignment of the C-terminal domain of MqsA	418	X
17010	Backbone Amide relaxation parameters for wild-type Tryptophan Repressor	328	X
17011	s34r structure	388	X
17013	Backbone Amide relaxation parameters for mutant A77V Tryptophan Repressor	358	X
17014	Backbone 1H,13C and 15N assignments of ChxR	1291	X
17015	CUPIENNIN 1A, NMR, MINIMIZED AVERAGE STRUCTURE	302	X
17016	solution structure of the CARMIL CAH3a/b domain bound to capping protein (CP_	2452	X
17017	Solution NMR Structure of (Ubiquitin thioesterase OTU1 EC3.1.2.-) from Mus musculus, Northeast Structural Genomics Consortium Target MmT2A	1018	X
17018	DAXX helical bundle (DHB) domain	1221	X
17019	DAXX helical bundle (DHB) domain / Rassf1C complex	1292	X
17020	Solution NMR structure of CV_0373(175-257) protein from Chromobacterium violaceum, Northeast Structural Genomics Consortium Target CvR118A	1100	X
17021	Solution NMR Structure of Q8PSA4 from Methanosarcina mazei, Northeast Structural Genomics Consortium Target MaR143A	1287	X
17022	Solution NMR Structure of A3DHT5 from Clostridium thermocellum, Northeast Structural Genomics Consortium Target CmR116	1466	X
17023	Solution NMR structure of the ZNF216 A20 zinc finger	548	X
17024	Solution structure of the non-covalent complex of the ZNF216 A20 domain with ubiquitin	453	X
17025	Solution NMR Structure of protein BVU3908 from Bacteroides vulgatus, Northeast Structural Genomics Consortium Target BvR153	965	X
17026	Solution NMR Structure of protein BT2368 from Bacteroides thetaiotaomicron, Northeast Structural Genomics Consortium Target BtR375	979	X
17027	NMR-derived spatial structure of water-soluble Lynx1	577	X
17028	The Solution Structure of the C-terminal Ig-like Domain of the Bacteriophage Lambda Tail Tube Protein	1000	X
17029	1H, 15N and 13C assignments for the potential GTPase binding domain of dictyostelium discoideum Fomin C	1375	X
17030	Solution NMR Structure of the Ras-binding domain of Serine/threonine-protein kinase B-raf from Homo sapiens, Northeast Structural Genomics Consortium Target HR4694F	1123	X
17031	Solution NMR structure of the PBS linker polypeptide domain of phycobilisome linker protein apcE from Synechocystis sp. Northeast Structural Genomics Consortium Target SgR209C	1833	X
17032	1H, 13C, and 15N chemical shifts and structure of brazzein-derived peptide CKR-PNG	189	X
17033	Solution NMR Structure of Nonsense mRNA reducing factor 3A from H. Sapiens, Northeast Structural Genomics Consortium Target HR4714B	915	X
17034	1H and 15N Chemical Shift Assignments for the Syrian hamster prion protein shPrP(90-232)	2335	X
17035	NMR Solution Structure of asr4154 from Nostoc sp. PCC7120 Northeast Structural Genomics Consortium target ID Nsr143	735	X
17036	SOLUTION STRUCTURE OF ZINC FINGER DOMAIN OF E3 UBIQUITIN-PROTEIN LIGASE PROTEIN Praja-1 FROM HOMO SAPIENS, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET HR4710B	904	X
17038	Solution NMR Structure of protein STY4237 (residues 36-120) from Salmonella enterica, Northeast Structural Genomics Consortium Target SlR115	1068	X
17039	Solution NMR Structure of putative cell surface protein MA_4588 (272-376 domain) from Methanosarcina acetivorans, Northeast Structural Genomics Consortium Target MvR254A	1313	X
17040	STRUCTURAL AND FUNCTIONAL ANALYSIS OF TM VI OF THE NHE1 ISOFORM OF THE Na+/H+ EXCHANGER	216	X
17041	Backbone dynamics of Tryptophan repressor protein in holo-form	379	X
17042	Backbone 1H, 15N, and 13C resonance assignment of rat-nNOS fragment (residues 134-298)	553	X
17043	TMS2 domain of Dengue virus NS4A protein	317	X
17044	Solution structure of Rtt103 CTD-interacting domain bound to a Ser2 phosphorylated CTD peptide	1531	X
17045	KSR1 CA1 domain	1847	X
17046	Backbone dynamics of Tryptophan repressor L75F mutant protein in holo-form	389	X
17047	Backbone dynamics of Tryptophan repressor A77V mutant protein in holo-form	362	X
17048	AP180 aa 623-680 Backbone Assignment	288	X
17050	Tudor domain from Drosophila Polycomblike	728	X
17062	Solution Structure of Human Plasminogen Kringle 3	782	X
17063	1H and 15N Chemical Shift Assignments of Mutated (K57D) Human Plasminogen Kringle 3	632	X
17064	13C, and 15N Chemical Shift Assignments for Anabaena sensory rhodopsin 1-229	845	X
17065	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Binary Tandem Ubiquitin Binding Domains of Signal Transducing Adapter Molecule 1	877	X
17066	SOLUTION NMR STRUCTURE OF THE N-TERMINAL PAS DOMAIN OF HERG POTASSIUM CHANNEL	1564	X
17067	Complex hMia40-hCox17	1135	X
17068	Assigment of the 1H, 13C, and 15N resonances of the yeast frataxin (Yfh1) under cold denaturation	894	X
17070	SOLUTION STRUCTURE OF THE R6 DOMAIN OF TALIN	1690	X
17071	Solution NMR structure of the Cbx3 in complex with H3K9me3 peptide	721	X
17072	Solution NMR structure of the chromobox protein 7 with H3K9me3	736	X
17073	Structure of CBP nuclear coactivator binding domain in complex with p53 TAD	1362	X
17074	An arsenate reductase	1523	X
17075	Chemical shift assignments for Bacillus subtilis TatAd protein, the channel-forming component of the Tat protein transport system	892	X
17076	An arsenate reductase	1491	X
17077	An arsenate reductase	1458	X
17078	1H, 15N chemical shift assignments of the imino groups in the base pairs of Escherichia coli tRNALeu (CAG)	64			X
17079	Solution NMR structure ov the chromobox protein Cbx7 with H3K27me3	777	X
17080	Shc-PTB:biphosphorylated integrin beta3 cytoplasmic tail complex (1:1)	2223	X
17081	Mouse Prion Protein (121-231) with mutation Y169G	1402	X
17082	Mouse Prion Protein (121-231) with mutation F175A	1411	X
17083	Structure of a conserved retroviral RNA packaging element by NMR spectroscopy and cryo-electron tomography	208			X
17084	NMR structure of mouse PrP fragment 121-231 at 20 C.	912	X
17085	NMR structure of the HLTF HIRAN domain	1319	X
17086	1H assignments for ASIP(93-126, P103A, P105A, P111A, Q115Y, S124Y)	182	X
17087	Mouse prion protein (121-231) with the mutations Y169A, Y225A, and Y226A.	1282	X
17088	Solution structure of the pseudouridine modified P6.1 hairpin of human telomerase RNA	245			X
17089	SH3-F2	913	X
17090	Solution NMR structure of the protein YP_399305.1	1529	X
17091	Zinc to cadmium replacement in the A. thaliana SUPERMAN Cys2His2 zinc finger induces structural rearrangements of typical DNA base determinant positions	254	X
17092	NMR solution structure of the N-terminal domain of DNA-binding protein SATB1 from Homo sapiens: Northeast Structural Genomics Target HR4435B(179-250)	924	X
17103	The structure of the calcium-sensitizer, dfbp-o, in complex with the N-domain of troponin C and the switch region of troponin I	1016	X
17104	YP_001336205.1	961	X
17105	Solution Structure of the N-terminal Domain of NP_954075.1	1198	X
17106	solution structure of a preQ1 riboswitch (Class I) aptamer bound to preQ1	607			X
17107	NMR STRUCTURE OF HUMAN INSULIN MUTANT GLY-B20-D-ALA, GLY-B23 2 PRO-B28-LYS, LYS-B29-PRO, 20 STRUCTURES	345	X
17108	NMR STRUCTURE OF HUMAN INSULIN MUTANT ILE-A2-LEU, VAL-A3-LEU 2 HIS-B10-ASP, PRO-B28-LYS, LYS-B29-PRO, 20 STRUCTURES	347	X
17109	The Structure of the Family D Sortase from Bacillus anthracis	1483	X
17110	chicken IGF2R domain 11	1705	X
17111	Mupirocin didomain ACP	2061	X
17112	1H, 13C and 15N NMR Assignments of the C1B Subdomains of PKC-delta.	833	X
17113	1H, 13C and 15N NMR Assignments of the C1A Subdomains of PKC-delta.	806	X
17124	NP_888769.1	1654	X
17125	SOLUTION STRUCTURE OF LACTOBACILLUS CASEI DIHYDROFOLATE REDUCTASE APO-FORM, 25 CONFORMERS	1748	X
17126	NMR assigment of Heparanase construct Hep158-417	2700	X
17127	COMPLEX STRUCTURE OF E4 mutant HUMAN IGF2R DOMAIN 11 BOUND TO IGF-II	2265	X
17128	unbound Cation-independent mannose-6-phosphate receptor domain 11 E4 mutant	1660	X
17129	Chemical shifts of the 25-mer oligonucleotide encompassing the variable region of a MUC1 DNA aptamer.	418		X
17130	Zif 268 with 12bp DNA	339	X	X
17131	NMR resonance assignment of the N-terminal domain of Latrodectus hesperus (black widow) major ampullate spider silk fibroin 1	1085	X
17132	Solution Structure of human UBA-like domain of OTUD7A_11_83, NESG target HT6304a/OCSP target OTUD7A_11_83/SGC-Toronto	858	X
17133	Chemical shift assignments for the RanBP2-type ZnF from Ewing's Sarcoma (EWS)	320	X
17134	Solution structure of Opossum Domain 11	1683	X
17135	Mature Drosophila Frataxin Homolog (Dfh)	502	X
17136	Rhodanese G	1093	X
17137	Rhodanese Y	1310	X
17138	Solution structure of the coiled-coil complex between MBD2 and p66alpha	1019	X
17139	Structure of ARC92VBD/MED25ACID	1792	X
17141	Backbone 1H, 13C, and 15N Chemical Shift Assignments for HYL1-dsRBD2	321	X
17143	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the first dsRBD of protein HYL1	500	X
17144	1H, 13C, and 15N backbone, side-chain, and heme chemical shift assignments for the oxidized form of the monoheme c-type cytochrome ApcA isolated from the acidophilic metal-reducing bacterium Acidiphilium cryptum	1169	X
17145	Chemical Shifts of the R24H Pitx2 Homeodomain Mutant	854	X
17146	1H, 13C, and 15N backbone, side-chain, and heme chemical shift assignments for the reduced form of the monoheme c-type cytochrome ApcA isolated from the acidophilic metal-reducing bacterium Acidiphilium cryptum	1172	X
17147	Chemical Shifts of the Pitx2 Homeodomain	840	X
17148	N-terminal domain of Nephila clavipes major ampulate spidroin 1	1571	X
17149	Folding Intermediate of the Fyn SH3 A39V/N53P/V55L from NMR Relaxation Dispersion Experiments	941	X
17150	Solution Structure of cellobiose-specific phosphotransferase IIB component protein from Borrelia burgdorferi. Seattle Structure Genomics Center for Infectious Disease (SSGCID).	1233	X
17151	Solution structure of peptidyl-prolyl cis-trans isomerase from Burkholderia pseudomallei complexed with 1-{[(4-methylphenyl)thio]acetyl}piperidine. Seattle Structure Genomics Center for Infectious Disease (SSGCID)	1233	X
17152	Helical hairpin structure of a novel antimicrobial peptide EcAMP1 from seeds of barnyard grass (Echinochloa crus-galli)	227	X
17153	Thiostrepton	161	X
17154	Thiostrepton (oxidized 9:CA-CB)	151	X
17155	Thiostrepton (epimer 9:CA)	153	X
17156	Thiostrepton (reduced 14:N-CA)	161	X
17157	DNA repair protein zinc finger 1	1168	X
17158	DNA repair protein zinc finger 2	1169	X
17159	Backbone assignment of the affibody-bound amyloid B-peptide	140	X
17160	1H, 13C, 15N resonance assignment of the chitin-binding protein CBP21 from Serratia marcescens	1863	X
17161	Rna14p/Rna15p heterodimer	2077	X
17162	Backbone 1H, 13C, and 15N Chemical Shift Assignments for a photochromic fluorescent protein Dronpa in the bright state	784	X
17163	Backbone 1H, 13C, and 15N Chemical Shift Assignments for a photochromic fluorescent protein Dronpa in the dark state	682	X
17165	Prion-like conversion during amyloid formation at atomic resolution	1268	X
17166	Prion-like conversion during amyloid formation at atomic resolution	1170	X
17169	Solution NMR Structure of DRBM 2 domain of Interleukin enhancer-binding factor 3 from homo sapiens, Northeast Structural Genomics Consortium Target HR4527E	948	X
17170	Resonance assignments of the Myb2 DNA binding domain in complex with its promoter MRE-1 from Trichomonas vaginalis	1311	X
17171	The chemical shift assignment of the SWIRM domain of LSD1	1137	X
17172	Bovine Pancreatic Ribonuclease A C-dimer	199	X
17173	1H, 13C, and 15N chemical shift assignments of the Nrd1-CTD Interacting Domain	1167	X
17174	MOUSE PRION PROTEIN FRAGMENT 121-231 AT 37 C	1294	X
17175	Solution NMR structure of hepothetical homodimer protein SP_0782 (7-79) from Streptococcus pneumoniae, Northeast Structural Genomics Consortium Target SpR104.	1005	X
17176	Solution NMR structure of the BT_0084 lipoprotein from Bacteroides thetaiotaomicron, Northeast Structural Genomics Consortium Target BtR376.	1510	X
17177	Partial backbone 1H,15N chemical shift of arrestin-1	292	X
17188	Solution structure of P2a-J2a/b-P2b of human telomerase RNA	605			X
17189	Pfu Rpp30 Free	959	X
17190	Complex Pfu Rpp30	825	X
17191	Solution NMR Structure of a putative Uracil DNA glycosylase from Methanosarcina acetivorans, Northeast Structural Genomics Consortium Target MvR76	1998	X
17192	Solution NMR Structure of CH domain of Rho guanine nucleotide exchange factor 7 from Homo sapiens, Northeast Structural Genomics Consortium Target HR4495E	1502	X
17193	NMR Structure in a Membrane Environment Reveals Putative Amyloidogenic Regions of the SEVI Precursor Peptide PAP248-286	253	X
17194	Oxki4a, spider derived antimicrobial peptide	237	X
17195	Backbone assignments for the UBA Domain of E2-25K	255	X
17196	Solution structure of the putative copper-ion-binding protein from Bacillus anthracis str. Ames	846	X
17199	Solution structure of Rap1-Taz1 fusion protein	1003	X
17200	NMR structure of UHRF1 Tandem Tudor Domains in a complex with Histone H3 peptide	1926	X
17201	Backbone assignment of the little finger domain of Y-family DNA polymerase Dpo4	436	X
17202	Solution structure of tandem SH2 domain from Spt6	2160	X
17203	NMR structure of Acyl carrier protein from Brucella melitensis. Seattle Structure Genomics Center for Infectious Disease (SSGCID)	821	X
17204	the 1H, 13C and 15N resonance assignment of ubiquitin-like small archaeal modifier protein from Haloferax volcanii	607	X
17205	Chemical shift of fully reduced Cox17 from Yeast.	332	X
17206	villin head piece domain of human ABLIM2	928	X
17207	Solution NMR Structure of the PBS linker domain of phycobilisome rod linker polypeptide from Synechococcus elongatus, Northeast Structural Genomics Consortium Target SnR168A	1715	X
17208	Backbone 1H, 13C, and 15N chemical shift assignments for the nucleotide-binding domain of E.coli DnaK in the ADP.Pi-bound state	1671	X
17209	Backbone 1H, 13C, and 15N chemical shift assignments for the nucleotide-binding domain of E.coli DnaK in the nucleotide-free state	1337	X
17210	Backbone 1H, 13C, and 15N Chemical Shift Backbone 1H, 13C, and 15N chemical shift assignments for the nucleotide-binding domain of E.coli DnaK in the ATP-bound state	1688	X
17211	Backbone and partial sidechain assignments of a fragment comprising transmembrane helix 1 to transmembrane helix 3 of the Ste2p receptor in TFE/water	1500	X
17212	1H, 13C and 15N resonance assignment of Rap1 BRCT domain from Saccharomyces cerevisiae	920	X
17213	Mouse prion protein (121-231) with the mutation Y169A	1292	X
17214	A30P alpha-synuclein fibrils	256	X
17226	1H, 15N, and 13C chemical shift assignments, and 15N dynamics for trHbN-cyanomet from M. tuberculosis	1124	X
17227	SOLUTION STRUCTURE OF GS-alfa-Ktx5.4 SYNTHETIC SCORPION LIKE	201	X
17228	C-terminal zinc knuckle of the HIVNCp7	118	X
17229	C-terminal zinc knuckle of the HIVNCp7 with DNA	153	X	X
17231	Resonance assignments of ArsD	554	X
17232	Solution structure of the PlyG catalytic domain	1847	X
17233	Solution structure of the PlyG cell wall binding domain	1062	X
17234	NMR structure of the DNA-binding domain of E.coli Lrp	788	X
17235	Solution structure of a putative acyl carrier protein from Anaplasma phagocytophilum. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target AnphA.01018.a	1047	X
17236	cytochrome c domain of pp3183 protein from Pseudomonas putida	507	X
17237	NMR Structure of hFn14	212	X
17238	NMR structure of the UBA domain of S. cerevisiae Dcn1	682	X
17239	NMR structure of the UBA domain of S. cerevisiae Dcn1 bound to ubiquitin	685	X
17240	INFLUENZA HEMEGGLUTININ FUSION PEPTIDE MUTANT G13A	117	X
17241	YAP WW2	503	X
17242	Solution Structures of Oxidized and Reduced Thioredoxin C from M. tb	1214	X
17243	The Solution Structure of Human Cardiac Troponin C in complex with the Green Tea Polyphenol; (-)-epigallocatechin-3-gallate	756	X
17244	Structural basis for histone code recognition by BRPF2-PHD1 finger	714	X
17245	Solution Structure of the Chemokine CCL21	1224	X
17246	Solution structure of the Streptococcus pneumoniae RrgB pilus backbone D1 domain	2000	X
17247	Solution NMR Structure of xenopus Fn14	247	X
17249	1H, 13C and 15N resonances of the AlgE62 subunit from Azotobacter vinelandii mannuronan C5-epimerase	1707	X
17250	GNA1946	3395	X
17251	the N-terminal domain of SARS-CoV main protease	2185	X
17252	Solution NMR Structure of BCMA	182	X
17253	1H and backbone 15N chemical shifts of a peptide inhibitor for the Malaria surface protein, Apical Membrane Antigen 1	166	X
17254	Promiscuous Binding at the Crossroads of Numerous Cancer Pathways: Insight from the Binding of GIP with Glutaminase L	1510	X
17255	GIP/Glutaminase L peptide complex	1454	X
17256	Solution structure of Ste5PM24 in the presence of SDS micelle	110	X
17257	NMR structure of the Xanthomonas VirB7	1444	X
17258	Resonance assignments and secondary structure of a phytocystatin from Ananas comosus	1651	X
17260	Backbone and side-chain 1H, 13C and 15N assignments of the UCHL1 S18Y variant	2462	X
17261	SOLUTION STRUCTURE OF APO S100A16	952	X
17262	SOLUTION STRUCTURE OF CALCIUM BOUND S100A16	966	X
17263	Solution structure of the small archaeal modifier protein 1 (SAMP1) from Methanosarcina acetivorans.	1278	X
17264	Solution NMR Structure of apo-calmodulin in complex with the IQ motif of Human Cardiac Sodium Channel NaV1.5	2142	X
17265	NMR structure of fusion of CtIP (641-685) to LMO4-LIM1 (18-82)	1315	X
17266	Solution structure of the C-terminal domain of SilB from Cupriavidus metallidurans	969	X
17267	Solution Structure of an Uncharacterized Thioredoin-like Protein from Clostridium perfringens	1572	X
17268	Solution Structures of Oxidized and Reduced Thioredoxin C from M. tb	1145	X
17270	Complex between BD1 of Brd3 and GATA-1 C-tail	1615	X
17271	Co-ordinates and 1H, 13C and 15N chemical shift assignments for the complex of GPS2 53-90 and SMRT 167-207	900	X
17272	Solution structures of human PIWI-like 1 PAZ domain	1472	X
17273	Solution Structures of human PIWI-like 1 PAZ domain with ssRNA (5'-pUGACA)	1472	X		X
17274	1H, 13C, and 15N Chemical Shift Assignments for the IIA(Chitobiose)-HPr Complex of the N,N'-Diacetylchitobiose Branch of the Escherichia coli Phosphotransferase System	1867	X
17275	Solution Structure of Thioredoxin from Bacteroides Vulgatus	1666	X
17276	Unbound TbRI-ED	861	X
17277	Solution Structure of a Putative Thioredoxin from Neisseria meningitidis	1820	X
17278	NMR assignment of actin depolymerizing and dynamics regulatory protein from toxoplasma gondii	1308	X
17279	Solution NMR structure of protein lipocalin 12 from rat epididymis	2008	X
17280	Solution NMR Structure of BVU_3817 from , Northeast Structural Genomics Consortium Target BvR159	1566	X
17281	Conformational and membrane interactins studies of antimicrobial peptide Alyteserin-1C	140	X
17282	Solution Structure of apo-IscU(WT)	1137	X
17283	Sequence-specific 1H, 13C and 15N assignments of the phosphoesterase (PE) domain of Pseudomonas aeruginosa DNA ligase D (LigD)	1570	X
17284	Solution NMR structure of E2 lipoyl domain from Thermoplasma acidophilum	939	X
17285	Structure of the first PHD finger (PHD1) from CHD4 (Mi2b).	642	X
17286	Solution structure of the C-terminal domain of hRpn13	1439	X
17287	NMR solution structure ensemble of domain 11 of the echidna M6P/IGF2R receptor	1680	X
17288	1H, 13C, and 15N backbone and side-chain chemical shift assignment of the staphylococcal toxin MazF	1520	X
17289	NMR structure of calcium-loaded STIM2 EF-SAM.	1529	X
17290	Backbone and side chain assignments for the intrinsically disordered cytoplasmic domain of human neuroligin-3	1413	X
17291	A novel design concept: New Y-receptor agonists with increased membrane recruitment, Y2 affinity and selectivity	323	X
17292	NMR structure of the A730 loop of the Neurospora VS ribozyme	496			X
17293	Solution structure of human J-protein co-chaperone Dph4	1592	X
17294	Protein and metal cluster structure of the wheat metallothionein domain g-Ec-1. The second part of the puzzle.	136	X
17295	Protein and metal cluster structure of the wheat metallothionein domain g-Ec-1. The second part of the puzzle.	141	X
17296	NMR solution structure of GLP-2 in 2,2,2 trifluroethanol	215	X
17297	NMR Solution structure of GLP-2 in DHPC micelles	215	X
17298	Resonance assignments of protein SSO1118 from hyperthermophilic archaeon Sulfolobus solfataricus P2	1449	X
17299	1H, 13C and 15N Chemical shift assignments of the thioredoxin from the anaerobic bacteria Desulfovibrio vulgaris Hildenborough	1343	X
17300	1H, 13C and 15N Chemical shift assignments of the thioredoxin from the anaerobic bacteria Desulfovibrio vulgaris Hildenborough	1349	X
17301	NMR Structure of an Archaeal DNA Binding Protein Sso7c4	470	X
17302	1H and 15N RESONANCE ASSIGNMENT OF HUMAN APO L-FABP	1078	X
17303	1H and 15N RESONANCE ASSIGNMENT OF HUMAN HOLO L-FABP	1082	X
17304	Solution NMR Structure of de novo designed rossmann 2x3 fold protein, Northeast Structural Genomics Consortium Target OR28	1588	X
17305	Three-dimensional structure of the N-terminal effector PYRIN domain of NLRP12	1204	X
17306	NRC consensus ankyrin repeat protein backbone and sidechain assignments	1144	X
17307	NMR Structure of the monomeric mutant C-terminal domain of HIV-1 Capsid in complex with stapled peptide Inhibitor	1184	X
17308	drosophila CstF-50 (1-65)	380	X
17309	Solution structure of coronaviral stem-loop 2 (SL2)	162			X
17310	L.casei DHFR-TRIMETHOPRIM complex	1604	X
17311	L.casei DHFR-NADPH complex	1871	X
17312	Tah1 complexed by MEEVD	1491	X
17313	drosophila CstF-50 (1-92)	423	X
17314	Solution Structure of a Nonphosphorylated Peptide Recognizing Domain	1163	X
17315	Structure of C-terminal dsRBD of the Fission Yeast DICER (Dcr1)	1093	X
17316	Specifier domain and GA motif region of B. subtilis tyrS T box leader RNA	773			X
17318	NMR solution structure of the protein YP_001092504.1	1615	X
17319	NMR solution structure of the protein NP_253742.1	1423	X
17320	NMR structure of the protein YP_926445.1 from Shewanella Amazonensis	1289	X
17321	New high resolution NMR structure of gpW (W protein of bacteriophage lambda) at neutral pH	687	X
17322	High resolution NMR structure of gpW (W protein of bacteriophage lambda) at acidic pH	700	X
17323	Solution NMR Structure of Med25(391-543) Comprising the Activator-Interacting Domain (ACID) of Human Mediator Subuniti 25. Northeast Structural Genomics Consortium Target HR6188A	2053	X
17324	NMR Solution Structure of the winged-helix domain from MUS81 junction-specific endonuclease	1249	X
17325	1H, 13C and 15N resonance assignment of the 117 residue fragment of Engrailed 2, a partially disordered protein.	1439	X
17326	Shin-Dalgarno sequence of the hcnA gene of Pseudomonas fluourescens	114			X
17327	Not known	2004	X
17328	magnesium bound CIB1	999	X
17329	The Solution Structure of Calcium Bound CIB1	1155	X
17330	NMR solution structure of GIP in micellular media	275	X
17331	NMR solution structure of GIP in Bicellular media	294	X
17332	Solution Structure of the talin Vbs2b domain	1547	X
17343	Structure of the NOXO1b PX domain	919	X
17344	Solution structure of CHD4-PHD2 in complex with H3K9me3	793	X
17345	Solution NMR structure of human NFATC2IP ubiquitin-like domain, NFATC2IP_244_338, NESG target HT65A/OCSP target hs00387_244_338/SGC-toronto	1194	X
17346	Solution NMR structure of PAP248-286 in 50% TFE	266	X
17347	Solution NMR structure of PAP248-286 in 30% TFE	269	X
17350	SOLUTION STRUCTURE OF THE R2 DOMAIN OF TALIN	658	X
17351	Ribonucleotide Perturbation of DNA Structure: Solution Structure of [d(CGC)r(G)d(AATTCGCG)]2	138				X
17352	The structure of a domain from yeast	1188	X
17353	Androcam	1870	X
17354	high calcium androcam	1787	X
17355	NMR solution structure of meACP	989	X
17356	Biophysical studies of lipid interacting regions of DGD2 in Arabidopsis thaliana	112	X
17357	PsbQ protein	961	X
17358	Solution structure of the third Immunoglobulin-like domain of nectin-1	627	X
17359	Solution NMR Structure of protein CD1104.2 from Clostridium difficile, Northeast Structural Genomics Consortium Target CfR130	911	X
17360	Solution structure of Ca2+/calmodulin complexed with a peptide representing the calmodulin-binding domain of calmodulin kinase I	194	X
17361	The Conformation of Bacteriorhodopsin Loops in Purple Membranes resolved by Solid-state MAS-NMR	255	X
17362	Backbone assignments for E2-25K	900	X
17363	NMR Structure of the B domain of talin	1905	X
17364	The solution structure of the PTB Domain of TENC1 in complex with the peptide of DLC1	1609	X
17365	ASHH2 a CW domain	1141	X
17367	Assignments of Drosophila cytotoxic T-lymphocyte antigen 2 (CTLA-2) like protein, crammer at pH3	371	X
17368	Fyn SH2 free form	1332	X
17369	Fyn SH2 bound form	1316	X
17370	Solution NMR structure of conjugate transposon protein BVU_1572(27-141) from Bacteroides Vulgatus, Northeast Structural Genomics Consortium Target BvR155.	1539	X
17371	Solution NMR structure of N-terminal Ubiquitin-like domain of FUBI, a ribosomal protein S30 precursor from Homo sapiens. NorthEast Structural Genomics consortium (NESG) target HR6166	891	X
17373	PDZ2 from human SAP97	457	X
17374	1H, 13C and 15N resonance assignments for ADF/Cofilin from Trypanosoma brucei	1469	X
17375	Assignment of Human Proliferating Cell Nuclear Antigen Complexed with a 20 Amino Acids Peptide from the C-terminal Region of p21 (WAF1/CIP1)	538	X
17376	Backbone Assignment of Human Proliferating Cell Nuclear Antigen Complexed with a 12 Amino Acids Peptide from the C-terminal Region of p21 (WAF1/CIP1)	1210	X
17377	Solution structure of the MFS-bound Sans CEN2 peptide	72	X
17378	Structure of CEL-PEP-RAGE V domain complex	1093	X
17379	QUI/G-quadruplex complex	197		X
17380	rbp56 RanBP2 zinc finger backbone chemical shifts	138	X
17381	Backbone 1H, 13C, and 15N Chemical Shift Assignments for a putative surface protein	783	X
17382	Solution structure of the human Raf-1 kinase inhibitor protein	2177	X
17383	Crimean Congo Hemorrhagic Fever Gn zinc finger	373	X
17384	Backbone Assignment of the Tyrosine Kinase Src Catalytic Domain in Complex with Imatinib.	1115	X
17385	TEX13A RanBP2 zinc finger backbone chemical shifts	137	X
17386	RBM10 RanBP2 zinc finger backbone chemical shifts	142	X
17387	RBM5 RanBP2 zinc finger backbone chemical shifts	135	X
17388	Solution Structure of the Zinc Finger Domain of USP13	1163	X
17389	Solution NMR Structure of the serine-rich domain of hEF1( Enhancer of filamentation 1) from homo sapiens, Northeast Structural Genomics Consortium Target HR5554A	1912	X
17390	Solution NMR Structure of de novo designed protein, P-loop NTPase fold, Northeast Structural Genomics Consortium Target OR32	1938	X
17391	A protein from Haloferax volcanii	667	X
17392	NMR Solution structures of CBP bromodomain with small molucule J28	1413	X
17393	Solution NMR structures of CBP bromodomain with small molecule of HBS	1378	X
17394	Solution NMR structure of human amylin in SDS micelles at pH 7.3	228	X
17395	The 27-residue N- terminus CCR5-peptide in a ternary complex with HIV-1 gp120 and a CD4-mimic peptide	164	X
17396	1H, 13C, and 15N Chemical Shift Assignments for FCS domain from human polyhomeotic homolog 1	550	X
17397	Solution structure of all parallel G-quadruplex formed by the oncogene RET promoter sequence	209		X
17398	A protein from yeast	1145	X
17399	Structure of a novel CBM3 lacking the calcium-binding site	1647	X
17400	B. ste. A26I TRAP methyls	116	X
17401	NMR Spectroscopy and Molecular Dynamics Simulation of r(CCGCUGCGG)2 Reveal a Dynamic UU Internal Loop Found in Myotonic Dystrophy Type 1	48			X
17402	Structure/function of the LBR Tudor domain	751	X
17403	1H, 15N and 13C resonance assignment of the N-terminal C39-peptidase like domain of the ABC transporter Haemolysin B (HlyB)	1895	X
17404	Backbone (H,N,CA,HA,CB,HB) assignment of the Escherichia coli peptidyl-tRNA hydrolase	1403	X
17405	IPSE/alpha-1	1293	X
17406	Structure of a 4X4 Nucleotide RNA Internal Loop from an R2 Retrotransposon	208			X
17407	The complex structure of homeodomain in solution	938	X
17408	Chemical probe bound to HIV TAR RNA	177			X
17409	A biocompatible backbone modification? - Structure and dynamics of a triazole-linked DNA duplex	306		X
17410	1H, 15N and 13C backbone chemical shift assignment of the titin A67-A68 domain tandem	910	X
17411	Backbone 1H, 13C, and 15N Chemical Shift Assignments for CHIP (carboxyl terminal of Hsc70-interacting protein)	323	X
17412	GABARAPL-1 NBR1-LIR complex structure	1497	X
17413	B. ste. A26I Holo TRAP Ile, Leu, and Val methyls	116	X
17414	Structure of an engineered splicing intein mutant based on Mycobacterium tuberculosis RecA	1329	X
17415	Reduced and CO-bound cytochrome P450cam (CYP101A1)	1189	X
17416	Aquifex aeolicus LpxC/CHIR-090 complex	3350	X
17417	mutant C335A, K309C of the Nek2 kinase leucine zipper	320	X
17418	Backbone and sidechain assignments of intein from DNA polymerase II of Pyrococcus abyssi	2064	X
17419	NMR STRUCTURE OF THE CYTIDINE REPRESSOR DNA BINDING DOMAIN IN PRESENCE OF OPERATOR HALF-SITE DNA	603	X
17420	Solution structure of Chr148 from Cytophaga hutchinsonii. Northeast Structural Genomics Consortium Target Chr148	1456	X
17421	Solution structure of human protein C6orf130 in complex with ADP-ribose	1842	X
17422	Solution Structure of a DNA Duplex Containing the Potent Anti-Poxvirus Agent Cidofovir	166		X
17423	Solution Structure of a DNA Duplex Containing the Potent Anti-Poxvirus Agent Cidofovir	157		X
17424	Solution NMR Structure of Transmembrane and Cytosolic Regions of Integrin 1 in Detergent Micelles	416	X
17425	Staphylococcus aureus pathogenicity island 1 protein gp6, an internal scaffold in size determination	701	X
17426	Solution structure of SFTI-OPN, a pro-angiogenic peptide with osteopontin sequence grafted into SFTI-1 cyclic framework	83	X
17427	Chemical Shift Assignments for p21-KID Bound to Cdk2 and Cyclin A in Solution	206	X
17428	AIDA1 PTB domain	1562	X
17429	Solution NMR structure of the phycobilisome linker polypeptide domain of CpcC (20-153) from Thermosynechococcus elongatus, Northeast Structural Genomics Consortium Target TeR219A	1466	X
17430	Spatial structure of antimicrobial peptide Arenicin-2 dimer in DPC micelles	600	X
17431	Solution structure of the E. coli outer membrane protein RcsF (periplasmatic domain)	1101	X
17432	Solution structure of murine myristoylated msrA	1010	X
17433	Structure of the Integrin beta3(A711P,K716A) Transmembrane Segment	194	X
17434	solution structure of the C-terminal domain of H-NS like protein Bv3F	515	X
17435	solution structure of the C-terminal domain of Salmonella H-NS	574	X
17436	Structure of the HIV-1 frameshift site RNA bound to a small molecule inhibitor of viral replication	397			X
17437	1H, 13C and 15N backbone chemical shift assignments of the UBC domain of Ube2S	534	X
17438	LAK160-P7	49	X
17439	1H, 13C and 15N backbone chemical shift assignments of ubiquitin at pH 7.2	275	X
17441	LAK160-P10	49	X
17442	LAK160-P12	49	X
17443	Solution structure of human ubiquitin conjugating enzyme Rad6b	1692	X
17444	transmembrane domain of LR11/SorLA	121	X
17445	1H 15N 13C Backbone Assignment of Akap79 'M' domain, a human A-kinase anchor protein 5	1225	X
17446	1H 15N 13C Backbone Assignment of Sap97 N terminal region and PDZ1 domain	1378	X
17447	1H, 15N and 13C resonance assignment of a common Major Urinary Protein of the mouse	1958	X
17448	Solution structure of the protein YP_546394.1, the first structural representative of the pfam family PF12112	1349	X
17449	Solution Structure of the human Anti-codon Stem and loop(hASL) of transfer RNA Lysine III (tRNALys3)	131			X
17450	Solution structure of AS1p-Tar in 10% negatively charged bicelles	116	X
17451	Central domain of RSV M2-1	1551	X
17452	Chemical Shifts of the Pitx2 Homeodomain in complex with a TAAGCT non-consensus DNA site	786	X	X
17453	Oligomeric Structure of the Chemokine CCL5/RANTES from NMR, MS, and SAXS Data	117	X
17454	Backbone 1H, 13C, and 15N Chemical Shift Assignments for human PMP22 (WT)	341	X
17455	Backbone 1H, 13C, and 15N Chemical Shift Assignments for human TrJ disease-related mutant form of PMP22	230	X
17456	1H, 15N, 13C chemical shift assignment of the THAP domain 1-81 from the cell growth suppressor human THAP11 protein	948	X
17458	NMR STRUCTURE OF THYMOSIN ALPHA-1	188	X
17466	Solution structure of the RING finger-like domain of Retinoblastoma Binding Protein-6 (RBBP6)	1027	X
17467	NMR assignment of the second B3 domain of VERNALIZATION1 from Arabidopsis thaliana	1354	X
17468	Resonance assignment of a 179 residue fragment of hepatitis C virus non-structural protein 5A	831	X
17471	Backbone 1H, 13C, and 15N Chemical Shift Assignments for p38 alpha MAPK	1131	X
17472	TRPV5 C-terminal peptide	107	X
17473	Backbone 1H and 15N Chemical Shift Assignments for chimeric fusion of S. cerevisiae and C. albicans Sup35	286	X
17474	Backbone 1H, 13C, and 15N Chemical Shift Assignments for CD147 Ig0 C66M domain.	428	X
17475	Structural basis of p63a SAM domain mutants involved in AEC syndrome	572	X
17476	The solution structure of the ZnF UBP domain of USP33/VDU1.	1066	X
17477	NMR Structure of the Mouse MFG-E8 C2 Domain	1706	X
17478	Structure of cIAP1 CARD	470	X
17479	Structure of the human Shwachman-Bodian-Diamond syndrome (SBDS) protein	2843	X
17481	Solution NMR Structure of Q5HLI9 from Staphylococcus epidermidis, Northeast Structural Genomics Consortium Target SeR147	1835	X
17482	Structural Characterization of small heat shock protein (Hsp12)	1103	X
17483	Structural characterization of small heat shock protein (Hsp12) in aqueous solution	779	X
17484	Solution NMR Structure of Homeobox domain of Homeobox protein Nkx-3.1 from homo sapiens, Northeast Structural Genomics Consortium Target HR6470A	806	X
17485	Solution structure of Pf1 SID1-mSin3A PAH2 Complex	1547	X
17487	Backbone 1H, 13C, and 15N Chemical Shift Assignments for ICL3 of 5TH1A receptor	673	X
17488	Spatial structure of dimeric ErbB3 transmembrane domain	525	X
17489	1H, 13C, and 15N Chemical Shift Assignments for the FF domain L24A mutant	309	X
17490	Solution Structure of the C-terminal domain of Prp24	1420	X
17491	Backbone Resonance Assignments for the C-terminus of Prp24	987	X
17492	Trn- peptide of the two-component bacteriocin Thuricin CD	312	X
17493	Solution structure of the MoCVNH-LysM module from the rice blast fungus Magnaporthe oryzae protein (MGG_03307)	1489	X
17494	Zinc knuckle in PRDM4	294	X
17495	Trn- peptide of the two-component bacteriocin Thuricin CD	255	X
17496	Solution Structure of the PilZ Domain Protein PA4608 Complex with Cyclic Di-GMP Identifies Charge Clustering as Molecular Readout	1584	X
17497	SNX-17-PX-DOMAIN	1015	X
17498	Solid-state NMR assignment of alpha-synuclein amyloid fibrils	394	X
17499	Solid-state NMR assignment of the Ure2p prion C-terminal 70-354 in microcrystalline form.	943	X
17500	Papiliocin	278	X
17501	The NMR structure of the protein NP_344798.1 reveals a CCA-adding enzyme head domain	2435	X
17502	NMR STRUCTURE OF THE C-TERMINAL RRM DOMAIN OF POLY(U) BINDING 1	1248	X
17503	Staphylococcus aureus FusB	838	X
17504	RNA Duplex-Quadruplex Junction Complex with FMRP RGG peptide	410	X		X
17505	1H, 13C, and 15N Chemical Shift Assignments for human muscle Acylphosphatase	1077	X
17506	Backbone and CB assignment of N-terminal Domain of Ribosomal Protein L9 (NTL9) native state	321	X
17507	DJ-1 backbone assignment	875	X
17508	Solution NMR Structure of RRM domain of RNA-binding protein FUS from homo sapiens, Northeast Structural Genomics onsortium Target HR6430A	1101	X
17509	NMR structure of the protein YP_557733.1 from Burkholderia xenovorans	1590	X
17510	1H, 13C and 15N backbone and side-chain resonance assignments of Drosophila melanogaster Ssu72	2255	X
17511	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Leucine Zipper GCN4 coiled coil and x-form conformations.	346	X
17512	1H, 13C, and 15N resonance assignments for S. aureus primase C-terminal domain	1549	X
17513	Towards an atomistic level understanding of the unfolded state of Immunity protein 7 in non-denaturing conditions	865	X
17514	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Leucine Zipper c-Jun.	158	X
17515	solution structure of INAD PDZ5 complexed with Kon-tiki peptide	1207	X
17517	Pseudouridine_ASL_Tyr	131			X
17518	Solution Strucuture of CBM25-1 of beta/alpha-amylase from Paenibacillus polymyxa	1131	X
17519	Solution Strucuture of CBM25-2 of beta/alpha-amylase from Paenibacillus polymyxa	1105	X
17520	Unmodified_ASL_Tyr	309			X
17521	Solution structure of an E. coli lipoprotein	2536	X
17523	Backbone and side-chain 1H, 15N, and 13C resonance assignments of Norwalk virus protease	1983	X
17524	Solution NMR Structure of Mitotic checkpoint serine/threonine-protein kinase BUB1 N-terminal domain from Homo sapiens, Northeast Structural Genomics Consortium Target HR5460A	1952	X
17525	ATR13 Chemical Shifts	876	X
17526	EcNusB bound to BoxA RNA	1284	X		X
17527	Structure of epidermal growth factor-like repeat 12 of mouse Notch-1 receptor	245	X
17528	Structure of epidermal growth factor-like repeat 12 of mouse Notch-1 receptor	245	X
17529	Third WW domain of human Nedd4L in complex with doubly phosphorylated human smad3 derived peptide.	359	X
17530	Solution NMR structure of the AHSA1-like protein RHE_CH02687 (1-152) from Rhizobium etli, Northeast Structural Genomics Consortium Target ReR242	1810	X
17531	Three-dimensional structure of the cyclotide Cter M	174	X
17532	NMR structure of Ca2+-bound CaBP1 C-domain with RDC	1354	X
17533	Solution structure of the Sex Peptide from Drosophila melanogaster	364	X
17534	NMR resonance assignment of the autoimmunity protein SpaI from Bacillus subtilis ATCC 6633	1594	X
17535	DNA / RNA Hybrid containing a central stereo specific Rp borano phosphate linkage	183		X	X
17536	Molecular Determinants of Paralogue-Specific SUMO-SIM Recognition	514	X
17537	Solution structure of a Human minimembrane protein OST4	202	X
17538	Structure of the second WW domain from human YAP in complex with a human Smad1 derived peptide	321	X
17539	Structure of first WW domain of human YAP in complex with a human Smad1 doubly-phosphorylated derived peptide.	229	X
17540	Structure of the first WW domain of human YAP in complex with a mono-phosphorylated human Smad1 derived peptide	321	X
17541	Structure of the first domain of human Smurf1 in complex with a monophosphorylated human Smad1 derived peptide.	224	X
17542	Structure of the first domain of human Smurf1 in complex with a doubly phosphorylated human Smad1 derived peptide.	295	X
17543	Structure of the second domain of human Smurf1 in complex with a human Smad1 derived peptide containing a PY motif	357	X
17544	Structure of the second domain of human Nedd4L in complex with a doubly phosphorylated human Smad3 derived peptide.	444	X
17545	Structure of the first domain of human PIN1 in complex with a human Smad3 derived peptide.	376	X
17546	Refined Structural Basis for the Photoconversion of A Phytochrome to the Activated FAR-RED LIGHT-ABSORBING Form	1490	X
17547	Hevein-type Antifungal Peptide with a Unique 10-Cysteine Motif	243	X
17549	Backbone Resonance Assignment of the von-Willebrand-factor-A-like domain 2 of type VII collagen	858	X
17550	Backbone assignments of the IDOL RING domain	415	X
17551	Solution structure of chicken ileal BABP in complex with glycochenodeoxycholic acid	1445	X
17552	Backbone resonance chemical shift assignments of Ph SAM linker	399	X
17553	Solution structure of acyl CoA binding protein from Babesia bovis T2Bo. Seattle Structure Genomics Center for Infectious Disease (SSGCID)	1011	X
17554	solution structure of tandem UBA of USP13	1172	X
17555	Chemical shift assignments of the VBS1 domain of talin	649	X
17556	1H, 13C, and 15N Chemical Shift Assignments of the yPEPmin fragment of Rsa1p	186	X
17557	Solution structure of the dimerization domain of human ribosomal protein P1/P2 heterodimer	1202	X
17558	Structure of the CHR of the Prion protein in DPC Micelles	256	X
17559	Assignment of the stem loop 2 of RsmZ	118			X
17560	Assignment of the stemloop 4 of RSMZ	113			X
17561	Solution Structure of the Dimeric Form of a Unliganded Bovine Neurophysin, Minimized Average Structure	948	X
17562	N2-dG:N2-dG interstrand cross-link induced by trans-4-hydroxynonenal	147		X
17563	Glycyl-tRNA(GCC) anticodon stem-loop from Bacillus subtilis	198			X
17564	Glycyl-tRNA(UCC)1B anticodon stem-loop from Staphylococcus epidermidis	194			X
17565	Unmodified Glycyl-tRNA(UCC) anticodon stem-loop from Bacillus subtilis	183			X
17566	22 nt artificial stemloop TASL1	133			X
17567	26 nt artificial stemloop TASL2	178			X
17568	30 nt artificial stemloop TASL3	176			X
17569	Solution structure of the ADD domain of ATRX complexed with histone tail H3 1-15 K9me3	1492	X
17570	Solid-state NMR assignment of the C-terminal domain of the Ure2p prion in its fibrillar form	694	X
17571	(Revised) SOLUTION STRUCTURE OF THE MONOMERIC FORM OF A MUTANT UNLIGANDED BOVINE NEUROPHYSIN, 20 STRUCTURES.	655	X
17572	i6A37_tyrASL	268			X
17573	Conformation Effects of Base Modification on the Anticodon Stem-loop of Bacillus subtilis tRNATYR	113			X
17574	Structure of a yeast RNase III dsRBD complex with a non-canonical RNA substrate provides new insights into substrate recognition	960	X			X
17575	solution structure of the C domain of Rv0899 from mycobacterium tuberculosis	1274	X
17576	1H, 13C, and 15N assignments of wild-type gamma-S crystallin	2007	X
17577	Siderocalin Q83 reveals a dual ligand binding mode	1482	X
17578	Solution structure of the S. cerevisiae H/ACA RNP protein Nhp2p-S82W mutant	1108	X
17579	H/ACA RNP protein Nhp2p	1205	X
17580	Myc G-quadruplex formed at the 5'-end of NHEIII element	161		X
17581	Solution structure of the skeletal muscle and neuronal voltage gated sodium channel antagonist mu-conotoxin CnIIIC	127	X
17582	1H, 13C, and 15N assignments of cataract-related variant gamma-S-G18V crystallin	2001	X
17583	Thurincin H	316	X
17584	1H 13C 15N resonance assignment of CD4+ T cell-derived peptide Thp5	186	X
17585	Rv0020c_Nter structure	1326	X
17586	Rv0020c_FHA Structure	1074	X
17588	Solution structure of the RXLR effector P. capsici AVR3a4	1283	X
17589	Backbone Resonance Assignments for Prp24-RRM3	421	X
17590	Backbone assignments of Anabaena Sensory Rhodopsin Transducer with D-tails	447	X
17591	Backbone assignments of Anabaena Sensory Rhodopsin Transducer with F-tails	470	X
17592	Backbone assignments of Anabaena Sensory Rhodopsin Transducer with DNA	492	X	X
17593	NMR analysis of TM1_TM2 in TFE:water(0.1%TFA) (1:1)	977	X
17594	Solution NMR structure of a helical bundle domain from human E3 ligase HECTD1. Northeast structural genomics consortium (NESG) target HT6305A	1016	X
17595	NMR resonance assignments for an archaeal homolog of the endonuclease Nob1 involved in ribosome biogenesis	1961	X
17596	Backbone and sidechain 1H, 13C and 15N chemical shift assignments of the hydrophobin DewA from Aspergillus nidulans	2474	X
17597	Chemical shift assignments for Rv0577, a putative glyoxylase associated with virulence from Mycobacterium tuberculosis. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target MytuD.17269.a.	1751	X
17598	Solution Structure of PilP from Pseudomonas aeruginosa	1215	X
17599	Solution structure of Par-6 Q144C/L164C	1521	X
17600	Solution structure of the isolated Par-6 PDZ domain	1212	X
17601	Solution structure of the MLV readthrough pseudoknot	274			X
17602	Backbone 1H, 13C, and 15N Chemical Shift Assignments of wildtype phosphomannomutase/phosphoglucomutase	2461	X
17603	Solution Structure of a Minor and Transiently Formed State of a T4 Lysozyme Mutant	960	X
17604	Solution Structure of a Minor and Transiently Formed State of a T4 Lysozyme Mutant	668	X
17606	Solution structure of RBBP1 chromobarrel domain	876	X
17607	Solution structure of RBBP1 tudor domain	1323	X
17608	RLIP76 (GAP-GBD)	3262	X
17609	Chemical shift assignment of Hr4436B from Homo Sapiens, Northeast	648	X
17610	Solution structure of GppNHp-bound H-RasT35S mutant protein.	2074	X
17611	Solution NMR structure of protein Rmet_5065 from Ralstonia metallidurans. Northeast Structural Genomics Consortium Target CrR115.	1741	X
17612	Solution NMR Structure of a Protein With a Redesigned Hydrophobic Core, Northeast Structural Genomics Consortium Target OR38	1436	X
17613	Solution NMR Structure of DE NOVO DESIGNED PROTEIN, P-LOOP NTPASE FOLD, Northeast Structural Genomics Consortium Target OR36	1740	X
17614	Structure of the mitochondrial uncoupling protein 2 determined by NMR molecular fragment replacement	1180	X
17615	Solution Structure of RfaH carboxyterminal domain	746	X
17616	Backbone Resonance assignment of 1H, 13C, 15N for P2 of plasmodium falciparum in 9M urea.	1012	X
17617	IIIS4	234	X
17618	1H and 15N assignments of WALP19-P10 peptide in SDS micelles	167	X
17619	1H and 15N assignments of WALP19-P8 peptide in SDS micelles	161	X
17620	1H,15N and 13C Assignment of the D2 domain of the Human Fibroblast Growth Factor Receptor 4	976	X
17621	Solution structure of the EF-hand domain of Human Polycystin 2	581	X
17622	Solution structure of the closed conformation of human U2AF65 tandem RRM1 and RRM2 domains	1623	X
17623	MODEL OF HUMAN U2AF65 TANDEM RRM1 AND RRM2 DOMAINS WITH EIGHT-SITE URIDINE BINDING	1473	X		X
17625	Microvirin:mannobiose complex	840	X
17626	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Act2-EF34 in complex with palladin peptide	209	X
17627	1H, 13C, and 15N chemical shift assignments for apo actinin-2 C-terminal EF-hand (Act2-EF34)	478	X
17628	NMR Structure of Alk1 extracellular domain	925	X
17629	Yeast Nbp2p SH3 domain in complex with a peptide from Ste20p	915	X
17630	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Human Just Another Zinc Finger Protein residues 23-117	201	X
17631	Backbone 1H, 13C, and 15N Chemical Shift Assignments for human JAZ ZF2	170	X
17632	Solution structure of the Vav1 SH2 domain complexed with a Syk-derived doubly phosphorylated peptide	1221	X
17633	NMR structure of BC28.1	2352	X
17634	Structure of the Cytidine Repressor DNA-Binding Domain; an alternate calculation	603	X
17635	solution structure of FUS/TLS RRM domain	1220	X
17636	1H, 13C, and 15N NMR resonance assignments of reduced full length and shortened forms of the Grx domain of Mus musculus TGR	1400	X
17637	1H, 13C, and 15N NMR resonance assignments of reduced full length and shortened forms of the Grx domain of Mus musculus TGR	1121	X
17638	NMR Structure of the Complete Internal Fusion Loop from Ebolavirus GP2 at pH 5.5	523	X
17639	NMR Structure of the Complete Internal Fusion Loop from Ebolavirus GP2 at pH 7.0	642	X
17640	EL222(14-222)	1259	X
17641	Assigment of the 1H, 13C, and 15N resonances of the yeast frataxin (Yfh1) under heat denaturation (50 C)	875	X
17642	Solution structure of the N-terminal domain of huntingtin (htt17) in 50 % TFE	74	X
17643	Backbone 1H, 13C, and 15N Chemical Shift Assignments for full-length YtvA from Bacillus subtilis	1381	X
17644	Solution structure of the N-terminal domain of huntingtin (htt17) in presence of DPC micelles	72	X
17645	Solution structure of myosin VI lever arm extension	1025	X
17646	Solution structure of the N-terminal domain of human anamorsin	2027	X
17647	Backbone 13C, 15N, 1H chemical shift assignment of a thermostable mutant "6B" of a Lipase from Bacillus Subtilis	729	X
17648	Partial 13C,15N chemical shift assignments of A30P alpha-synuclein fibrils	58	X
17649	Partial 13C, 15N chemical shift assignments of A53T alpha-synuclein fibrils	58	X
17650	1H, 13C, and 15N resonance assignments and secondary structure prediction of the full-length transition state regulator AbrB from Bacillus anthracis	1171	X
17651	Solution Structure of Histidine Phosphotransfer Domain of CheA	1419	X
17652	Backbone 1H, 13C, and 15N Chemical Shift Assignments of S108C mutant of phosphomannomutase/phosphoglucomutase	2377	X
17653	solution structure of the mSin3A PAH3-SAP30 SID complex	1959	X
17654	Partial 13C, 15N chemical shift assignments of E46K alpha-synuclein fibrils	57	X
17655	Structure of Human Telomeric DNA in Crowded Solution	189		X
17656	1H, 13C and 15N NMR assignments of inactive form of P1 endolysin Lyz	1604	X
17657	Solution structure of the estrogen receptor-binding stapled peptide SP2 (Ac-HKXLHQXLQDS-NH2)	95	X
17658	Solution structure of the estrogen receptor-binding stapled peptide SP1 (Ac-HXILHXLLQDS-NH2)	96	X
17659	Solution structure of the estrogen receptor-binding stapled peptide SP6 (Ac-EKHKILXRLLXDS-NH2)	122	X
17660	Backbone 1H, 13C, and 15N Chemical Shift Assignments for LmrA-NBD	1218	X
17661	Solution structure of the long sarafotoxin srtx-i3	170	X
17662	Solution structure of the long sarafotoxin srtx-m	160	X
17663	HVS ORF57 56-140 backbone assignment	526	X
17664	HVS ORF57 103-120 backbone assignment	228	X
17665	human alpha synuclein construct	1054	X
17667	1H, 13C & 13N chemical shift assignments for Toxoplasma gondii Microneme protein 4 (MIC4) residues 410-491 (apple domain 5)	840	X
17668	NMR solution structure of ZiaAN sub mutant	1014	X
17669	1H Chemical Shift Assignments and structure of Trp-Cage mini-protein with D-amino acid	140	X
17670	Solution NMR Structure of Protein AAur_3427 from Arthrobacter aurescens, Northeast Structural Genomics Consortium Target AaR96	2093	X
17671	Solution NMR Structure of the HIV-1 Exon Splicing Silencer 3	341			X
17672	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Human Just Another Zinc Finger Protein residues 228-277	94	X
17673	Not Available	903	X
17674	Solution structure of FGF1-SSR128129E	1170	X
17675	Backbone 1H,15N,13C and 13CB chemical shifts of folded state and denatured state for the N-terminal domain of ribosomal protein L9 (NTL9) V3AI4A double mutant	632	X
17678	HRas166*GppNHp backbone chemical shift assignments	644	X
17679	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Human Just Another Zinc Finger Protein residues 168-227	223	X
17680	Solution structure of Helix-RING domain in the Tyr363 phosphorylated form.	990	X
17681	Solution Structure of a Short-chain LaIT1 from the Venom of Scorpion Liocheles australasiae	350	X
17682	The 912-888 alternate conformation for helix 27 of E.coli 16S rRNA	204			X
17683	Solution NMR Structure of Heat shock factor protein 1 DNA binding domain from homo sapiens, Northeast Structural Genomics Consortium Target HR3023C	1478	X
17685	Solution structure of the C-terminal Pdr1 activating domain of Zuo1	1082	X
17686	Solution structure of the RMM-CTD domains of human LINE-1 ORF1p	2086	X
17687	PARP BRCT Domain	1095	X
17688	Solution NMR Structure of Tfu_2981 from Thermobifida fusca, Northeast Structural Genomics Consortium Target TfR85A	1770	X
17689	Novel dimeric structure of phage phi29-encoded protein p56: Insights into Uracil-DNA glycosylase inhibition	449	X
17690	N-terminal regulatory segment of carnitine palmitoyltransferase 1A	330	X
17691	Solution structure of the HMG box DNA-binding domain of human stem cell transcription factor Sox2	982	X
17692	backbone resonance assignment of the DMSO-d6 denatured DLC8	528	X
17693	RRM domain of mRNA export adaptor REF2-I bound to HVS ORF57 peptide	1610	X
17694	1H, 15N and 13C backbone and side-chain assignments of a family 32 carbohydrate-binding module (CBM32) from the Clostridium perfringens NagH	1735	X
17695	Backbone Chemical Shift Assignments of the Extracellular domain of GLIC, a prokaryotic nAChR homologue	642	X
17697	Structure of a dimeric all-parallel-stranded G-quadruplex stacked via the 5'-to-5' interface	127		X
17698	HP67 H41F	140	X
17699	SOLUTION NMR STRUCTURE OF THE S4S5 LINKER OF HERG POTASSIUM CHANNEL	128	X
17700	13C, 15N Chemical shifts of E. coli thioredoxin using solid-state nmr spectroscopy	593	X
17701	20 NMR solution structures of Bacillus subtilis L,D-transpeptidase refined in water	2090	X
17702	The protein complex for DNA replication	1259	X
17703	Backbone and stereo-specific Ile(d1), Leu, Val methyl sidechain chemical shift assignments of RDE-4 (1-243)	1440	X
17704	RAGEC2-S100A13 tetrameric complex	991	X
17705	na1	1002	X
17706	na2	1024	X		X
17707	na3	1034	X		X
17708	Solution-state structures of monomeric and dimeric G-quadruplexes adopted by a sequence from N-myc	130		X
17709	Solution-state structures of monomeric and dimeric G-quadruplexes formed by a sequence from N-myc	115		X
17710	Membrane protein complex DsbB-DsbA structure by joint calculations with solid-state NMR and X-ray experimental data	1544	X
17711	Solution structure of the core SMN-Gemin2 complex	2536	X
17713	Fpr4p PPIase domain	1511	X
17714	human prion protein mutant HuPrP(90-231, M129, V210I)	1536	X
17715	Itch WW domain 2	498	X
17716	Structure of Cu(I)Cu(II)-CopK from Cupriavidus metallidurans CH34	720	X
17717	Monomeric Mouse ApoAI(1-216)	2253	X
17719	Solution structure of esophageal cancer-related gene 2	799	X
17720	Solution Structure of N-terminal Cytosolic Domain of Rhomboid Intramembrane Protease from Escherichia Coli	713	X
17721	Backbone (1H, 13C, 15N) Chemical Shifts for the two tandem Calcium Binding Domains (CBD12) of the Na+/Ca2+ exchanger in the absence of Calcium	1046	X
17722	Backbone (1H,13C,15N) chemical shifts for the two tandem Calcium Binding Domains (CBD12) of the Na+/Ca2+ exchanger in the Ca2+-bound state	837	X
17723	Chemical Shift Assignment and Solution Structure of ChR145 from Cytophaga Hutchinsonii. Northeast Structural Genomics Consortium Target ChR145.	1699	X
17724	Micelle-bound KSR1 CA1CA1a	553	X
17725	KSR1(1-170)	1338	X
17726	conotoxin pc16a	98	X
17727	3D ssNMR structure of membrane embedded KcsA-Kv1.3 channel (Closed state)	311	X
17728	13C and 15N Chemical Shift Assignments for the fd Bacteriophage	245	X
17729	Structure of the DNA complex of the C-Terminal domain of Ler	847	X	X
17731	Structural Plasticity of Paneth cell alpha-Defensins: Characterization of Salt-Bridge Deficient Analogues of Mouse Cryptdin-4	205	X
17732	Complex of the C-terminal WRKY domain of AtWRKY4 and a W-box DNA	815	X	X
17733	Solution structure of (R7G)-Crp4	188	X
17734	Solution NMR structure of N-terminal domain of Salmonella effector protein PipB2. Northeast structural genomics consortium (NESG) target stt318a	1644	X
17735	Solution structure of sf3636, a two-domain unknown function protein from Shigella flexneri 2a, determined by joint refinement of NMR, residual dipolar couplings and small-angle X-ray scatting, NESG target SfR339/OCSP target sf3636	1527	X
17736	Solution NMR structure of the AHSA1-like protein CHU_1110 from Cytophaga hutchinsonii, Northeast Structural Genomics Consortium Target ChR152.	2128	X
17737	Solution NMR structure of HopPmal_281_385 from Pseudomonas syringae pv. maculicola str. ES4326, Midwest Center for Structural Genomics target APC40104.5 and Northeast Structural Genomics Consortium target PsT2A	1268	X
17738	Structure of a monomeric mutant of the HIV-1 capsid protein	2600	X
17739	Solution NMR structure of HopABPph1448_220_320 from Pseudomonas syringae pv. phaseolicola str. 1448A, Midwest Center for Structural Genomics target APC40132.4 and Northeast Structural Genomics Consortium target PsT3A	1135	X
17740	Backbone 1H, 13C, 15N assignment of Hck kinase regulatory segment	822	X
17741	Q436	1387	X
17742	R458	1630	X
17743	Backbone 1H, 13C and 15N chemical shift assignments for the N-terminal domain of insulin-like growth factor binding protein-2 (IGFBP-2)	394	X
17744	3D ssNMR structure of membrane embedded KcsA-Kv1.3 channel (Inactivated state)	289	X
17745	NMR Assignment of PFV RNase H domain	1748	X
17746	Oligonucleotide duplex contaning (5'S)-8,5'-cyclo-2'-deoxyguansine	160		X
17747	Solution NMR Structure of Fumarate reductase flavoprotein subunit from Lactobacillus plantarum, Northeast Structural Genomics Consortium Target LpR145J	1899	X
17748	Solution NMR Insights into Docking Interactions Involving Inactive ERK2	941	X
17749	Solution NMR structure of Diiron protein in presence of 2 eq Zn2+, Northeast Structural Genomics Consortium Target OR21	1402	X
17750	Solution NMR structure of N-terminal domain of human E3 ubiquitin-protein ligase HECW2. Northeast structural genomics consortium (NESG) target ht6306a	1433	X
17751	Solution structure of Diiron protein in presence of 8 eq Zn2+, Northeast Structural Genomics consortium target OR21	1395	X
17752	SOLUTION STRUCTURE OF THE HUMAN PROLACTIN RECEPTOR ECD DOMAIN D2	1470	X
17753	Solution NMR Structure of the Helix-loop-Helix Domain of Human ID3 Protein, Northeast Structural Genomics Consortium Target HR3111A	676	X
17754	Solution NMR structure of a MucBP domain (fragment 187-294) of the protein LBA1460 from Lactobacillus acidophilus, Northeast structural genomics consortium target LaR80A	1461	X
17755	1H, 13C, and 15N resonance assignments of human regenerating family I-alpha protein (Reg I-alpha)	1533	X
17756	Backbone 1H and 13C Chemical Shift Assignments of human prion protein (residues 121-230) in its oxidized state	431	X
17757	Backbone 1H and 13C Chemical Shift Assignments of human prion protein (residues 121-230) in its reduced state	431	X
17758	Backbone 1H and 13C Chemical Shift Assignments of murine prion protein (residues 121-232) in its oxidized state	376	X
17759	Backbone 1H and 13C Chemical Shift Assignments of murine prion protein (residues 121-232) in its reduced state	401	X
17760	backbone resonance assignments of p53 N-terminal transactivation domain (1-93)	385	X
17761	Backbone 1H, 13C, 15N and 13CB assignment of N-terminal Domain of Ribosomal Protein L9 (NTL9) Denatured State in 8.3M Urea	323	X
17762	Solution structure of the monomeric derivative of BS-RNase	1116	X
17763	NMR solution structure of native TdPI-short	356	X
17764	A partially folded structure of amyloid-beta(1 40) in an aqueous environment	254	X
17765	Identification of the key regions that drive functional amyloid formation by the fungal hydrophobin EAS	420	X
17766	Secondary structure of subunit E (E133-222) from Saccharomyces cerevisiae V1VO ATPase	926	X
17767	NMR structure of cl-BABP/SS complexed with glycochenodeoxycholic and glycocholic acids	1500	X
17768	Structure of bacteriophage SPP1 gp17 protein	1092	X
17769	UBIQUITIN NMR STRUCTURE	1001	X
17770	Sequence specific backbone resonance assignment of Vitamin D receptor ligand binding domain (VDRLBD) complexed with 1,25(OH)2 D3 and LXXLL motif (DRIP205)	1187	X
17771	Resonance Assignments of Calmodulin Complexed with the Calmodulin-Binding Domain of Olfactory Nucleotide Gated Ion Channel	3997	X
17772	Solution structure of the RING finger-like domain of Retinoblastoma Binding Protein-6 (RBBP6)	1027	X
17773	Backbone (1)H, (13)C and (15)N NMR chemical shift assignments for the human DGCR8 core	984	X
17774	Antiparallel beta-sheet structural model for Iowa-mutant beta-amyloid fibrils	74	X
17775	Solution structure of the chimeric Af1503 HAMP- EnvZ DHp homodimer	1326	X
17776	Solution structure of the chimeric Af1503 HAMP- EnvZ DHp homodimer; A219F variant	1115	X
17777	Solution structure of the N-terminal domain of the Shigella type III secretion protein MxiG	834	X
17779	NMR structure of the intermediate IIIb of the TdPI-short	355	X
17780	Human prion protein with E219K protective polymorphism	1536	X
17781	structure of	1016	X
17782	lsm57	540	X
17783	Solution Structure of the SPOR domain from E. coli DamX	1283	X
17784	NMR structure of the PhyRSL-NepR complex from Sphingomonas sp. Fr1	2458	X
17785	KRas171*GppNHp backbone chemical shift assignments	614	X
17786	Structure of the duplex when (5'S)-8,5'-cyclo-2'-deoxyguanosine is placed opposite dT	167		X
17787	Structure of the duplex when (5'S)-8,5'-cyclo-2'-deoxyguanosine is placed opposite dA	164		X
17788	Minor conformer of the DNA-peptide conjugate bridged by trimethylene tether	187	X	X
17789	structure of the duplex containing (5'S)-8,5'-cyclo-2'-deoxyadenosine	171		X
17790	Structure of the duplex containing HNE derived (6S,8R,11S) N2-dG cyclic hemiacetal when placed opposite dT	137		X
17791	Structure of the duplex containing HNE derived (6S,8R,11S) gamma-HO-PdG when placed opposite dT	131		X
17792	3D solution structure of antimicrobial peptide aurelin	401	X
17793	Backbone chemical shift assignments for Ab42 with Met35 in its oxidized state	201	X
17794	Backbone chemical shift assignments for Ab42 with Met35 in its reduced state	201	X
17795	Backbone chemical shift assignments for A 40 with Met35 in its oxidised state	196	X
17796	Backbone chemical shift assignments for A 40 with Met35 in its reduced state	196	X
17797	1H Chemical Shift Assignments for Chicken AvBD2 defensin	237	X
17798	1H Chemical Shift Assignments for chicken AvBD2-K31A mutant	226	X
17799	NMR structure of the protein YP_001302112.1 from Parabacteroides distasonis	1396	X
17803	Human Insulin Mutant A22Gly-B31Arg	509	X
17804	1H, 15N and 13C backbone resonance assignments of alpha1-antitrypsin	2519	X
17805	THE HIGH RESOLUTION STRUCTURE OF UBIQUITIN LIKE DOMAIN OF UBLCP1	971	X
17806	NMR structure of the calcium-bound form of the protein YP_001302112.1 from Parabacteroides distasonis	1518	X
17807	Solution structure of Ca2+/calmodulin complexed with a peptide representing the calmodulin-binding domain of L-selectin	869	X
17808	Structure of PHD domain of UHRF1 in complex with H3 peptide	792	X
17809	Solution NMR structure of the AHSA1-like protein AHA_2358 from Aeromonas hydrophila refined with NH RDCs. Northeast Structural Genomics Consortium Target AhR99.	1666	X
17810	Atomic Resolution Protein Structures using NMR Chemical Shift Tensors	342	X
17811	Solution structure of MsPTH	2093	X
17812	NMR STRUCTURE OF UHRF1 PHD DOMAINS IN A COMPLEX WITH HISTONE H3 PEPTIDE	800	X
17813	NMR structure of the UHRF1 PHD domain	688	X
17814	Structure of DNA Containing an Aristolactam II-dA Lesion.	82		X
17815	Backbone 1H, 13C and 15N resonance assignments for IMP1 KH34	682	X
17816	lactococcin 972	423	X
17817	Green Proteorhodopsin - Deuterated	352	X
17818	Solution NMR structure of a FKBP-type peptidyl-prolyl cis-trans isomerase from Giardia lamblia. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target GilaA.00840.a	1220	X
17819	Backbone 1H, 13C, 15N assignment of Hck kinase regulatory segment complex with full length Nef	551	X
17820	Backbone resonance assignments for IsdH-N2N3	1462	X
17821	Human C30S/C59S-Cox17 mutant	519	X
17822	Backbone 1H, 13C, and 15N Chemical Shift Assignments for QFM(Y)F	1664	X
17823	1H Chemical Shift Assignments for the hen egg beta-defensin Gallin	289	X
17824	Rbx1	848	X
17825	Solution Structure of the J Domain of HSJ1a	618	X
17826	Galectin-7	2933	X
17827	1H, 13C, and 15N Chemical Shift Assignments for Kindle-2 N-terminus	1082	X
17828	Ubiquitin-like domain from HOIL-1	1114	X
17829	FVIII C2 Domain	730	X
17830	1H, 13C and 15N Resonance Assignments for Oxidised and Reduced nDsbD fromm Escherichia coli	1374	X
17831	1H, 13C and 15N resonance assignments for oxidised and reduced nDsbD from Escherichia coli	1340	X
17832	1H, 15N and 13C resonance assignments for the N-terminal dimeric region of budding yeast histone chaperone Rtt106	803	X
17833	Skint1 IgV	1164	X
17834	Syrian hamster prion protein with thiamine	284	X
17835	NOT AVAILABLE	1018	X
17836	The assigned chemical shifts for the disordered forms of apo-IscU	659	X
17837	The assigned chemical shifts for the structured forms of apo-IscU	256	X
17838	Solution structure of C2B with IP6	1840	X
17839	Ga98 solution structure	603	X
17840	GB98 solution structure	615	X
17841	GB98-T25I,L20A	656	X
17842	Solution structure of outer membrane protein H (OprH) from P. aeruginosa in DHPC micelles.	787	X
17843	GB98-T25I solution structure	240	X
17844	The assigned chemical shifts of disordered-IscU complexed with IscS	231	X
17845	Backbone 1H, 13C, and 15N chemical shift assignments of oxidized yeast iso-1 cytochrome c	770	X
17846	Backbone 1H, 13C, and 15N chemical shift assignments of reduced yeast iso-1 cytochrome c	771	X
17847	Backbone 1H, 13C, and 15N chemical shift assignments of oxidized horse heart cytochrome c	730	X
17848	Backbone 1H, 13C, and 15N chemical shift assignments of reduced horse heart cytochrome c	738	X
17849	Solution structure of Ca2+-bound yCaM	1474	X
17850	Solution structure of Ca2+/CNA1 peptide-bound yCaM	2204	X
17851	Backbone 1H, 15N, 13C assignments for beta phosphoglucomutase in a binary complex with BeF3-	1059	X
17852	Backbone 1H, 15N, 13C assignments for beta phosphoglucomutase in a ternary complex with glucose-6-phosphate and BeF3-	1052	X
17853	Backbone and sidechain 1H 13C and 15N chemical shift assignement of the catalytic domain from	1680	X
17855	Backbone 1H, 13C, and 15N Chemical Shift Assignments for high mobility group protein-like protein NHP1 from Babesia bovis T2Bo. Seattle Structure Genomics Center for Infectious Disease (SSGCID)	1019	X
17856	Structural analysis of a chaperone in type III secretion system	481	X
17857	Chemical Shift Assignments and solution structure of human apo-S100A1 E32Q mutant	1179	X
17858	RNA-binding zinc finger protein	878	X
17859	Solution Structure of a DNA duplex Containing an Unnatural, Hydrophobic Base Pair	155		X
17860	high resolution NMR solution structure of helix H1 of the chimpanzee HAR1 RNA	282			X
17861	high resolution NMR solution structure of helix H1 of the human HAR1F RNA	277			X
17862	Solution structure of Staphylococcus aureus IsdH linker domain	1007	X
17863	Rv0899 from Mycobacterium tuberculosis contains two seperated domains	2440	X
17864	1H, 13C, and 15N Chemical Shift Assignments for human FAIM-CTD	1013	X
17865	Solution structure of Venturia inaequalis cellophane-induced 1 protein (ViCin1) domains 1 and 2	1406	X
17866	1H,15N and 13C backbone and side chain chemical shifts of human halo S100P	948	X
17867	Structural Insight into the Unique Cardiac Myosin Binding Protein-C Motif: A Partially Folded Domain	608	X
17868	Mucin sequence based on MUC2 Mucin glycoprotein tandem repeat	85	X
17869	Tri-O-GalNAc glycosylated Mucin sequence based on MUC2 Mucin glycoprotein tandem repeat	85	X
17870	Di-O-GalNAc glycosylated Mucin sequence based on MUC2 Mucin glycoprotein tandem repeat	80	X
17871	Di-O-GalNAc glycosylated Mucin sequence based on MUC2 Mucin glycoprotein tandem repeat	85	X
17872	Di-O-GalNAc glycosylated Mucin sequence based on MUC2 Mucin glycoprotein tandem repeat	87	X
17873	Mono-O-GalNAc glycosylated Mucin sequence based on MUC2 Mucin glycoprotein tandem repeat	85	X
17874	Mono-O-GalNAc glycosylated Mucin sequence based on MUC2 Mucin glycoprotein tandem repeat	92	X
17875	Mono-O-GalNAc glycosylated Mucin sequence based on MUC2 Mucin glycoprotein tandem repeat	92	X
17876	STRUCTURAL AND FUNCTIONAL ANALYSIS OF A NOVEL POTASSIUM TOXI ARGENTINEAN SCORPION TITYUS TRIVITTATUS REVEALS A NEW KAPPA SUB-FAMILY	185	X
17877	Solution structure of a shortened antiterminator hairpin from a Mg2+ riboswitch	232			X
17878	Backbone 1H, 13C, and 15N Chemical Shift Assignments for La(4-325)	1207	X
17879	NMR structure of Atg8-Atg7C30 complex	1946	X
17880	1H, 13C, and 15N Chemical Shift Assignments for a yeast protein	898	X
17881	Dynamics of isolated C domain of calmodulin apo form	142	X
17882	Solution Structure of CssII	391	X
17883	The solution structure of the Lin28-ZnF domains bound to AGGAGAU of pre-let-7 miRNA	705	X		X
17884	METAL BINDING DOMAIN OF RAT BETA-AMYLOID	142	X
17885	Solution NMR structure of a DNA dodecamer containing the 7-aminomethyl-7-deaza-2'-deoxyguanosine adduct	73		X
17886	Backbone chemical shift assignments of holo-acyl carrier protein of Leishmania major	935	X
17887	DNA sequence context conceals alpha anomeric lesion	251		X
17888	NMR Structure of the Polyserine Tract of Apis mellifera Vitellogenin, residues 358-392	223	X
17889	The polyserine tract of Nasonia vitripennis Vg residues 351-385	259	X
17890	NMR structure of the lectin CCL2 (free)	1755	X
17891	Solution Structure of KKGF	239	X
17892	NOE-based 3D structure of the CylR2 homodimer at 298K	849	X
17893	NOE-based 3D structure of the CylR2 homodimer at 270K (-3 Celsius degrees)	845	X
17894	NOE-based 3D structure of the predissociated homodimer of CylR2 in equilibrium with monomer at 266K (-7 Celsius degrees)	717	X
17895	NOE-based 3D structure of the monomer of CylR2 in equilibrium with predissociated homodimer at 266K (-7 Celsius degrees)	717	X
17896	NOE-based 3D structure of the monomeric intermediate of CylR2 at 262K (-11 Celsius degrees)	674	X
17897	NOE-based 3D structure of the monomeric partially-folded intermediate of CylR2 at 259K (-14 Celsius degrees)	616	X
17898	NOE-based 3D structure of the monomeric partially-folded intermediate of CylR2 at 257K (-16 Celsius degrees)	674	X
17899	1H, 13C and 15N NMR assignments of the aciniform spidroin (AcSp1) repetitive domain of Argiope trifasciata wrapping silk	1989	X
17900	Solution NMR Structure of BfR322 from Bacteroides fragilis, Northeast Structural Genomics Consortium Target BfR322	1491	X
17901	Partial 1H, 13C, 15N Chemical Shift Assignments for the U6 Spliceosomal snRNA 5' Stem-Loop 30-mer Construct.	65			X
17902	Solution structure of CCL2 in complex	1796	X			X
17903	NMR Solution Structure of Yeast Iso-1-cytochrome c Mutant P71H in oxidized states	616	X
17904	NMR Solution Structure of Yeast Iso-1-cytochrome c Mutant P71H in reduced states	616	X
17905	1H, 13C and 15N resonance assignment of the Anticodon Binding Domain of Human Lysyl Aminoacyl tRNA Synthetase	1362	X
17906	NMR structure of holo-ACPI domain from CurA module from Lyngbya majuscula	1214	X
17907	NMR structure of HMG-ACPI domain from CurA module from Lyngbya majuscula	1214	X
17908	Solution structure Analysis of the ImKTx104	162	X
17909	Resonance assignments of human Steroidogenic acute regulatory-related lipid transfer domain protein 5	1239	X
17910	WT alpha-synuclein fibrils in the presence of phospholipid vesicles	231	X
17911	C-terminal domain of SARS-CoV main protease	1284	X
17912	The third SH3 domain of R85FL	691	X
17913	The third SH3 domain of R85FL with ataxin-7 PRR	558	X
17914	Integral membrane core domain of the mercury transporter MerF in lipid bilayer membranes	165	X
17915	PFBD: High-throughput Strategy of Backbone fold Determination for small well-folded proteins in less than a day	232	X
17916	Backbone assignments for the C-terminal domain of yeast Tfg2	535	X
17917	Backbone chemical shift assignments for the C-terminal domain of yeast Tfg1.	364	X
17918	Solution structure of the TbPIN1	1364	X
17919	Description of the structural fluctuations of proteins from structure-based calculations of residual dipolar couplings	426	X
17920	Assignment of filamentous full-length tau	669	X
17921	Partial 1H, 15N Chemical Shift Assignments of a GAAA Tetraloop Receptor Variant.	54			X
17922	Backbone 1H, 13C, 15N assignment of HIV-1 accessory protein Nef	818	X
17923	3D solution structure of plant defensin Lc-def	385	X
17924	SEVI	244	X
17925	SEVI with Zn	182	X
17926	PARTIAL 3D STRUCTURE OF THE C-TERMINAL PART OF THE FREE ARAB THALIANA CP12-2 IN ITS OXIDIZED FORM	518	X
17927	Solution Structure of a putative thiol-disulfide oxidoreductase from Bacteroides vulgatus	1804	X
17928	Structure of the influenza AM2-BM2 chimeric channel	78	X
17929	Structure of the influenza AM2-BM2 chimeric channel bound to rimantadine	62	X
17930	monophosphorylated (747pY) beta3 integrin cytoplasmic tail under membrane mimetic conditions	593	X
17931	biphosphorylated (747pY, 759pY) beta3 integrin cytoplasmic tail under membrane mimetic conditions	590	X
17932	monophosphorylated (747pY) beta3 integrin cytoplasmic tail under aqueous conditions	369	X
17934	AIDA1 PTB domain	1553	X
17935	1H, 13C, 15N assignment and secondary structure determination of GATase subunit of GMP Synthetase from Methanococcus jannaschii	1437	X
17936	N/A	897	X
17937	Solid-state Chemical Shift Assignments for CAP-Gly Domain of Mammalian Dynactin	412	X
17938	Solution Chemical Shifts Assignments of 1H, 13C, and 15N for CAP-Gly	633	X
17939	a protein from Haloferax volcanii	492	X
17940	1H, 13C and 15N backbone resonance assignment of the activated p38 mitogen-activated protein kinase	967	X
17941	the structure of subdomain IV-B from the CVB-3 IRES	471			X
17942	1H, 13C and 15N resonance assignment of a complex constisting of hDlg/SAP-97 residues 318-406 and HPV type 51 E6 protein residues 141-151	1308	X
17943	1H, 13C and 15N NMR assignment of CGC-19, a single domain proteic constituent of a non ribosomal peptide synthetase.	1504	X
17944	13C, 15N Chemical shifts of the C-terminal fragment of E. coli thioredoxin reassembly using solid-state NMR spectroscopy	186	X
17945	NMR backbone assignment of a Tau protein fragment	412	X
17946	Aliphatic 1H, 13C, and 15N chemical shift assignments of dihydrofolate reductase from the psychropiezophile Moritella profunda in complex with NADP+ and folate	1896	X
17947	Partial backbone 1H assignments of the 2/2 hemoglobin from the cyanobacterium Synechococcus sp. PCC 7002 in the ferrous bis-histidine state	364	X
17948	NMR structure of Hsp12 in the presence of DPC	862	X
17949	Solution Structure of CssII	413	X
17950	Solution structure of DNA binding domain of AtTRB2	746	X
17952	Backbone 1H, 13C, and 15N Chemical Shift Assignments for E.coli Ribonuclease P protein	988	X
17953	NMR Structure of protoporphyrin-IX bound murine p22HBP	1836	X
17955	(C9S, C14S)-leucocin A	386	X
17956	Solution structure of MCoTI-V	179	X
17957	1H, 13C and 15N chemical shifts assignments of BA42 from Bizionia argentinensis	1770	X
17958	C9L,C14L-LeuA	356	X
17959	Backbone and side chain 1H, 13C, and 15N assignments of the ubiquitin-like domain of human HOIL-1L	1438	X
17960	Complete 1H, 13C and 15N assignments of the kinetochore localisation domain of BUBR1 bound to a Blinkin motif	1920	X
17961	S. cerevisiae U2/U6 snRNA complex	194			X
17962	Solution structure of putative oxidoreductase from Ehrlichia chaffeensis. (Seattle Structural Genomics Center for Infectious Disease (SSGCID))	951	X
17963	Solution structure of Rhodostomin G50L mutant	457	X
17964	Backbone 1H, 13C, and 15N Chemical Shift Assignment for inactive HIV-1 protease CRF01_AE	352	X
17965	Solution NMR structure of Alr2454 protein from Nostoc sp. strain PCC 7120, Northeast Structural Genomics Consortium Target NsR264	1409	X
17966	PDGFR beta-TM	475	X
17967	Structure of the monomeric N-terminal domain of HPV16 E6 oncoprotein	901	X
17968	Haddock model structure of the N-terminal domain dimer of HPV16 E6	891	X
17969	Solution structure and binding studies of the RanBP2-type zinc finger of RBM5	214	X
17970	Solution structure and binding studies of the RanBP2-type zinc finger of RBM5	214	X
17971	Solution NMR structure of homeobox domain (171-248) of human homeobox protein TGIF1, Northeast Structural Genomics Consortium Target HR4411B	1082	X
17972	U2/U6 Helix I	247			X
17973	Onconase zymogen FLG variant	1436	X
17974	Structural and mechanistic insights into the interaction between PAT Pyk2 and Paxillin LD motif	1579	X
17975	PPARgamma LBD complexed with rosiglitazone	1240	X
17976	PPARgamma LBD complexed with MRL24	884	X
17977	PPARgamma LBD complexed with MRL20	838	X
17978	Backbone and sidechain 1H, 13C and 15N chemical shift assignments of the hydrophobin MPG1 from the rice blast fungus Magnaporthe oryzae	1130	X
17979	Solution structure of the Zn(II) form of Desulforedoxin	231	X
17980	Monomer-dimer equilibrium for 5 -5 stacking of propeller-type parallel-stranded G-quadruplexes: NMR structural study	159		X
17981	Dynamics of isolated C domain of calmodulin complexed with PEP-19 in the absence of Ca2+	138	X
17982	Dynamics of isolated C domain of calmodulin complexed with Ca2+	142	X
17983	Dynamics of isolated C domain of calmodulin complexed with PEP-19 in the presence of Ca2+	130	X
17985	Structure of BST-2/Tetherin Transmembrane Domain	70	X
17986	Solution structure of cyclic gomesin peptide	105	X
17987	New tricks of an old fold: structural versatility of scorpion toxins with common cysteine spacing	192	X
17988	Evolutionary diversification of Mesobuthus {alpha}-scorpion toxins affecting sodium channels.	420	X
17989	NMR resonance assignment of the UUP protein C-terminal domain	1362	X
17990	STRUCTURES AND INTERACTIONS ANALYSES OF THE INTEGRIN ALPHA-M BETA-2 CYTOPLASMIC TAILS	154	X
17991	WSA major conformation	1306	X
17992	WSA minor conformation	1306	X
17993	A coiled-coil scaffold for GPCR loop investigations	913	X
17994	Backbone 1H, 13C, and 15N Chemical Shift Assignment for inactive HIV-1 protease Bmut5	353	X
17995	Solution NMR structure of holo acyl carrier protein NE2163 from nitrosomonas europaea. Northeast structural genomics consortium target NET1	1001	X
17996	Backbone 1H, 13C, and 15N Chemical Shift Assignment for inactive HIV-1 protease subtype C	359	X
17997	Solution structure of the Cd(II) form of Desulforedoxin	234	X
17998	Resonance assignments of the PPIase domain of FKBP42 from Arabidopsis thaliana	1022	X
17999	Chemical Shift Assignments from PfEMP1: Full-length	1883	X
18000	Structural Basis for Molecular Interactions Involving MRG Domains: Implications in Chromatin Biology	2461	X
18001	1H, 13C and 15N chemical shift assignments of the PPIase domain of human aryl-hydrocarbon receptor-interacting protein (AIP)	2069	X
18002	Structural Basis of Phosphoinositide Binding to Kindlin-2 Pleckstrin Homology Domain in Regulating Integrin Activation	1169	X
18003	solution structure of apo-NmtR	1469	X
18004	Structural and functional analysis of the DEAF-1 and BS69 MYND domains	511	X
18005	TBA	716	X
18006	TBA	690	X
18007	TBA	715	X
18008	TBA	689	X
18009	NMR structure of the lambda 5 22-45 peptide	159	X
18010	FF11-60	622	X
18011	NMR assignments for TB24	2280	X
18012	Solution structure of N-terminal domain of human TIG3	1284	X
18013	Staphylococcal Nuclease PHS variant	1847	X
18014	A Myristoylated Polyproline Type II Helix Functions as a Novel Fusion Peptide During Cell-Cell Membrane Fusion Induced by the Baboon Reovirus p15 FAST Protein	144	X
18015	Chemical shift assignments for the homeodomain of Pitx2 in complex with a TAATCC DNA binding site	833	X	X
18016	Solution structure of MSMEG_1053, the second DUF3349 annotated protein in the genome of Mycobacterium smegmatis. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target MysmA.17112.b	1305	X
18017	The solution structure of RRM	1102	X
18018	NMR structure of the putative ATPase regulatory protein YP_916642.1 from Paracoccus denitrificans	1051	X
18019	High-resolution solution structure of the orally active insecticidal spider venom peptide U1-TRTX-Sp1a	290	X
18020	Backbone 1H, 13C, and 15N Chemical Shift Assignments of Apo Human Integrin Alpha1 I-domain	890	X
18021	Backbone 1H, 13C, and 15N Chemical Shift Assignments of Mg2+ bound Human Integrin Alpha1 I-domain	902	X
18022	Structure of the Cx43 C-terminal domain bound to tubulin	164	X
18023	Cyclo-TC1 Trp-cage	124	X
18024	13C and 15N chemical shift assignments of cAMP bound Cyclic Nucleotide-Binding Domain from a bacterial Cyclic Nucleotide-Gated channel	552	X
18025	hUBR2 ubr-box assigments	128	X
18026	Backbone Chemical Shift Assignments for Unmyristoylated GCAP1 bound to Ca2+ ions	586	X
18027	Solution NMR structure of CaM bound to iNOS CaM binding domain peptide	1579	X
18028	Solution NMR structure of CaM bound to the eNOS CaM binding domain peptide	1150	X
18029	1H, 13C, and 15N Chemical Shift Assignments for sf-ALR	1021	X
18031	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the ribosoaml assembly factor Fap7 from Pyrococcus horikoshii in its AP5A bound form	629	X
18032	Solution NMR structure of the specialized holo-acyl carrier protein RPA2022 from Rhodopseudomonas palustris refined with NH RDCs. Northeast Structural Genomics Consortium Target RpR324.	1229	X
18034	UNAC Tetraloops: To What Extent Can They Mimic GNRA Tetraloops	89			X
18035	UNAC Tetraloops: To What Extent Can They Mimic GNRA Tetraloops	88			X
18036	UNAC Tetraloops: To What Extent Can They Mimic GNRA Tetraloops	89			X
18037	NMR STRUCTURE OF THE IMIPENEM-ACYLATED L,D-TRANSPEPTIDASE FROM BACILLUS SUBTILIS	1851	X
18039	Solution structure ensemble of the two N-terminal apple domains (residues 58-231) of Toxoplasma gondii microneme protein 4	1772	X
18040	DNA TT mismatch and 2,7-BisNP	222		X
18041	Solution structure of the EDC3-LSm domain	1075	X
18042	Structure of EDC3:DCP2	1215	X
18043	The Insect Defensin Lucifensin from Lucilia sericata	330	X
18044	Computational design of an eight-stranded (beta/alpha)-barrel from fragments of different folds	2699	X
18045	1H,13C, and 15N chemical shift assignments for human endothelial monocyte-activating polypeptide II	1761	X
18046	Sixth Gelsolin-like domain of villin	1161	X
18047	NMR structure of the protein NP_814968.1 from Enterococcus faecalis	1614	X
18048	NPM1_C70	590	X
18049	Low resolution structure of RNA-binding subunit of the TRAMP complex	760	X
18050	Structure of a bis-naphthalene bound to a thymine-thymine DNA mismatch	188		X
18051	Solution NMR structure of the N-terminal myb-like 1 domain of the human cyclin-D-binding transcription factor 1 (hDMP1). Northeast Structural Genomics Consortium (NESG) target ID hr8011a.	659	X
18052	Structural analysis of the pyroglutamate modified isoform of the Alzheimer's disease related beta-amyloid using NMR spectroscopy	217	X
18053	Solution NMR structure of C-terminal globular domain of human Lamin-B2. Northeast Structural Genomics Consortium target HR8546A.	1394	X
18054	NH chemical shift assignments for free AbpSH3	130	X
18055	NH chemical shift assignments for free AbpSH3 bound to WT Ark1p peptide	130	X
18056	NH chemical shift assignments for free AbpSH3 bound to WT Ark1p (ArkB) peptide	130	X
18057	NH chemical shift assignments for free AbpSH3 bound to mutant ArkA_H(-6)A peptide	130	X
18058	NH chemical shift Assignments for AbpSH3 bound to truncated ArkA peptide (SI)	130	X
18059	NH chemical shift Assignments for AbpSH3 bound to mutant ArkA peptide (K(-3)A)	130	X
18060	NH chemical shift Assignments for AbpSH3 bound to mutant ArkA peptide (K(-3)R)	120	X
18061	NH chemical shift Assignments for AbpSH3 bound to mutant ArkA peptide (K(-3)V)	120	X
18062	NH chemical shift Assignments for AbpSH3 bound to mutant ArkA peptide (K(3)A)	130	X
18063	NH chemical shift Assignments for AbpSH3 bound to mutant ArkA peptide (L(-7)A)	128	X
18064	NH chemical shift Assignments for AbpSH3 bound to mutant ArkA peptide (L(-7)V)	128	X
18065	NH chemical shift Assignments for AbpSH3 bound to truncated ArkA peptide (ArkA12)	130	X
18066	NH chemical shift Assignments for AbpSH3 bound to mutant ArkA peptide (ArkA_P(-4)A)	130	X
18067	NH chemical shift Assignments for AbpSH3 bound to mutant ArkA peptide (ArkA_P(2)A)	128	X
18068	NH chemical shift Assignments for AbpSH3 bound to mutant ArkA peptide (ArkA_P(2)V)	128	X
18069	NH chemical shift Assignments for AbpSH3 bound to mutant ArkA peptide (ArkA_P(0)A)	130	X
18070	NH chemical shift Assignments for AbpSH3 bound to mutant ArkA peptide (ArkA_P(-1)A)	130	X
18071	NH chemical shift Assignments for AbpSH3 bound to WT Prk1 peptide (ArkA_P(-1)A)	130	X
18072	NH chemical shift Assignments for AbpSH3 bound to mutant Ark1 peptide (ArkA15_H(-6)A_K(-8)A)	130	X
18073	NH chemical shift Assignments for AbpSH3 bound to Abp1 peptide (PRR)	126	X
18074	NH chemical shift Assignments for AbpSH3 bound to WT Scp1 peptide (Scp12)	128	X
18075	NH chemical shift Assignments for AbpSH3 bound to WT Scp1 peptide (Scp17)	128	X
18076	NH chemical shift Assignments for AbpSH3 bound to WT Sjl2 peptide (Sjl17)	130	X
18077	NH chemical shift Assignments for AbpSH3 bound to WT Srv2 peptide (Srv12)	130	X
18078	NH chemical shift Assignments for AbpSH3 bound to WT Srv2 peptide (Srv17)	130	X
18079	UNAC Tetraloops: To What Extent Can They Mimic GNRA Tetraloops	90			X
18080	structure of amyloid precursor protein's transmembrane domain	455	X
18081	Solution structure of Thermus thermophilus apo-CuA	1416	X
18082	SOLUTION NMR-DERIVED STRUCTURE OF CALMODULIN N-LOBE BOUND WITH ER alpha PEPTIDE	530	X
18083	Solution structure of a THP type 1 alpha 1 collagen fragment (772-786)	483	X
18084	SOLUTION NMR-DERIVED STRUCTURE OF CALMODULIN C-LOBE BOUND WITH ER ALPHA PEPTIDE	450	X
18085	Alvinellacin	95	X
18086	GhoS (YjdK) monomer	1119	X
18087	solution structure of human apo-S100A1 C85M	1149	X
18088	Post-translational S-nitrosylation is an endogenous factor fine-tuning human S100A1 protein properties	1073	X
18089	Post-translational S-nitrosylation is an endogenous factor fine-tuning human S100A1 protein properties	1071	X
18090	Solution structure of the yeast Sti1 DP1 domain	941	X
18091	Solution structure of the yeast Sti1 DP2 domain	899	X
18092	Solution structure of the N-terminal domain of human polypeptide chain release factor eRF1	1697	X
18093	NMR structures of the transmembrane domains of the nAChR a4 subunit	1563	X
18094	Solution structure of the AF4-AF9 complex	1285	X
18095	Solution NMR Structure of Lysine-specific demethylase lid from Drosophila melanogaster, Northeast Structural Genomics Consortium Target FR824D	1324	X
18096	NMR structures of the transmembrane domains of the AChR b2 subunit	1499	X
18097	Backbone 1H, 13C, and 15N Chemical Shift Assignments for primate innate immunity protein	810	X
18098	Solution NMR Structure of mitochondrial succinate dehydrogenase assembly factor 2 from Saccharomyces cerevisiae, Northeast Structural Genomics Consortium Target YT682A	1383	X
18099	Solution structure of Ca2+-CIB1 in complex with the cytoplasmic domain of the integrin aIIb subunit	1119	X
18101	1H,15N and 13C backbone and side chain chemical shifts of Human Halo S100A1	1036	X
18102	Structure, Activity and Interactions of the Cysteine Deleted Analog of Tachyplesin-1 with Lipopolysaccharide Micelles	88	X
18103	Backbone resonance assignments for G protein alpha i3 subunit in the GTP-bound state	1674	X
18104	MARCKS MH2 Domain free and mAb 3C3 bounded	93	X
18105	MARCKS MH2 Domain free and mAb 3C3 bounded	205	X
18106	MARCKS MH2 Domain free and mAb 3C3 bounded	202	X
18107	The NMR structure of a major allergen from dust mite	1030	X
18108	13C, 15N solid-state MAS NMR chemical shift assignment for YadA membrane anchor domain.	491	X
18109	1H, 13C and 15N resonance assignment of MmpS4	373	X
18110	Solution Structure of C-terminal RAGE (ctRAGE)	373	X
18111	Structure of T7 transcription factor Gp2-E. coli RNAp jaw domain complex	1374	X
18112	Minimal Constraints Solution NMR Structure of Prospero Homeobox protein 1 from Homo sapiens. Northeast Structural Genomics Consortium Target HR4660B.	1366	X
18113	Sequence-specific 1H, 15N and 13C resonance assigments of Gad m 1: a allergenic parvalbumin from Atlantic Cod (Gadus morhua).	1202	X
18114	Solution structure of human LL-23 bound to membrane-mimetic micelles	257	X
18115	Solution Structure of The C-terminal Domain (537-610) of Human Heat Shock Protein 70	872	X
18118	NMR structure of the protein BC040485 from Homo sapiens	1146	X
18119	ITK-SH3	802	X
18121	1H, 13C, and 15N chemical shift assignments for CdnLNt from Myxoccoccus xanthus	1197	X
18122	1H, 13C, and 15N resonance assignments of Photoactive Yellow Protein	1375	X
18123	Resonance assignments of the 56 kDa chimeric avidin in the biotin-bound and free forms	452	X
18124	Solution Structure of D. radiodurans RecQ HRDC domain 1	872	X
18125	Resonance assignments of the 56 kDa chimeric avidin in the biotin-bound and free forms	1389	X
18126	Backbone Chemical Shifts of the designed protein Z-L2LBT	369	X
18127	Structural Model for a 40-Residue Beta-Amyloid Fibril with Two-Fold Symmetry, Positive Stagger	110	X
18128	Structural Model for a 40-Residue Beta-Amyloid Fibril with Two-Fold Symmetry, Negative Stagger	110	X
18129	Structural Model for a 40-residue Beta-Amyloid Fibril with Three-Fold Symmetry, Positive Stagger	90	X
18130	1H, 13C and 15N chemical shift assignments of thioredoxin 2 from Pseudomonas aeruginosa PAO1 in its reduced form	1296	X
18131	Structural Model for a 40-residue Beta-Amyloid Fibril with Three-Fold Symmetry, Negative Stagger	90	X
18132	THERMOSTABLE PROTEIN FROM HYPERTHERMOPHILIC VIRUS SSV-RH	575	X
18133	1H, 13C, 15N backbone and sidechain of human AK1 from Escherichia coli	2012	X
18134	SOLUTION STRUCTURE OF THE FIRST SAM DOMAIN OF ODIN	879	X
18135	A single GalNAc residue on Threonine-106 modifies the dynamics and the structure of Interferon alpha-2a around the glycosylation site.	2101	X
18137	NMR assignment of the monomeric DUF59 domain of human Fam96a	668	X
18138	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Multi-Drug Resistant HIV-1 Protease Variant, MDR 769	353	X
18141	Solution NMR structure of the novel conotoxin im23a from Conus imperialis	353	X
18142	MOZ	1174	X
18145	Solution NMR Structure of DE NOVO DESIGNED PROTEIN, IF3-like fold, Northeast Structural Genomics Consortium Target OR135 (CASD target)	1016	X
18146	Insight into the antimicrobial activities based on the Structure-activity relationships of coprisin isolated from the Dung Beetle, Copris tripartitus	271	X
18147	Assigned NMR chemical shift of Escherichia coli Ribosome binding factor A	665	X
18148	VEGFR2-Integrin B3 interaction	58	X
18151	1H, 13C, and 15N chemical shift assignments for CdnL from Myxoccoccus xanthus	1787	X
18152	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the catalytic domain of B. anthracis SrtD	1431	X
18153	The solution structure of thermomacin	498	X
18154	apo_YqcA	1628	X
18155	1H, 13C, and 15N chemical shift assignments of the second immunoglobulin domain of the membrane receptor Neurolin from Carassius auratus	1322	X
18156	Solution NMR Structure of the mitochondrial inner membrane domain (residues 164-251), FtsH_ext, from the paraplegin-like protein AFGL32 from Homo sapiens, Northeast Structural Genomics Consortium Target HR6741A	1178	X
18157	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Avirulence homolog-5	529	X
18158	Solution NMR structure of N-terminal domain (6-74) of human ZBP1 protein, Northeast Structural Genomics Consortium Target HR8174A.	909	X
18159	Solution NMR structure of the C-terminal extension of two bacterial light, oxygen, voltage (LOV) photoreceptor proteins from Pseudomonas putida	175	X
18160	Solution NMR structure of the C-terminal extension of two bacterial light, oxygen, voltage (LOV) photoreceptor proteins from Pseudomonas putida	214	X
18161	Solution NMR Structure of DE NOVO DESIGNED PROTEIN, PFK fold, Northeast Structural Genomics Consortium Target OR134	1314	X
18162	Neurotensin 40 structures in water pH 5.5 298 K. NMR data & structures	108	X
18163	Neurotensin 40 structures in DMPC:CHAPS bicelle pH 5.5 298 K, NMR data & structures	108	X
18164	Neurotensin 40 structures in DMPC:CHAPS:GM1 bicelle pH 5.5 298 K, NMR data & structures	111	X
18165	Enterohaemorrhagic E. coli (EHEC) exploits a tryptophan switch to hijack host F-actin assembly	1921	X
18166	Solution NMR Structure of Stress-induced-phosphoprotein 1 STI1 from Homo sapiens, Northeast Structural Genomics Consortium Target HR4403E	1610	X
18167	Solution Structure of Cyanobacterial PsbP (CyanoP) from Synechocystis sp. PCC 6803	1936	X
18169	Solution structure of Ca-bound S100A4 in complex with non-muscle myosin IIA	2776	X
18170	Structure of human CXCR1 in phospholipid bilayers	1114	X
18171	Solution structure of atTic-hip/hop domain (Residue 310-371)	754	X
18175	40-residue D23N beta amyloid fibril	74	X
18176	Backbone chemical shift assignments for the oxidized form of cVIMP-Cys	331	X
18177	Backbone chemical shift assignments for the reduced form of cVIMP-Cys	403	X
18178	Solution structure of AGR2 residues 41-175	928	X
18179	Solution structure of E60A mutant AGR2	1185	X
18180	Solution NMR Structure of the uncharacterized protein from gene locus rrnAC0354 of Haloarcula marismortui. Northeast Structural Genomics Consortium Target HmR11.	2209	X
18181	Solution structure of GspC-HR of typeII secretion system	768	X
18182	Identification and structural basis for a novel interaction between Vav2 and Arap3	1450	X
18183	Identification and structural basis for a novel interaction between Vav2 and Arap3	1368	X
18184	ShB peptide structure bound to negatively charged lipid-bilayer after Molecular Dynamics refinement	54	X
18185	Backbone 1H and 15N Chemical Shift Assignments of the VHS-UIM domains of STAM2	330	X
18186	Solution structure of the Get5 carboxyl domain from S. cerevisiae	762	X
18187	Solution structure of the Get5 carboxyl domain from A. fumigatus	832	X
18188	CohA2	1815	X
18189	DocA	785	X
18190	NMR structure of the protein BC008182, a DNAJ-like domain from Homo sapiens	806	X
18191	Solution structure of Sgf11(63-99) zinc finger domain	421	X
18192	Solution structure of Sgf73(59-102) zinc finger domain	489	X
18193	1H, 13C, and 15N chemical shift assignments for the N-terminal domain of Thermus thermophilus CdnL	1035	X
18194	1H, 13C, and 15N chemical shift assignments for the 72-residue N-terminal domain of Myxococcus xanthus CarD	875	X
18195	NMR Solution Structure of Optineurin Zinc-finger Domain	305	X
18196	Backbone assignment for an intracellular proteinase inhibitor of Bacillus Subtilis	1132	X
18197	rat Angiogenin	1372	X
18198	Chemical Shift Assignment of the PP1 Binding Domain of NIPP1	329	X
18199	Structural Basis for Bifunctional Zn(II) Macrocyclic Complex Recognition of Thymine Bulges in DNA. Structure of a Thymine bulge.	48		X
18200	Resonance assignments for C-terminal DNA-binding domain of RstA protein from Klebsiella pneumonia	1173	X
18201	1H, 13C and 15N resonance assignments of the periplasmic signaling domain of HasR, a TonB-dependent outer membrane heme transporter	1167	X
18202	Backbone and partial sidechain assignment (13C only) of hNaa50p assignment	824	X
18203	NMR solution structure of Mu-contoxin BuIIIB	245	X
18204	Backbone 1H, 13C, and 15N Chemical Shift Assignments for human PEBP1	865	X
18205	PDZ Domain of CAL (Cystic Fibrosis Transmembrane Regulator-Associated Ligand)	301	X
18206	Conotoxin analogue [D-Ala2]BuIIIB	243	X
18207	A53T alpha-synuclein fibrils	229	X
18208	Chemical shift assignments of the E46K alpha-synuclein fibrils	171	X
18209	Solution-state structure of an intramolecular G-quadruplex w th propeller, diagonal and edgewise loops	153		X
18210	Structure of the Plasmodium 6-cysteine s48/45 Domain	1460	X
18211	1H, 15N and 13C resonance assignments for the LOTUS2 and LOTUS3 RNA binding domains of mouse TDRD7	2329	X
18214	Solution NMR structure of TSTM1273 from Salmonella typhimurium LT2, NESG target STT322, CSGID target IDP01027 and OCSP target TSTM1273	761	X
18215	Solution NMR Structure of the uncharacterized protein from gene locus VNG_0733H of Halobacterium salinarium, Northeast Structural Genomics Consortium Target HsR50.	1896	X
18216	NMR structure of an acyl-carrier protein from Rickettsia prowazekii.(Seattle Structural Genomics Center for Infectious Disease (SSGCID))	941	X
18217	Backbone structure of human membrane protein HIGD1A	512	X
18218	Backbone structure of human membrane protein HIGD1B	1003	X
18219	Backbone structure of human membrane protein TMEM14A from NOE data	819	X
18220	Backbone structure of human membrane protein TMEM14A	819	X
18221	Backbone structure of human membrane protein FAM14B (Interferon alpha-inducible protein 27-like protein 1)	885	X
18222	Backbone structure of human membrane protein TMEM141	611	X
18223	Backbone structure of human membrane protein TMEM14C	527	X
18224	AR55 solubilised in SDS micelles	720	X
18225	AR55 solubilised in DPC micelles	755	X
18226	AR55 solubilised in LPPG micelles	721	X
18227	Solution structure of AR55 in 50% HFIP	741	X
18228	Backbone and side chain assignment of TpbA	1919	X
18229	NMR structure of the complex between the PH domain of the Tfb1 subunit from TFIIH and Rad2	1955	X
18230	Solution structure and dynamics of human S100A1 protein modified at cysteine 85 with homocysteine disulfide bond formation in calcium saturated form.	1067	X
18231	Solution structure of S100A1 Ca2+	1091	X
18232	Solid-state NMR assignments for mouse alpha-synuclein fibrils	273	X
18234	Solution structure of P1-CheY/P2 complex in bacterial chemotaxis	216	X
18235	Solution Structure Of The N-Terminal Domain Of The Yeast Protein Dre2	1466	X
18236	Backbone and sidechain 13C, 15N, and 1H assignments of cruzain in complex with K777	1018	X
18237	Structure of gp41-M-MAT, a membrane associated MPER trimer from HIV-1 gp41.	485	X
18238	SOLUTION STRUCTURE OF AN APOPTOSIS ACTIVATING PHOTOSWITCHABLE BAK PEPTIDE BOUND to BCL-XL	1939	X
18239	Pseudo-triloop from the sub-genomic promoter of Brome Mosaic Virus	120			X
18240	Mutant of the sub-genomic promoter from Brome Mosaic Virus	114			X
18242	Backbone and sidechain 1H, 15N and 13C assignments of NLRP10 (PYNOD) pyrin domain	1240	X
18243	WT AS fibrils (1H detection experiments)	224	X
18244	Structure of the complex of the central activation doamin of Gcn4 bound to the mediator co-activator domain 1 of Gal11/med15	1350	X
18245	Backbone assignment of porcine pepsin	1195	X
18246	Backbone assignment of porcine pepsin complex with pepstatin	1534	X
18248	Assignments for the dually targeting peptide from Thr-tRNA synthetase	377	X
18249	1H, 13C and 15N backbone and side-chain resonance assignments of reduced CcmG from Escherichia coli	1760	X
18250	NMR STRUCTURE of Bcl-XL	2036	X
18251	Cdc42Hs-GMPPCP Complex	798	X
18252	Cdc42Hs-GMPPCP-PBD46 Complex	761	X
18253	1H, 13C and 15N NMR assignments of inactive form of P1 endolysin Lyz at pH 7.5	1561	X
18254	1H and 15N resonance assignments for Pseudomonas aeruginosa apo-azurin	214	X
18255	Solution structure of a MbtH-like protein from Burkholderia pseudomallei, the etiological agent responsible for melioidosis. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target BupsA.13472.b.	940	X
18256	R state structure of monomeric phospholamban (C36A, C41F, C46A)	303	X
18257	E. coli DmsD	2079	X
18260	1H, 13C and 15N resonance assignment of chicken brain alpha spectrin repeat 17	1375	X
18261	NMR structure of a monomeric mutant (A72R) of major ampullate spidroin 1 N-terminal domain	1557	X
18262	NMR structure of major ampullate spidroin 1 N-terminal domain at pH 7.2	1428	X
18263	Solution NMR of the specialized apo-acyl carrier protein (RPA2022) from Rhodopseudomonas palustris, Northeast Structural Genomics Consortium Target RpR324	1228	X
18265	WIP C-terminal domain	753	X
18266	Backbone assignment of Dengue Virus NS2B/NS3 in complex with Aprotinin	874	X
18267	Substrate-dependent millisecond domain motions in DNA polymerase beta	1322	X
18268	Unliganded (apo) C-terminal EF-hand domain from human polycystin-2	380	X
18269	Solution Structure of N-Terminal domain of human Conserved Dopamine Neurotrophic Factor (CDNF)	1146	X
18276	1H, 13C and 15N chemical shifts for Salmonella Typhimurium PrgI Type three secretion system needle subunit	539	X
18277	Solution structures of KmAtg10	1961	X
18278	Solution Structure of FKBP12 from Aedes aegypti	1242	X
18279	human CEB25 minisatellite G-quadruplex	314		X
18280	Backbone 1H, 13C, and 15N Chemical Shift Assignments for CD81LEL	427	X
18281	Solution Structure of Strawberry Allergen Fra a 1e	1735	X
18282	SOLUTION STRUCTURE OF THE M-PMV MYRISTOYLATED MATRIX PROTEIN	1043	X
18283	Assignment of E coli periplasmic protein YmgD	1034	X
18284	Solution structure of de novo designed antifreeze peptide 1m	112	X
18285	Backbone amide assignments of HLA-DR1/CLIP complexes	318	X
18286	Solution structure of de novo designed antifreeze peptide 3	120	X
18287	Backbone and sidechain 1H chemical shifts for PAP248-286 (SEVI) in solution at pH 6	229	X
18288	1H, 13C and 15N chemical shift assignments of Ninjurin1 ENT domain	554	X
18289	Solution structure of de novo designed peptide 4m	81	X
18290	Solution NMR Structure of syc0711_d from Synechococcus sp., Northeast Structural Genomics Consortium (NESG) Target SnR212	1279	X
18291	Backbone 1HN, 13C, and 15N Chemical Shift Assignments for Granulocyte colony-stimulating factor	787	X
18292	NMR structure of the RNA binding motif 39 (RBM39) from Mus musculus	1352	X
18293	Backbone 1HN, 13C, and 15N Chemical Shift Assignments for Granulocyte colony-stimulating factor A29G	791	X
18294	Backbone 1HN, 13C, and 15N Chemical Shift Assignments for Granulocyte colony-stimulating factor A30G	791	X
18295	Backbone 1HN, 13C, and 15N Chemical Shift Assignments for Granulocyte colony-stimulating factor A37G	781	X
18296	Solution structure of BRD1 PHD2 finger	887	X
18297	E2 binding surface on Uba3 beta-grasp domain undergoes a conformational transition	1040	X
18298	Domain interaction in Thermotoga maritima NusG	1895	X
18299	Solution structure of the K60A mutant of Atox1	713	X
18300	Solution NMR structure of asteropusin A from marine sponge Asteropus sp.	346	X
18301	Metal binding repeat 2 of the Wilson disease protein (ATP7B)	763	X
18302	Solution structure of the calcium-bound CaM N-terminal domain in a complex.	906	X
18303	1H, 13C, and 15N Chemical Shift Assignments for PfPMT, a Phosphoethanolamine Methyltransferase from Plasmodium falciparum	2499	X
18306	Human APOBEC2 chemical shifts, RDC, NOE, and T1/T2 data	782	X
18307	Human APOBEC2 chemical shifts	783	X
18308	Backbone amide assignments of HLA-DR1/CLIP complexes	314	X
18309	Chemical Shift 1H, 13C, 15N Assignments of N-terminal domain of Thermotoga Maritima flagellar motor protein FliG	373	X
18310	Chemical Shift 1H, 13C, 15N Assignments of N-terminal domain of Thermotoga Maritima flagellar motor protein FliG bound to unlabeled FliF C-terminal peptide	517	X
18312	1H, 13C and 15N assignments of Cyclophilin A from Piriformospora indica, a plant root-colonizing basidiomycete fungus	1729	X
18313	Solution Structure of the A domain of talin	1631	X
18314	NMR structure of FOXO3a transactivation domains (CR2C-CR3) in complex with CBP KIX domain (2b3l conformation)	1496	X
18315	NMR structure of FOXO3a transactivation domains (CR2C-CR3) in complex with CBP KIX domain (2l3b conformation)	1495	X
18316	Solution structure of the C-terminal domain of the MgtC protein from Mycobacterium tuberculosis	543	X
18317	Chemical shift assignments of the canecystatin-1 from Saccharum officinarum	1237	X
18318	Solution structure of CHCH5	660	X
18319	1H, 13C and 15N full assignment of transmembrane domain TM12 from human Y4 receptor	1436	X
18320	Solution Structures of RadA intein from Pyrococcus horikoshii	2074	X
18321	Solution structure of CRKL	2154	X
18322	Mrx1 reduced	1047	X
18323	Solution structure of the calcium-bound CaM C-terminal domain in a complex	579	X
18324	Backbone Resonance Assignments of the Micro-RNA Interaction Region of Human TRBP2	973	X
18325	Mrx1 oxidized	1038	X
18326	1H, 13C, and 15N resonance assignments of Ni(II)-NmtR	231	X
18327	Solution structure of the atypical SH3 domain of DOCK180	616	X
18328	Solution structure of CHCHD7	780	X
18329	Structure of decorbin-binding protein A from Borrelia burgdorferi	1725	X
18331	1H, 13C and 15N assignments of the holo-acyl carrier protein of Pseudomonas aeruginosa	984	X
18332	E. coli Protein	768	X
18333	Solution structure of phosphorylated CRKL	1951	X
18334	NMR spatial structure of the trypsin inhibitor BWI-2c from the buckwheat seeds	348	X
18335	Structure and orientation of the gH625-644 membrane interacting region of herpes simplex virus type 1 in a membrane mimetic system.	105	X
18336	Structure of the RNA claw of the DNA packaging motor of bacteriophage 29	287			X
18337	SOLUTION NMR STRUCTURE OF DE NOVO DESIGNED PROTEIN, P-LOOP NTPASE FOLD, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET OR136	1764	X
18338	C-terminal propeptide (PPc) region of vibrio extracellular metalloprotease	1101	X
18339	1H, 15N and 13C backbone resonance assignments of FTSA	1697	X
18340	Structural Mechanism for Bax Inhibition by Cytomegalovirus Protein vMIA	173	X
18341	Sgt2_NT	938	X
18342	Backbone and sidechain assignments for Get5_UBL domain	1066	X
18344	Gal-GalNac-Interferon Alpha-2a	856	X
18345	Solution structure of the anti-fungal defensin DEF4 (MTR_8g070770) from Medicago truncatula (barrel clover)	324	X
18346	NMR structure of the protein NP_390037.1 from Bacillus subtilis.	1499	X
18347	1H chemical shift assignments for micasin	221	X
18348	Backbone 1H, 13C, and 15N Chemical Shift Assignments for EB1 CH domain	619	X
18349	NMR structure of a LINE-1 type transposase domain-containing protein 1 (L1TD1) from HOMO SAPINES	990	X
18350	cathelicidin-PY	184	X
18351	Solution structure of the Class II hydrophobin NC2	951	X
18352	Solution NMR Structure of CASP8-associated protein 2 from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR8150A	883	X
18353	1H, 15N and 13C backbone resonance assignments of the Kelch domain of mouse Keap1	992	X
18354	High-resolution solution NMR structure of the rho-conotoxin TIA.	141	X
18355	NMR Structure of Signal Sequence Deleted (SSD) Rv0603 Protein from Mycobacterium tuberculosis without N-terminal His-tag	865	X
18356	Solution Structure of ADF like UNC-60A Protein of Caenorhabditis elegans	1995	X
18357	The solution structure of the monomeric Acanthaporin	319	X
18358	The solution structure of the dimeric Acanthaporin	263	X
18359	The chemical shifts and T1, T2, and 1H-15N NOE data for apo-IscU(D39V)	510	X
18360	The chemical shifts and T1, T2, and 1H-15N NOE data for apo-IscU(E111A)	403	X
18361	The chemical shifts and T1, T2, and 1H-15N NOE data for apo-IscU(N90A)	432	X
18362	The chemical shifts and T1, T2, and 1H-15N NOE data for apo-IscU(S107A)	445	X
18363	'Backbone Chemical Shift Assignments for Scylla Serrata anti lipopolysaccharide Factor-24 (SsALF-24) peptide'	224	X
18364	NMR structure of the protein YP_001300941.1 from Bacteroides vulgatus	1312	X
18365	Backbone and side chain 1H, 13C, and 15N Chemical Shift Assignments for Hen Egg White Lysozyme mutant WT-ALA	957	X
18366	Backbone 1H and 15N Chemical Shift Assignments for Hen Egg White Lysozyme mutant W28G.	250	X
18367	Backbone 1H and 15N Chemical Shift Assignments for Hen Egg White Lysozyme mutant W62G.	232	X
18368	Backbone 1H and 15N Chemical Shift Assignments for Hen Egg White Lysozyme mutant W108G.	242	X
18369	Backbone 1H and 15N Chemical Shift Assignments for Hen Egg White Lysozyme mutant W111G.	244	X
18370	Backbone 1H and 15N Chemical Shift Assignments for Hen Egg White Lysozyme mutant W123G.	250	X
18371	Backbone 1H, 13C, and 15N Chemical Shift Assignments for EB1 C-terminal domain	311	X
18372	SOLUTION NMR STRUCTURE OF DE NOVO DESIGNED PROTEIN, P-LOOP NTPASE FOLD, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET OR137	1774	X
18373	bLac - Oceanobacillus iheyensis	902	X
18374	NMR structure of the second PHD finger of AIRE (AIRE-PHD2)	635	X
18375	NMR solution structure of staphyloxanthin biosynthesis protein	1233	X
18376	Free MTIP(61-204) from Plasmodium falciparum	696	X
18377	MTIP(61-204) from Plasmodium falciparum bound to peptide MyoA(799-818)	707	X
18378	Liraglutide	196	X
18379	Solution Structures of the IIA(Chitobiose)-HPr complex of the N,N'-Diacetylchitobiose Branch of the Escherichia coli Phosphotransferase System	1868	X
18380	Backbone 1H, 13C, and 15N Chemical Shift Assignments and Complete 15N Relaxation Analysis of the Soluble C-terminal Domain of CcmE Heme Chaperone from Desulfovibrio vulgaris, dvCcmE(44-137). Northeast Structural Genomics Target DvR115.	667	X
18381	The backbone chemical shifts of IscU complexed with HscA	361	X
18385	Characterization of the chromoshadow domain-mediated binding of heterochromatin protein 1 alpha (HP1 alpha) to histone H3: Backbone 1H, 15N chemical shift assignments for histone H3 (1-59)	110	X
18386	Characterization of the chromoshadow domain-mediated binding of heterochromatin protein 1 alpha (HP1 alpha) to histone H3: Backbone 1H, 15N chemical shift assignments for HP1 CSDalpha(109-185)	142	X
18387	Solution structure of a thiol:disulfide interchange protein from Bacteroides sp.	1861	X
18388	Solution structure, dynamics and binding studies of CtCBM11	1958	X
18389	Solution structure, dynamics and binding studies of CtCBM11	1790	X
18390	Chemical Shift Assignment and Solution Structure of ChR145 from Drosophila melanogaster. Northeast Structural Genomics Consortium Target Fr822A	893	X
18391	Solution structure of the R3H domain from human Smubp-2 in complex with 2'-deoxyguanosine-5'-monophosphate	986	X
18392	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the C-terminal Domain of E. coli Enzyme I	1342	X
18393	The second dsRBD domain from A. thaliana DICER-LIKE 1	851	X
18394	Solution structure of the uncharacterized thioredoxin-like protein BVU_1432 from Bacteroides vulgatus	1878	X
18395	Chemical shift assignments of deuterated DsbB by 1H-detected solid-state NMR	266	X
18396	nanocrystalline DsbA 1H, 13C, 15N chemical shifts	705	X
18397	nanocrystalline GB1 1H, 13C, 15N assignments	313	X
18398	Solution Structure of the WNK1 Autoinhibitory Domain	1239	X
18399	Solution structure of a ubiquitin-like protein from Trypanosoma brucei	748	X
18400	RNA structural dynamics are modulated through anti-folding by chaperones	534	X
18403	1H,13C and 15N resonance assignment of the UIM-SH3 construct of the STAM2 protein	402	X
18404	Solution Structure of the Target Recognition Domain of Zoocin A	1405	X
18405	Structure of Sviceucin, an type I lasso peptide from Streptomyces sviceus	177	X
18406	Solid-state NMR sequential assignments of Sup35NM	116	X
18407	Solid-state NMR sequential assignments of full-length Sup35p	116	X
18408	1H Chemical Shift Assignments for the first transmembrane domain from human copper transport 1	165	X
18409	1H Chemical Shift Assignments for the second transmembrane domain from human copper transport 1	220	X
18410	1H Chemical Shift Assignments for the third transmembrane domain from the human copper transport 1	147	X
18411	Solution structure of a putative protein disulfide isomerase from Bacteroides thetaiotaomicron	1954	X
18412	High Definition Solution Structure of PED/PEA-15 Death Effector Domain	1462	X
18413	Apo-AdcR	831	X
18414	Zn(II)-AdcR	921	X
18415	Solution structure of human C-type lectin domain family 4 member D	1889	X
18416	1H,15N and 13C backbone and side chain chemical shifts of the ubiquitin homology domain of mouse BAG-1	1113	X
18417	1H, 13C and 15N resonance assignments of human BASP1	2127	X
18418	Pleurocidin-NH2	142	X
18419	B2 domain of Neisseria meningitidis Pilus assembly protein PilQ	1484	X
18420	magainin	53	X
18421	Capsid protein from Equine Infectious Anemia Virus	961	X
18422	Backbone dynamics of the truncated (2/2) hemoglobin from Synechococcus sp. PCC 7002 (ferrous form with heme PTM, carbonmonoxy complex)	956	X
18423	Backbone dynamics of the truncated (2/2) hemoglobin from Synechococcus sp. PCC 7002 (ferric form with heme PTM, cyanide complex)	504	X
18424	Backbone dynamics of the truncated (2/2) hemoglobin from Synechococcus sp. PCC 7002 (ferric form without heme PTM, cyanide complex)	472	X
18425	Resonance Assignments of Ca2+-bound human S100A11	938	X
18426	Solution-state NMR structure of the human prion protein	1541	X
18427	Solution structure of 2'F-ANA and ANA self-complementary duplex	79		X
18428	N0N1 domains of Neisseria meningitidis Pilus assembly protein PilQ	1895	X
18429	Solution NMR Structure of De Novo Designed Four Helix Bundle Protein, Northeast Structural Genomics Consortium (NESG) Target OR188	1247	X
18430	Structure and Stability of Duplex DNA Containing (5 S) 5 ,8-Cyclo-2 -Deoxyadenosine: An Oxidative Lesion Repair by NER.	149		X
18431	Solution structure of the mouse Rev1 C-terminal domain	1227	X
18432	Solution structure of polymerase-interacting domain of human Rev1 in complex with translesional synthesis polymerase kappa	1478	X
18433	Solution structure of the mouse Rev1 CTD in complex with the Rev1-interacting Region (RIR)of Pol Kappa	1552	X
18434	C-terminal domain of human REV1 in complex with DNA-polymerase H (eta)	1118	X
18435	Solution structure of the C-terminal domain of Tetrahymena telomerase protein p65	1449	X
18437	Solution structure of gpFI C-terminal domain	666	X
18438	Solution NMR Structure of the Globular Domain of Human Histone H1x, Northeast Structural Genomics Consortium (NESG) Target HR7057A	1063	X
18439	solution structures of BRD4 second bromodomain with NF-kB-K310ac peptide	1435	X
18440	Analog of the fragment 197-221 of 1- adrenoreceptor	210	X
18441	Solution structure of harmonin N terminal domain in complex with a exon68 encoded peptide of cadherin23	1132	X
18442	Solution structure of the R. rickettsii cold shock-like protein	859	X
18443	Solution structure of a thioredoxin from Thermus thermophilus	1516	X
18445	NMR high resolution structures of free Tah1 and Tah1 bound to the Hsp90 C-terminal tail explain how Hsp90 recognizes the R2TP complex	1087	X
18446	Sequence specific 1H, 13C and 15N resonance assignments of an intrinsically unstructured -Crystallin from Hahella chejuensis	364	X
18447	NMR high resolution structures of free Tah1 and Tah1 bound to the Hsp90 C-terminal tail explain how Hsp90 recognizes the R2TP complex	1271	X
18448	Chemical Shift Assignment of the NIPP1 FHA Domain	500	X
18449	Structure, sulfatide-binding properties, and inhibition of platelet aggregation by a Disabled-2-derived peptide	368	X
18452	Solution structure of a mini i-motif	116	X	X
18453	NMR structure of duplex DNA containing the -OH-PdG dA base pair: A mutagenic intermediate of acrolein	150		X
18454	NMR structure of duplex DNA containing the -OH-PdG dA base pair: A mutagenic intermediate of acrolein	150		X
18455	Structure of the C-terminal domain from human REV1	1124	X
18458	1H, 13C, 15N Chemical shift assignment of HIRAN domain of human HLTF	1303	X
18459	N0 domain of Neisseria meningitidis Pilus assembly protein PilQ	1520	X
18461	Chemical shift assignments and backbone dynamics of H-Ras-GppNHp bound to Ras-binding domain of cRaf1.	487	X
18462	Solution NMR structure of Kaiso zinc finger DNA binding domain in complex with Kaiso binding site DNA	2059	X	X
18463	Eurocin solution structure	309	X
18464	The solution structure of Ca2+ binding domain 2B of the third isoform of the Na+/Ca2+ exchanger	1608	X
18465	SOLUTION NMR STRUCTURE OF DE NOVO DESIGNED PROTEIN, ROSSMANN 3x1 FOLD, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET OR157	1388	X
18466	Wild-type FAS1-4	1487	X
18467	FAS1-4, R555W	1501	X
18468	Solution NMR structure of the specialized acyl carrier protein PA3334 (apo) from Pseudomonas aeruginosa. Northeast Structural Genomics Consortium Target PaT415.	1042	X
18469	Solution NMR Structure of apo YdbC from Lactococcus lactis, Northeast Structural Genomics Consortium (NESG) Target KR150	953	X
18470	Cu(I) form gt CsoR	493	X
18471	Backbone 1H, 13C, and 15N Chemical Shift Assignments for PWWP domain from Trypanosoma brucei	1044	X
18472	Apo form gt CsoR	494	X
18473	1H, 13C, and 15N resonance assignment of mouse lipocalin-type prostaglandin D synthase/substrate analog complex.	1394	X
18474	the pwwp domain of TFIIS2-1 from Trypanosoma brucei	1017	X
18475	The solution structure of Phage P2 gpX	739	X
18477	NMR dynamics in the C-terminal globular domain of oligosaccharyltransferase	302	X
18478	P75/LEDGF PWWP Domain	892	X
18479	HRas166*GDP backbone chemical shift assignments	786	X
18480	NMR structure of major ampullate spidroin 1 N-terminal domain at pH 5.5	1582	X
18481	STRUCTURE OF LASSO PEPTIDE ASTEXIN1	159	X
18484	Conformational analysis of StrH, the surface-attached exo- -D-N-acetylglucosaminidase from Streptococcus pneumoniae.	1089	X
18485	Solution structure of a monomeric truncated mutant of Trypanosoma brucei 1-C-Grx1	1415	X
18486	Backbone 1H, 13C, and 15N Chemical Shift Assignments for reduced form of sulfiredoxin extract from Saccharomyces cerevisiae	1069	X
18487	Solution NMR Structure of NifU-like protein from Saccharomyces cerevisiae, Northeast Structural Genomics Consortium (NESG) Target YR313A	1317	X
18488	Backbone 1H, 13C, and 15N Chemical Shift Assignments of an oxidizied and mutant form of sulfiredoxin from Saccharomyces cervisiae	1081	X
18489	Solution NMR Structure of NFU1 Iron-Sulfur Cluster Scaffold Homolog from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR2876B	1251	X
18490	TDRD3 complex	575	X
18491	1H chemical shifts of Thermolysin 255-316 fragment	448	X
18492	Solution structure of the SANT2 domain of the human nuclear receptor corepressor 2 (NCoR2), Northeast Structural Genomics Consortium (NESG) target ID HR4636E.	824	X
18493	High resolution structure of DsbB C41S by joint calculation with solid-state NMR and X-ray data	705	X
18494	Assignment of the -Helical Membrane Protein TM0026 from Thermotoga maritima.	289	X
18495	1H chemical shifts of Thermolysin 205-316 fragment	751	X
18496	Solution NMR Structure of YdbC:dT19G1 complex. Northeast Structural Genomics Consortium (NESG) Target KR150	1055	X	X
18497	Solution Structure of autoinhibitory domain of human AMP-activated protein kinase catalytic subunit	654	X
18498	YAP WW2 in complex with a Smad7 derived peptide.	279	X
18499	YAP WW1 in complex with a Smad7 derived peptide.	269	X
18500	Smurf1 WW2 domain in complex with a Smad7 derived peptide.	281	X
18501	NEDD4L WW2 domain in complex with a Smad7 derived peptide.	327	X
18502	Smurf2 WW3 domain in complex with a Smad7 derived peptide.	288	X
18503	NMR solution structure of the kappa-zeta region of S.cerevisiae group II intron ai5(gamma)	957			X
18504	pfsub2 solution NMR structure	1143	X
18505	Backbone and side chain assignments of MHV N protein NTD (aa60-197)	1238	X
18506	MIC5 regulates the activity of Toxoplasma subtilisin 1 by mimicking a subtilisin prodomain	156	X
18507	Solution NMR structure of the apo-form of the beta2 carbohydrate module of AMP-activated protein kinase	1199	X
18508	Solution NMR structure of the beta2 carbohydrate module of AMP-activated protein kinase bound to glucosyl-cyclodextrin	1199	X
18509	Structure and chemical shifts of Cu(I),Zn(II) superoxide dismutase by solid-state NMR	517	X
18510	NMR solution structure of Midi peptide designed based on m-conotoxins	115	X
18511	Solution NMR Structure of Ig like domain (1277-1357) of Obscurin-like protein 1 from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR8578D	953	X
18513	RECOMBINANT TAMAPIN NMR solution structure.	205	X
18514	Solution structure of CXC domain of MSL2	572	X
18515	high resolution NMR solution structure of helix H1 of the human HAR1 RNA	277			X
18516	1H, 13C and 15N backbone NMR reassignment of the third PDZ domain of PSD95 protein	494	X
18517	Solution structure of EDK-delta-Bd37 from Babesia divergens	2411	X
18518	LC3B OPTN-LIR Ptot complex structure	1717	X
18519	Retro Trp-cage peptide	201	X
18520	Chemical shift assignments of a S72-S107 peptide of 18.5kDa murine myelin basic protein (MBP) in association with dodecylphosphocholine micelles	366	X
18521	The NMR structure of the Vta1-Vps60 complex	2763	X
18522	Chemical Shift Assignments for the PICK1 PDZ domain fused to the C10 DAT ligand	1126	X
18523	NMR structure of Hsp12, a protein induced by and required for dietary restriction-induced lifespan extension in yeast.	1219	X
18524	Solution structure of a parallel-stranded oligoisoguanine DNA pentaplex formed by d(T(iG)4T) in the presence of Cs ions	455		X
18526	Solution NMR Structure of PH Domain of Tyrosine-protein kinase Tec from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR3504C	1983	X
18527	1H chemical shifts for the C-terminal beta-tubulin 394-455 fragment	340	X
18528	1H chemical shifts for the C-terminal alfa-tubulin 404-451 fragment	291	X
18529	1H, 13C and 15N resonance assignment for the human K-Ras at physiological pH	1123	X
18530	1H, 13C and 15N resonance assignment of the pair of complement control protein modules of human C7	1581	X
18531	Three-State Ensemble obtained from eNOEs of the Third Immunoglobulin Binding Domain of Protein G (GB3)	625	X
18532	RNA Aptamer for B. anthracis Ribosomal Protein S8	486			X
18533	NMR solution structure of apo-MptpA	1731	X
18534	RDC REFINED SOLUTION STRUCTURE OF DOUBLE-STRANDED RNA BINDING DOMAIN OF S. CEREVISIAE RNASE III (RNT1P) IN COMPLEX WITH THE TERMINAL RNA HAIRPIN OF SNR47 PRECURSOR	1317	X		X
18535	SOLUTION STRUCTURE OF DOUBLE-STRANDED RNA BINDING DOMAIN OF S.CEREVISIAE RNASE III (RNT1P)	978	X
18536	KB1[GHRW;23-28]	156	X
18537	1H and 13C chemical shifts for collagelin	138	X
18538	1H and 13C NMR of GPVI mimetic	188	X
18539	NMR structure of Carcinoscorpius rotundicauda thioredoxin related protein 16 and its role in regulating transcription factor NF-kB activity	1450	X
18540	NMR solution structure of midkine-a	1117	X
18541	NMR solution structure of midkine-b, mdkb	1011	X
18542	Structure and Binding Interface of the Cytosolic Tails of aXb2 Integrin	195	X
18543	Chemical shift assignments of DsbA(C33S) by solid-state NMR	646	X
18544	Chemical shift assignments of DsbA(C33S)/DsbB by solid-state NMR	323	X
18545	Calcium saturated form of human C85M S100A1 mutant	1107	X
18546	Solution structure of the tandem zinc finger domain of fission yeast Stc1	1139	X
18547	Solution NMR Structure of CalU16 from Micromonospora echinospora, Northeast Structural Genomics Consortium (NESG) Target MiR12	2242	X
18548	1H, 13C, and 15N resonance assignments of the monomeric human Fam96a	1735	X
18549	Solution Structure of Helix-35 Stem-loop from E. coli 23S rRNA	408			X
18550	Solution-state NMR of prion protein mutant V210I at pH 7	1507	X
18551	Solution NMR structure of C2H2-type Zinc-fingers 4 and 5 from human Insulinoma-associated protein 1 (fragment 424-497), Northeast Structural Genomics Consortium Target HR7614B.	860	X
18552	TM4-Cx43CT	1267	X
18553	ZirS C-terminal Domain	1582	X
18555	NMR solution structure of PA1075 from Pseudomonas Aeruginosa	1226	X
18556	The complex between Ca-Calmodulin and skeletal muscle myosin light chain kinase from combination of NMR and aqueous and contrast-matched SAXS data	288	X
18557	Solution structure of Ca2+-bound CaBP7 N-terminal doman	1055	X
18559	Solution NMR structure of the PHD domain of human MLL5. Northeast structural genomics consortium target HR6512A.	844	X
18560	NMR solution structure of the N-terminal domain of human USP28. Northeast structural genomics consortium target HT8470A	1243	X
18561	Solution NMR Structure DE NOVO DESIGNED PFK fold PROTEIN, Northeast Structural Genomics Consortium (NESG) Target OR250	1312	X
18562	Backbone and side-chain assignments of an effector membrane localization domain from Vibrio vulnificus MARTX toxin	823	X
18563	Solution NMR Structure of Ig like domain (805-892) of Obscurin-like protein 1 from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR8578K	1097	X
18565	Backbone and side-chain resonance assignments of the membrane localization domain from Pasteurella multocida toxin	1015	X
18566	Telokin-like domain (TL-domain) from P22 coat protein	1434	X
18567	Overexpression, purification and structural characterization of S114A mutant of UVI31+ from chlamydomonas reinhardtii	528	X
18568	ns4b40	425	X
18569	13C, 15N and 1H backbone and sidechain assignments of the ENA-VASP homology 1 (EVH1) domain of the human vasodilator-stimulated phosphoprotein (VASP)	1297	X
18570	Solution structure of the zinc finger AFV1p06 protein from the hyperthermophilic archaeal virus AFV1	764	X
18571	Solution structure of apo-Phl p 7	873	X
18572	solution structure of hemi-Mg-bound Phl p 7	888	X
18573	Solution structure of Ca-bound Phl p 7	883	X
18574	1H,13C,15N resonance assignment of wild-type Lipase A from Bacillus subtilis	2202	X
18575	1H, 13C and 15N resonance assignments of Bacillus subtilis Lipase A mutant evolved towards thermostability	2164	X
18576	Griffithsin assignment	458	X
18577	Chemical Shift Assignments of the Connexin45 Carboxyl Terminal Domain: Dimer Conformation	1129	X
18578	Chemical shift assignments of the connexin45 carboxyl terminal domain: monomer and dimer conformations.	1335	X
18579	Methylated Histone Complex	1706	X
18580	1H, 13C, and 15N backbone and side chain resonance assignments of the C-terminal DNA binding and dimerization domain of v-Myc	1167	X
18581	Solution structure of gp78 CUE domain	662	X
18582	1H, 13C, 15N chemical shifts of gp78CUE bound to ubiquitin AND backbone amide shifts of ubiquitin bound to gp78CUE	792	X
18583	Solution structure of the gp78CUE/K48-Ub2 complex	222	X
18584	Solution structure of gp78CUE/K48-Ub2 complex	222	X
18585	Griffithsin assignment	458	X
18586	Solution structures of Miz-1 zinc fingers 8 to 10	877	X
18587	MHV nsp3a	1243	X
18588	Backbone 1H, 15N, 13C Assignments of the N-terminal Part of Tyrosine tRNA Synthase from Bacillus stearothermophilus	1498	X
18589	NMR solution structure of Cbp2	1073	X
18590	S. aureus pepA1 NMR structure	94	X
18591	Solution NMR studies of the dimeric regulatory subunit IlvN of the E.coli Acetohydroxyacid synthase I (AHAS I)	1132	X
18592	MRH domain of the Glucosidase II beta subunit from S. pombe	1080	X
18593	Solution Structure of a RNA Duplex Containing a 2'-O-Pivaloyloxymethyl Modification	178			X
18595	Solid-state NMR 13C and 15N resonance assignments of a seven-transmembrane helical protein Anabaena Sensory Rhodopsin	1186	X
18596	Solution structure of a Eosinophil Cationic Protein-trisaccharide heparin mimetic complex	1482	X			X
18598	Backbone resonance assignments for AgrA LytTR domain	502	X
18599	Solution structure of CCP modules 11-12 of complement factor H	1514	X
18600	S67	778	X
18601	GGBP Ecoli unliganded solution structure	1104	X
18602	Solution structure of the soluble domain of MmpS4 from Mycobacterium tuberculosis	823	X
18603	RBP E. coli Assignment of backbone NH, alpha and beta carbons	969	X
18604	Solution structure of CCP modules 10-11 of complement factor H	1567	X
18605	Solution NMR Structure of Human Transcription Elongation Factor A protein 2, Central Domain, Northeast Structural Genomics Consortium (NESG) Target HR8682B	1294	X
18606	Solution structure of anti-CRISPR protein Acr30-35 from Pseudomonas aeruginosa Phage JBD30	823	X
18607	Solution structure of an avirulence protein AvrPzi-t from pathogen Magnaportheoryzae	884	X
18608	Backbone resonance assignment of ASC pyrin domain	443	X
18609	Chemical shifts of Ecoli GGBP sugar bound	1009	X
18610	1H, 13C and 15N assignments of Ubiquitin for both folded and denatured states at 258K and 2500 bar	517	X
18611	Pressure & methanol-induced A-state of Ubiquitin	360	X
18612	NMR solution structure of human HisRS splice variant	1732	X
18613	NMR solution structure of Eph receptor	1560	X
18614	NMR solution structure of Myo10 anti-CC	535	X
18615	1H, 13C and 15N chemical shift assignments of human parvulin 17	1588	X
18617	Conformational ensemble for the G8A mutant of the influenza hemagglutinin fusion peptide	95	X
18618	Structural model of BAD-1 repeat loop by NMR	238	X
18619	Met-enkephaline in DPMC SUV	28	X
18620	NMR Chemical Shift Assignments of N terminal RRM domain of La protein	1068	X
18621	NMR Chemical Shift Assignments of N terminal La motif domain of La protein	985	X
18622	Solution structure of second CARD of human RIG-I.	1215	X
18623	Solution structure of mutant (T170E) second CARD of human RIG-I	1206	X
18624	Structure of N-terminal domain of a plant Grx	1367	X
18625	NMR Structure of the Self-Complementary 10 mer DNA Oligonucleotide 5'-GGATATATCC-3'.	200		X
18626	NMR Structure of the Self-Complementary 10 mer DNA Duplex 5'-GGATATATCC-3' in Complex with Netropsin	175		X
18627	1H, 13C, and 15N Chemical Shift Assignments for Calcium free, Myristoylated Visinin-like protein 3	1876	X
18628	1H, 13C, and 15N Backbone and Sidechain Resonance Assignments for Cyclophilin A from Geobacillus Kaustophilus	1651	X
18629	Solution structure of H-RasT35S mutant protein in complex with Kobe2601	310	X
18630	Backbone Chemical Shifts for N-terminal domain of sulfhydryl oxidase ALR	378	X
18631	N-terminal of Sulfydryl Oxidase of ALR reduced	387	X
18632	Resonance assignment of As-p18, a structurally unusual fatty acid binding protein secreted by developing larvae of the parasitic nematode Ascaris suum	3518	X
18633	solution structure of small molecule-influenza RNA complex, Seattle Structural Genomics Center for Infectious Disease (SSGCID)	186			X
18634	Structural basis for the interaction of human -defensins 1 and 6 and its receptors CCR2 corresponding peptide and breast cancer cells	514	X
18635	Backbone resonance assignments of human beta-defensin 1	197	X
18636	1H, 13C and 15N resonance assignment of the soluble form of the Lipid-modified Azurin from Neisseria gonorrhoeae	1542	X
18637	1H, 13C and 15N chemical shift assignments of Na-FAR-1, a helix-rich fatty acid and retinol binding protein of the parasitic nematode Necator americanus	2388	X
18638	Solution Structure of Duplex DNA Containing a b-Carba-Fapy-dG Lesion	142		X
18639	Solution Structure of Duplex DNA Containing a b-Carba-Fapy-dG Lesion	150		X
18640	Solution Structure of Duplex DNA Containing a b-Carba-Fapy-dG Lesion	150		X
18641	NMR solution structure of PawS derived peptide 11 (PDP-11)	158	X
18642	Protein structure	706	X
18643	NMR solution structure of PawS Derived Peptide 4 (PDP-4)	81	X
18644	NMR solution structure of PawS Derived Peptide 5 (PDP-5)	173	X
18645	NMR solution structure of PawS Derived Peptide 7 (PDP-7)	135	X
18647	1H, 13C, and 15N backbone resonance assignments of the L124D mutant of StAR-related lipid transfer domain protein 4 (StARD4)	1343	X
18648	APPTM V44M	426	X
18649	Transmembrane domain of Amyloid precursor protein WT	426	X
18650	NMR structure of RelA-TAD/CBP-TAZ1 complex	1822	X
18651	13C and 15N chemical shifts for Shigella Flexneri MxiH Type three secretion system needle subunit	487	X
18652	Backbone assignment of Bt-Lon alpha sub-domain from Brevibacillus thermoruber	520	X
18653	Solution Structure of Bacterial Intein-Like domain from Clostridium thermocellum	1737	X
18654	NMR Structures of Single-chain Insulin	613	X
18655	Arced helix (ArcH) NMR structure of the reovirus p14 fusion-associated small transmembrane (FAST) protein transmembrane domain (TMD) in dodecyl phosphocholine (DPC) micelles	287	X
18656	Major Conformation of the Internal Loop 5'GAGU/3'UGAG	192			X
18657	1H,13C,15N assignments for an isoform of the type III antifreeze protein from notched-fin eelpout	870	X
18658	NMR solution structure of peptide a2N(1-17) from Mus musculus V-ATPase	96	X
18659	NMR solution structure of peptide epsilon(103-120) from Mycobacterium tuberculosis F-ATPsynthase	114	X
18661	STRUCTURE OF LASSO PEPTIDE CAULOSEGNIN I	123	X
18662	Solution NMR structure of SH3 domain of growth arrest-specific protein 7 (GAS7)(fragment 1-60)from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR8574A	743	X
18663	The third member of the eIF4E family represses gene expression via a novel mode of recognition of the methyl-7 guanosine cap moiety	2154	X
18664	Chemical shift assignments of human NSD3 PHD5-C5HCH domain	961	X
18665	Human dUTPase	587	X
18666	Human dUTPase	583	X
18667	Solution structure of eIF4E3 in complex with m7GDP	2357	X
18668	Solution Structure of Escherichia coli Ferrous Iron transport protein A (FeoA)	361	X
18669	Solution structure of the Get5 ubiquitin-like domain	898	X
18670	Solution structure of the Sgt2 homodimerization domain	780	X
18671	Solution structure of the complex between the Sgt2 homodimerization domain and the Get5 UBL domain	1606	X
18672	S4WYILD	1223	X
18673	Solution NMR structure of a potential acylphosphatase from Giardia lamblia, Seattle Structural Genomics Center for Infectious Disease target GilaA.01396.a	1106	X
18676	Regulation of a potassium channel by the pro-domain of a matrix metalloprotease	372	X
18677	1H, 13C and 15N Assignments of the RING domain in ubiquitin ligase gp78	654	X
18678	NMR structure of the N-terminal RNA Binding domain 1 (RRM1) of the protein RBM10 from Homo sapiens	1095	X
18679	Backbone 1H, 13C, and 15N Chemical Shift Assignments for cold shock protein, LmCsp with dT7	692	X
18680	Backbone 1H, 13C, and 15N Chemical Shift Assignments for cold shock protein, LmCsp	704	X
18681	LIP5(MIT)2	1867	X
18682	LIP5-CHMP5	2276	X
18683	1H and 15N backbone resonance assignments of Escherichia coli Adenylate kinase: wild type	394	X
18684	Identification of the Structural Traits Mediating the Antimicrobial Activity of a Chimeric Peptide of HBD2 and HBD3	144	X
18686	1H and 15N backbone resonance assignments of Escherichia coli Adenylate kinase: E170A	378	X
18687	1H and 15N backbone resonance assignments of Escherichia coli Adenylate kinase: wild type with 0.35 M TMAO.	310	X
18688	Backbone amide chemical shifts of gp78 RING bound to Ube2g2:G2BR	110	X
18689	Backbone 1H, 13C, and 15N backbone resonance assignments of the TPR2A domain of mouse STI1	516	X
18690	MOMERIC PIL-E G-QUADRUPLEX DNA FROM NEISSERIA GONORRHOEAE	188		X
18691	Backbone 1H, 13C, and 15N backbone resonance assignments of the TPR1 domain of mouse STI1	420	X
18692	Solution structure of HP1264 from Helicobacter pylori	879	X
18693	1H, 13C, and 15N resonance assignments of mouse peptide ESP4	1155	X
18694	Allosteric communication in the KIX domain proceeds through dynamic re-packing of the hydrophobic core	1220	X
18695	Allosteric communication in the KIX domain proceeds through dynamic re-packing of the hydrophobic core	973	X
18696	1H, 13C and 15N resonance assignment of the N-terminal domain of human lysyl aminoacyl tRNA synthetase	1377	X
18697	1H, 13C and 15N resonance assignment of the N-terminal domain of human lysyl aminoacyl tRNA synthetase complexed with anticodon stem-loop of tRNALys,3	1319	X
18698	Solution NMR Structure of the eukaryotic RNA recognition motif, RRM1, from the heterogeneous nuclear ribonucleoprotein H from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR8614A	1302	X
18699	DIMERIC PIL-E G-QUADRUPLEX DNA FROM NEISSERIA GONORRHOEAE, N STRUCTURES	134		X
18700	The solution structure of XIAP(RING)-binding domain of human XAF1	676	X
18701	Solution struture of cofilin like UNC-60B protein from Caenorhabditis elegans	1795	X
18702	RNA BINDING PROTEIN Solution structure of the third KH domain of KSRP in complex with the G-rich target sequence.	758	X		X
18703	Backbone, sidechain and ligand chemical shift assignments for 2-mercaptophenol-alpha3C	857	X
18704	human Siglec5 Carbohydrate Recognition Domain Chemical Shifts	550	X
18705	Solution Structure of the Antimicrobial Peptide Human Defensin 5	304	X
18706	Solution NMR structure of the influenza A virus S31N mutant (19-49) in presence of drug M2WJ332	377	X
18707	Solution structure of TamA POTRA domain I	951	X
18708	Structure of Co-substituted microcrystalline SOD using PCS and PRE restraints by solid-state NMR	517	X
18709	HMGB1-facilitated p53 DNA binding occurs via HMG-box/p53 transactivation domain interaction and is regulated by the acidic tail	2080	X
18710	Refined solution structure of recombinant brazzein at low temperature	610	X
18711	TBA	1045	X
18712	b-flap domain of RNA polymerase (B. subtilis)	1449	X
18713	The budding yeast chaperone Scm3 recognizes the partially unfolded dimer of the centromere-specific Cse4/H4 histone variant	1446	X
18714	Solution NMR Structure of Homeobox 2 Domain from Human ZHX1 repressor, Northeast Structural Genomics Consortium (NESG) Target HR7907F	952	X
18715	Structure of HIV-1 myr(-) matrix protein in complex with 1,2-dioctanoyl-sn-phosphatidylcholine	1445	X
18716	Structure of HIV-1 myr(-) matrix protein in complex with 1,2-dioctanoyl-sn-phosphatidyl-L-serine	1452	X
18717	Structure of C-terminal domain of Ska1	1420	X
18718	Alpha4 Integrin Cytoplasmic Tail 1H and 15N Chemical Shift	72	X
18719	Beta2 Integrin Cytoplasmic Tail 1H and 15N Chemical Shift	88	X
18720	The solution structure of the Dm DCP1 EVH1 domain in complex with the XRN1 DBM peptide	665	X
18721	(1)H, (13)C, and (15)N backbone chemical shift assignments of StAR-related lipid transfer domain protein 5 (STARD5) in complex with cholic acid	929	X
18722	High resolution NMR solution structure of a symmetrical theta-defensin, BTD-2.	184	X
18723	High resolution NMR solution structure of the theta-defensin RTD-1	154	X
18724	FUC_TBA	171		X
18725	Structure of Faap24 residues 141-215	980	X
18726	Repetitive domain (RP) of aciniform spidroin 1 from Nephila antipodiana	1722	X
18728	SOLUTION STRUCTURE	2266	X
18729	S64	345	X
18730	Chemical shift assignment of West Nile Virus NS2B-NS3 protease in a complex with 4-phenyl-phenyl-KKR-aldehyde.	933	X
18731	Solid-state NMR sequential assignments of the C-terminal oligomerization domain of human C4b-binding protein	230	X
18732	NMR structure of the protein NP_390345.1 from Bacilus subtilis	1026	X
18733	NMR structure of the protein NB7890A from Shewanella sp	1124	X
18734	NMR structure of the hypothetical protein ZP_02034617.1 from Bacteroides capillosus ATCC 29799	1088	X
18735	Solution NMR Structure of the DNA-Binding Domain of Human NF-E2-Related Factor 2, Northeast Structural Genomics Consortium (NESG) Target HR3520O	1033	X
18736	Solution structure of a Novel Alpha-Conotoxin TxIB	92	X
18737	DISTINCT UBIQUITIN BINDING MODES EXHIBITED BY SH3 DOMAINS: M DETERMINANTS AND FUNCTIONAL IMPLICATIONS	266	X
18738	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the HEAT1 domain of the human translation initiation factor 4G, isoform I (eIF4GI-HEAT1)	1011	X
18740	LMPG micelle-bound KSR1 CC-SAM	552	X
18741	The backbone 1H, 13C, 15N resonance assignment of FGFR1 kinase domain in its free form	1322	X
18748	Backbone chemical shift assignments of the C-terminal SH3 domain of Grb2	258	X
18749	Ligase 10C	608	X
18750	Chemical shift of E coli. IscU Prolyl residues in S-states	43	X
18753	Structure of the biofilm matrix promoter AbbA from B. subtilis	785	X
18754	Chemical shift of E coli. IscU Prolyl residues in D-states	56	X
18755	NMR Structure of Mdm2 (6-125) with Pip-1	1127	X
18756	Backbone 15N, 1H, and CA Chemical Shift Assignments for WT IkappaBalpha (67-287)	441	X
18757	High resolution NMR structure of the theta-defensin HTD-2 (retrocyclin 2)	176	X
18758	Refined solution structure and dynamics of First Catalytic Cysteine Half-domain from mouse E1 enzyme	1348	X
18759	Backbone 15N, 1H, and CA Chemical Shift Assignments for C186P/A220P IkappaBalpha (67-287)	395	X
18760	Backbone 15N, 1H, and CA Chemical Shift Assignments for Y254L/T257A IkappaBalpha (67-287)	577	X
18761	1H, 13C, and 15N chemical shift assignments for the phosphotyrosine binding domain 2 (PTB2) of human FE65	1402	X
18762	NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing	140		X
18763	FGFR3tm	558	X
18764	Phf19 links methylated lysine 36 of histone H3 to regulation of Polycomb activity	704	X
18765	Backbone and side-chain assignments of 1H, 15N and 13C chemical shifts of RNA recognition motif 1 (RRM1) of TAR DNA-binding protein (TDP-43)	1156	X
18766	Spatial stucture of PI-AnmTX Ugr 9a-1	250	X
18767	Hug1: an intrinsically disordered protein involved in the DNA damage response.	598	X
18768	Structural study of NS2(2-32) GBVB protein	332	X
18769	Structural study of NS2(32-57) GBVB protein	313	X
18770	TatA T22P	531	X
18771	TatA oligomer	212	X
18772	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Staphylococcal Complement Inhibitor SCIN-A	396	X
18773	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Staphylococcal Complement Inhibitor SCIN-B	406	X
18774	Backbone 1H-13C-15N NMR assignments of yeast OMP synthase	1080	X
18775	Backbone 1H-13C-15N NMR assignments of yeast OMP synthase in complex with orotidine 5 -monophosphate	1083	X
18776	1H, 13C, 15N backbone NMR resonance assignments for N-terminal RNA recognition motif of HvRBP1 from Hordeum vulgare L. (barley)	782	X
18777	1H, 13C, and 15N backbone chemical shift assignments of StAR-related lipid transfer domain protein 6 (STARD6)	1235	X
18778	Solution structure of LIMD2	594	X
18779	Backbone resonance assignments of FrpD from Neisseria meningitidis	1121	X
18780	DNA duplex containing mispair-aligned O4U-heptylene-O4U interstrand cross-link	81		X
18781	DNA duplex containing mispair-aligned O6G-heptylene-O6G interstrand cross-link	80		X
18782	Solution structure of the QUA1 dimerization domain of pXqua, the Xenopus ortholog of Quaking.	690	X
18783	SOLUTION NMR STRUCTURE OF ASTEROPSIN B FROM A MARINE SPONGE ASTEROPUS SP.	343	X
18784	SOLUTION NMR STRUCTURE OF ASTEROPSIN C FROM A MARINE SPONGE ASTEROPUS SP.	336	X
18785	Erbin PDZ Domain (Wild Type)	444	X
18786	Erbin PDZ Domain (S47 Designed Mutant)	438	X
18787	Solution structure of a mutant of the triheme cytochrome PpcA from Geobacter sulfurreducens sheds light on the role of the conserved aromatic residue F15	492	X
18788	Solution structure of staphylococcal nuclease E43S mutant in the presence of ssDNA and Cd2+	1625	X
18789	Solution structure of Kunitz-type neurotoxin LmKKT-1a from scorpion venom	549	X
18791	Sequence-specific backbone 1H, 13C and 15N assignments of the catalytic domain of the Escherichia coli protein tyrosine kinase, Wzc	1160	X
18792	Solution structure of BCL-xL determined with selective isotope labelling of I,L,V sidechains	1050	X
18793	Solution structure of BCL-xL in complex with PUMA BH3 peptide	1195	X
18794	Structure of module 2 from the E1 domain of C. elegans APL-1	759	X
18795	NMR assignments of Amylin in DMSO	171	X
18796	NMR structure of OmpX in phopspholipid nanodiscs	639	X
18797	NMR structure of OmpX in DPC micelles	639	X
18798	Backbone assignments of the apo and Zn(II) protoporphyrin IX-bound states of the soluble form of rat heme oxygenase-1	1108	X
18799	Backbone assignments of the apo and Zn(II) protoporphyrin IX-bound states of the soluble form of rat heme oxygenase-1	975	X
18800	Backbone assignments of the apo and Zn(II) protoporphyrin IX-bound states of the soluble form of rat heme oxygenase-1	1094	X
18801	The solution structure of NmPin, the parvuline of Nitrosopumilus maritimus	1124	X
18802	Structure, phosphorylation and U2AF65 binding of the Nterminal domain of splicing factor 1 during 3 splice site recognition	1530	X
18803	SR-linker peptide	114	X
18804	Homodimeric transmembrane domain of the human receptor tyrosine kinase ErbB1 (EGFR, HER1) in micelles	594	X
18805	Solution NMR Structure of Homeobox Domain of Human ALX4, Northeast Structural Genomics Consortium (NESG) Target HR4490C	736	X
18806	Solution Structure of Miz-1 zinc fingers 5 to 7	1186	X
18807	Chemical shifts for the N-terminal head group of ceSAS-6	778	X
18808	Structure, phosphorylation and U2AF65 binding of the Nterminal domain of splicing factor 1 during 3 splice site recognition	1253	X
18809	SP-B C-terminal (residues 59-80) peptide in methanol	167	X
18811	Structural Characterization of Minor Ampullate Spidroin Domains and their Distinct Roles in Fibroin Solubility and Fiber Formation	1103	X
18812	Solution structure of a DUF3349 annotated protein from Mycobacterium abscessus, MAB_3403c. Seattle Structural Genomics Center for Infectious Disease target Myab.17112.a	1065	X
18813	The solution structure of human PHF1 in complex with H3K36me3	728	X
18814	13C and 15N NMR chemical shifts of E. coli full-length H-NS protein	162	X
18815	N-histidine-tagged EIAV-CA	1064	X
18816	Solution structure of the tenth complement type repeat of human megalin	451	X
18817	Solution NMR analysis of intact KCNE2 in detergent micelles demonstrate a straight transmembrane helix	577	X
18818	Solution structure and dynamics of human S100A14	1077	X
18819	1H, 13C and 15N assignments of the Apo-acyl carrier protein-3 of Pseudomonas aeruginosa.	985	X
18820	1H, 13C and 15N assignments of the Apo-acyl carrier protein-1 of Pseudomonas aeruginosa.	716	X
18821	1H, 13C and 15N assignments of Apo-acyl carrier protein of Pseudomonas aeruginosa.	966	X
18822	Solution Structure of the trans-membrane domain of the NS2A of dengue virus	231	X
18823	1H, 13C and 15N resonance assignments of the C-terminal domain of PpdD	1343	X
18824	Structural characterization of the extended PDZ1 domain from NHERF1.	1421	X
18825	Complex structure of C-terminal CFTR peptide and extended PDZ1 domain from NHERF1.	1429	X
18826	Complex structure of C-terminal CFTR peptide and extended PDZ2 domain from NHERF1.	1534	X
18827	Sequence-specific 1H,13C, and 15N resonance assignment of GATE-16	647	X
18828	NMR Assignment of Arabidopsis thaliana cytochrome c in its reduced state	234	X
18829	NMR restraints for the C-terminal RRM domain (RRM3) of TIA-1 protein.	393	X
18830	Solution structure of ALPS-23 peptide in SDS micelles	137	X
18831	Solution structure of U14Ub1, an engineered ubiquitin variant with increased affinity for USP14	916	X
18832	Solution structure of the SH3 domain of DOCK180	770	X
18833	cis form of a photoswitchable PDZ domain crosslinked with an azobenzene derivative	1123	X
18834	trans form of a photoswitchable PDZ domain crosslinked with an azobenzene derivative	1106	X
18835	Structure of perimidinone-derived synthetic nucleoside paired with guanine in DNA duplex	109		X
18836	Backbone assignments of 8M urea denatured S-YibK-C variant from Haemophilus influenzae (HI0766)	815	X
18837	15N, 13C and 1H Resonance Assignments and Secondary Structure Determination of a Variable Heavy Chain Antibody	1277	X
18838	Solution structure of the ID3 stem loop of domain 1 in the ai5gamma group II intron	290			X
18839	Chemical shift assignments of the monomeric canecystatin-1 from Saccharum officinarum	1237	X
18840	The ZZ domain of cytoplasmic polyadenylation element binding protein 1 (CPEB1)	789	X
18841	E. coli O157 ParE2-associated antitoxin 2 (PaaA2)	865	X
18842	NMR structure of the complex between the PH domain of the Tfb1 subunit from TFIIH and Rad4	1558	X
18843	1H, 13C and 15N assignments of the four N-terminal domains of human fibrillin-1	1435	X
18844	ubiquitin-like domain-containing C-terminal domain phosphatase (UBLCP1)	900	X
18845	SUP-12	1198	X
18846	SUP-12 + GGUGUGC	1197	X		X
18847	Structure of stacked G-quadruplex formed by human TERRA sequence in potassium solution	232			X
18848	LTBP1 EGF3-cbEGF15	759	X
18849	Chemical shift assignments and secondary structure prediction of the C-terminal domain of the response regulator BfmR from Acinetobacter baumannii	1202	X
18850	Solution structure of the Haloferax volcanii HVO_2177 protein	1217	X
18851	HIV-1 Rev ARM peptide (residues T34-R50)	293	X
18852	HIV-1 Rev ARM peptide (residues T34-R50)	302	X
18853	Backbone and side-chain 1H, 13C, 15N NMR assignment of the N-terminal domain of Escherichia coli LpoA	2919	X
18854	1H,15N and 13C backbone chemical shifts of Human Halo S100A6 C3S	360	X
18855	Backbone assignments of 8M urea denatured YibK from Haemophilus influenzae (HI0766)	736	X
18856	HADDOCK structure of GtYybT PAS Homodimer	1485	X
18857	Backbone 1H, 13C,and 15N chemical shift assignments for alpha-synuclein at different pH and temperature	21514	X
18858	Biosynthetic engineered B28K-B29P human insulin monomer structure in in water/acetonitrile solutions.	341	X
18859	Biosynthetic engineered B28K-B29P human insulin monomer structure in in water solutions.	323	X
18860	solid-state NMR assignment of a-synuclein fibrils	367	X
18861	NMR Structure of Antiamoebin I (peptaibol antibiotic) bound to DMPC/DHPC bicelles	191	X
18862	Parallel human telomeric quadruplex containing 2'F-ANA substitutions	111		X
18863	The Solution Structure of Monomeric Hepatitis C Virus p7 Yields Potent Inhibitors of Virion Release	768	X
18864	High resolution structure and dynamics of CsPinA parvulin at physiological temperature	1090	X
18865	Ovine Doppel Signal peptide (1-30)	226	X
18867	CD79a cytosolic domain	591	X
18868	Interaction of Human S100A6 (C3S) with V domain of Receptor for Advanced Glycation End products (RAGE)	441	X
18869	Solution NMR Structure of Cyclin-dependent kinase 2-associated protein 2 (CDK2AP2, DOC-1R) from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR8910C	783	X
18870	Solution structure of the dimerization domain of Aux/IAA transcription factor Ps-IAA4 from pea (Pisum sativum)	1128	X
18871	Solution structure of a chaperone in type III secretion system	323	X
18872	ID3 stem	132			X
18873	Chemical shift assignment for Lewisx with a (CH2)3NH2 spacer	53				X
18874	PHD domain of ING4 N214D mutant	429	X
18875	[Aba5,14]BTD-2	176	X
18876	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Complex of MDM2(3-109) and p73 TAD(10-25)	1257	X
18877	1H,13C,15N chemical shift assignment of Ca2+_bound CaBP4	1462	X
18878	Solution structure of the Hs. PSIP1 PWWP domain	1155	X
18879	SP-B C-terminal (residues 59-80) peptide in DPC micelles	197	X
18880	SOLUTION STRUCTURE OF THE SMALL DICTYOSTELIUM DISCOIDEIUM MYOSIN LIGHT CHAIN MlcB PROVIDES INSIGHTS INTO IQ-MOTIF RECOGNITION OF CLASS I MYOSIN MYO1B	926	X
18881	NMR solution structure of the d3'-hairpin from the Sc.ai5gamma group II intron including the EBS1:dIBS1 RNA:DNA hybrid	385		X	X
18882	TICAM-2 TIR domain	2058	X
18883	TICAM-1 TIR domain structure	2139	X
18884	CD79b cytosolic domain	241	X
18885	S. cerevisiae proteasome regulatory particle ATPase Rpt6 C-terminal domain	523	X
18887	Solution structure of hypothetical protein lmo0427	1340	X
18888	EGFR transmembrane - juxtamembrane (TM-JM) segment in bicelles: MD guided NMR refined structure.	568	X
18889	CD3e cyt	492	X
18890	CD3g cytosolic domain	222	X
18891	Solution structure of the Tetrahymena telomerase RNA stem IV terminal loop	341			X
18892	Solution structure of the helix II template boundary element from Tetrahymena telomerase RNA	369			X
18893	NMR solution structure of the d3'-hairpin of the group II intron Sc.ai5gamma including EBS1 bound to IBS1	397			X
18894	NMR solution structure of the d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5gamma	343			X
18895	Backbone and partial sidechain assignment of the microtubule binding domain of the MAP1B light chain	1370	X
18896	NMR STRUCTURE OF A BI-FUNCTIONAL LYSOZYME-PROTEASE INHIBITOR FROM THE DEFENSE GLAND OF COPTOTERMES FORMOSANUS SHIRAKI SOLDIERS	537	X
18897	NMR structure of the glycosylated conotoxin CcTx from Conus consors	353	X			X
18898	Backbone and side-chain assignments of a tethered complex between LMO4 and DEAF-1	1065	X
18899	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the bacterial toxin Doc	1382	X
18900	NMR STRUCTURE OF THE CATALYTIC DOMAIN FROM E. FAECIUM L,D- TRANSPEPTIDASE	1597	X
18901	NMR structure of the C-terminal domain of the protein HCFC1 from MUS MUSCULUS	1311	X
18902	Solution structure of the major G-quadruplex formed in the human VEGF promoter: Insights into loop interactions of the parallel G-quadruplexes	202		X
18904	NMR solution structure of the two domain PPIase SlpA from Escherichia coli	1645	X
18905	NMR structure of the RRM2 domain of the protein RBM10 from homo sapiens	1336	X
18906	1H, 13C and 15N resonance assignments of an N-terminal domain of CHD4	930	X
18907	Solution structure of Duplex DNA	225		X
18908	Human programmed cell death 1 receptor	1346	X
18909	Solution NMR structure of the SANT domain of human DNAJC2; Notrheast structural genomics consortium target HR8254a	947	X
18910	NMR solution structure of the AVR3a11 from Phytophthora Capsici	642	X
18911	NMR STRUCTURE OF THE CATALYTIC DOMAIN FROM E. FAECIUM L,D- TRANSPEPTIDASE ACYLATED BY ERTAPENEM	1556	X
18912	The membran-proximal domain of ADAM17	409	X
18913	[Aba3,16]BTD-2	180	X
18914	[Aba3,7,12,16]BTD-2	184	X
18915	Brevenin DPC micelle bound structure	145	X
18916	NMR solution structure of BRCT domain of yeast REV1	1150	X
18917	Solution NMR structure of the N-terminal domain of STM1478 from Salmonella typhimurium LT2: Target STR147A of the Northeast Structural Genomics consortium (NESG), and APC101565 of the Midwest Center for Structural Genomics (MCSG).	751	X
18918	Chemical shifts assignment for the unfolded state of the N-terminal domain of ribosomal protein L9 (NTL9) V3AI4A double mutant in 8.3 M urea	268	X
18919	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Full-Length Rabbit Cytochrome b5	939	X
18920	Solution structure of Entamoeba histolytica HP1 chromodomain	639	X
18921	Structure of [L-HisB24] insulin analogue at pH 1.9	348	X
18922	1H, 13C and 15N assignments of the dimeric receiver domain of PmrAn response regulator from Klebsiella pneumonia	897	X
18923	Structure of [L-HisB24] insulin analogue at pH 8.0	311	X
18924	Structure of [D-HisB24] insulin analogue at pH 1.9	353	X
18925	Structure of [D-HisB24] insulin analogue at pH 8.0	311	X
18926	Solution structure of MCh-1: A novel inhibitor cystine knot peptide from Momordica charantia	178	X
18927	Solution NMR assignments of V5 domain from Protein Kinase C alpha	302	X
18928	Solution NMR assignments of the phosphorylation-mimicking mutant of V5 domain from Protein Kinase C alpha	302	X
18929	Solution NMR assignments of V5 domain from Protein Kinase C alpha, in complex with DPC micelles	286	X
18930	Solution NMR assignments of the phosphorylation-mimicking mutant of V5 domain from Protein Kinase C alpha, in complex with DPC micelles	266	X
18931	[Aba5,7,12,14]BTD-2	185	X
18933	ASFV Pol X structure	738	X
18934	Binary complex of African Swine Fever Virus Pol X with MgdGTP	2357	X
18935	African Swine Fever Virus Pol X in the ternary complex with MgdGTP and DNA	1212	X	X
18937	[Aba3,5,7,12,14,16]BTD-2	192	X
18938	BTD-2[3,4]	172	X
18939	Solution Structure of C-terminal AbrB	488	X
18940	Structure of the S2 neuropeptide from the starfish Asterias rubens.	73	X
18941	Backbone 1H, 13C, and 15N chemical shift assignments for the LFA-1 wild type I-domain	927	X
18942	alpha-1 integrin I-domain in complex with GLOGEN triple helical peptide	2143	X
18943	N-terminal domain of pneumococcal PhtD protein with bound Zn(II)	1473	X
18944	NMR Structure of the homeodomain transcription factor Gbx1 from Homo sapiens	817	X
18945	k-Ssm1a	609	X
18946	Solution structure of the insecticidal spider-venom peptide Aps III	385	X
18947	SpnDE1	708	X
18948	STRUCTURE OF LASSO PEPTIDE ASTEXIN-1(19)	124	X
18949	The H/D-exchange Kinetics of the Escherichia coli Co-chaperonin GroES studied by 2D-NMR and DMSO-Quenched Exchange Methods	88	X
18950	THE SOLUTION STRUCTURE OF 3',5'-LINKED 2'-O-(2-METHOXYETHYL)-RNA DUPLEX	173			X
18951	NMR solution structure of a MYB-like DNA binding domain of KNL-2 from C. Elegans	568	X
18952	Serine 16 phosphorylated phospholamban pentamer, Hybrid solution and solid-state NMR structural ensemble	98	X
18953	Solution Structure of gammaM7-Crystallin	1630	X
18954	NMR structure of the GUCT domain from human DEAD box polypeptide 21	1066	X
18955	STRUCTURE OF NAB2P TANDEM ZINC FINGER 12	881	X
18956	STRUCTURE OF NAB2P TANDEM ZINC FINGER 34	859	X
18958	The Integrin L Transmembrane Domain in Bicelles: Structure and Interaction with Integrin 2	632	X
18959	NMR structure of Rsa1p238-259 from S. Cerevisiae	468	X
18961	NMR assignments of a hypothetical pseudo-knotted protein HP0242 from H. pylori	1149	X
18963	1H, 13C, 15N chemical shift assignments of Dido PHD domain	1144	X
18964	Characterization of a Novel Alpha4/6-Conotoxin TxIC from Conus textile that Potently Blocks alpha3beta4 Nicotinic Acetylcholine Receptors	77	X
18965	Solution Structure of Marine Sponge-Derived Asteropsin E Which is Highly Resistant to Gastrointestinal Proteases	321	X
18966	Global folded of the type IV pilin ComP from Neisseria meningitidis	1268	X
18967	Solution structure of the C-terminal zinc-binding domain of HPV51 oncoprotein E6	944	X
18968	Diffuse binding of Zn2+ to the denatured ensemble of Cu/Zn superoxide dismutase 1	593	X
18969	1H, 13C and 15N resonance assignments of S55A mutant of UVI31+ from Chlamydomonas reinhardtii	476	X
18970	peptide leucine arginine	154	X
18971	Structure and dynamics of a human Nedd4 WW domain-ENaC complex	640	X
18972	SOLUTION STRUCTURE OF THE SOMATOSTATIN SST3 RECEPTOR ANTAGONIST TAU-CONOTOXIN CnVA	154	X
18973	DNA containing a cluster of 8-oxo-guanine and abasic site lesion : alpha anomer	199		X
18974	Modified Helix 69	201			X
18975	Unmodified Helix 69	288			X
18976	CALMODULIN, I85L, F92E, H107I, L107I, A128T, M144R MUTANT	1865	X
18977	Assignment of Tyrosine Phosphatase Related to Biofilm formation A (TpbA) from Pseudomonas Aeruginosa bound to phosphate	1001	X
18978	Solution structure of Ph1500: a homohexameric protein centered on a 12-bladed beta-propeller	1930	X
18979	DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer	199		X
18980	NMR solution structure of HIV-1 nucleocapsid protein in complex with an inhibitor displaying a 2 inhibitors:1 NC stoichiometry	590	X
18981	DNA containing a cluster of 8-oxo-guanine and THF lesion	206		X
18982	Transcriptional regulatory protein	1420	X
18984	DNA containing a cluster of 8-oxo-guanine and abasic site lesion : alpha anomer (AP6, 8OG 14)	202		X
18985	DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer (6AP, 8OG14)	202		X
18986	1H, 13C, and 15N Chemical Shift Assignments for the C-terminus of the minichromosome maintenance protein MCM from Sulfolobus solfataricus	1110	X
18987	Solution NMR structure of SACOL0876 from Staphylococcus aureus COL, NESG target ZR353 and CSGID target IDP00841	1406	X
18988	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Pseudomonas Aeruginosa heme oxyengase apo and in presence of selected compounds	779	X
18989	Solution NMR structure of the Polyketide_cyc-like protein Cgl2372 from Corynebacterium glutamicum, Northeast Structural Genomics Consortium Target CgR160.	1842	X
18990	protein structure	1434	X
18991	Backbone resonance assignment of [2Fe-2S]-ferredoxin in its oxidized state	443	X
18992	Backbone resonance assignment of [2Fe-2S]-ferredoxin in its reduced state	332	X
18993	Backbone resonance assignment of Alt a 1, the major allergen of Alternaria alternata	631	X
18994	1H, 13C and 15N chemical shift assignments for the N-terminal domain of the KCNH channel from Zebrafish	1602	X
18995	Structural Insights into Human S100B and Basic Fibroblast Growth Factor (FGF2) Interaction	412	X
18998	Allatide O4 conformation 2	182	X
18999	solution structure of allatide O4 in solution	182	X
19000	Solution NMR structure of VV2_0175 from Vibrio vulnificus, NESG target VnR1 and CSGID target IDP91333	1036	X
19001	OspE	1836	X
19002	Solution structure of the Core Domain (11-85) of the Murine Norovirus VPg protein.	912	X
19003	Solution structure of the Core Domain (10-76) of the Feline Calicivirus VPg protein.	853	X
19004	1H, 13C, and 15N backbone chemical shift assignments of the low-spin CN-bound yeast cytochrome c peroxidase with the C-terminal His-tag	1354	X
19005	1H, 13C, and 15N backbone chemical shift assignments of the low-spin CN-bound yeast cytochrome c peroxidase with the N-terminal His-tag	1311	X
19006	1H, 13C and 15N backbone and side chain resonance assignment of the phosphorelay protein VanU from Vibrio anguillarum	1277	X
19007	Solution structure of Bacillus subtilis MinC N-terminal domain	1071	X
19008	Chemical Shift Assignments for SinR from Bacillus subtilis	1206	X
19009	40-residue beta-amyloid fibril derived from Alzheimer's disease brain	216	X
19010	1H, 15N and 13C backbone chemical shift assignment of the titin A59-A60 domain tandem	783	X
19011	1H, 15N and 13C backbone chemical shift assignment of the titin A60 domain	553	X
19012	NMR structure of hypothetical protein BT_0846 from Bacteroides thetaiotaomicron VPI-5482 (NP_809759.1)	1101	X
19013	Solution structure of the RRM domain of the hypothetical protein CAGL0M09691g from Candida glabrata	1479	X
19014	Solution structure of the putative Ras interaction domain of AFD-1, isoform a from Caenorhabditis elegans	1337	X
19015	Backbone resonance assignments for G protein alpha i3 subunit in the GDP-bound state	1527	X
19017	Solution structure of an intramolecular propeller-type G-quadruplex containing a single bulge	183		X
19018	NMR structure of E. coli ribosomela decoding site with apramycin	373			X
19023	Solution structure and sigma factor interactions of Mycobacterium tuberculosis RNA polymerase binding protein A	813	X
19024	single G-bulge in a conserved regulatory region of the HEV genome	257			X
19025	Solid-state Chemical Shift Assignments for CAP-Gly Domain of Mammalian at 19.9 T	684	X
19026	Analysis of the structural and molecular basis of voltage-sensitive sodium channel inhibition by the spider toxin, Huwentoxin-IV ( -TRTX-Hh2a).	194	X
19027	Backbone 1H, 13C, and 15N Chemical Shift Assignments for rubredoxin type protein from Mycobacterium ulcerans	543	X
19028	Flexible anchoring of archaeal MBF1 on ribosomes suggests role as recruitment factor	392	X
19029	1H, 13C and 15N resonance assignments of K2A1: N-terminal repeat of the K2A domain of Plasmodium falciparum knob - associated histidine rich protein (KAHRP).	489	X
19030	Analysis of the structural and molecular basis of voltage-sensitive sodium channel inhibition by the spider toxin, Huwentoxin-IV ( -TRTX-Hh2a).	191	X
19031	Solid-state Chemical Shift Assignments for p150Glued CAP-Gly Domain in complex with EB1 at 19.9 T	323	X
19032	Analysis of the structural and molecular basis of voltage-sensitive sodium channel inhibition by the spider toxin, Huwentoxin-IV ( -TRTX-Hh2a).	187	X
19033	NMR structure of the SH3 domain of human RAS p21 protein activator (GTPase activating protein) 1	733	X
19034	NMR Structure of the third RNA Recognition Motif (RRM) of U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 2	1190	X
19035	G-rich VEGF aptamer with LNA modifications	189		X
19036	NMR structure of the complex of an N-terminally acetylated alpha-synuclein peptide with calmodulin	806	X
19037	1H, 13C, and 15N Chemical Shift Assignments of h-prune C-terminal domain	534	X
19038	The structure of the complex of cytochrome P450cam and its electron donor putidaredoxin determined by paramagnetic NMR spectroscopy	494	X
19039	NMR solution structure of domain 5 from Azotobacter vinelandii Intron 5 at pH 7.8	880			X
19040	structure of 2'-5' AG1 lariat forming ribozyme in its inactive state	789			X
19041	Spatial structure of dimeric VEGFR2 membrane domain in DPC micelles	521	X
19042	Complete 1H, 13C, and 15N Chemical Shift Assignments for Burkholderia pseudomallei Frataxin like protein	1338	X
19043	Protein A binding by an engineered Affibody molecule	1477	X
19044	Backbone and Side Chain 1H, 13C and 15N Chemical Shift Assignments for Domain 4 of Phosphomannomutase/Phosphoglucomutase from Pseudomonas aeruginosa	1136	X
19045	The NMR structure of the BID-BAK complex	2095	X
19046	Sequence-specific backbone 1H, 13C and 15N assignments of the 34 kDa catalytic domain of PTPN5	884	X
19047	Solution Structure of the Bacillus cereus Metallo-Beta-Lactamase BcII	4074	X
19048	Solution Structure of the Bacillus cereus Metallo-Beta-Lactamase BcII in Complex with R-Thiomandelic Acid	4041	X
19049	Solution structure of chicken Engrailed 2 homeodomain	827	X
19050	Structure of the C-domain of Calcium-saturated Calmodulin bound to the IQ motif of NaV1.2	998	X
19051	1H, 13C, 15N assignment of Voltage-gated calcium channel beta 4 subunit core domains	1482	X
19052	NMR Structure of the Complete Internal Fusion Loop mutant L529A/I544A from Ebolavirus GP2 at pH 5.5	602	X
19053	Solution structure of FimA wt	668	X
19054	NMR structures of human apoptotic protein tBid in LPPG micelle	1598	X
19055	ns5a D2 con1	455	X
19056	1H, 13C, 15N backbone and side chain NMR resonance assignments of the N-terminal NEAr iron Transporter (NEAT 1) domain of the IsdB hemoglobin receptor of Staphylococcus aureus	1281	X
19057	brevinin-2-related peptide, an antimicrobial peptide derived from frog skin	135	X
19058	Atomic-resolution structure of a doublet cross-beta amyloid fibril	65	X
19059	ns5a308	244	X
19060	Atomic-resolution structure of a triplet cross-beta amyloid fibril	65	X
19061	1H,13C and 15N resonance assignments of Ca2+ - bound human S100A15	853	X
19062	Atomic-resolution structure of a cross-beta protofilament	68	X
19063	TIAR RRM2 chemical shifts in the apo state	418	X
19064	TIAR RRM2 chemical shifts in bound to RNA 5'-UUAUUU-3'	412	X		X
19065	ADAPT-NMR automated assignments and manual assignments of RNaseA	232	X
19066	Solution structure of the FimH adhesin carbohydrate-binding domain	1939	X
19067	Solution structure of latherin	2649	X
19068	Solution NMR Structure CTD domain of NFU1 Iron-Sulfur Cluster Scaffold Homolog from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR2876C	1075	X
19069	1H,13C,15N Assignement of EFGP fluorescent protein	2944	X
19070	SOLUTION STRUCTURE OF LIPIDATED GLUCAGON ANALOG IN WATER	201	X
19071	SOLUTION STRUCTURE OF LIPIDATED GLUCAGON ANALOG IN D-TFE	177	X
19074	1H, 13C, 15N chemical shift assignments of Dido PHD domain in complex with peptide H3K4me3	715	X
19075	1H, 13C, and 15N backbone chemical shift assignments of the iron-free protoporphyrin IX yeast cytochrome c peroxidase with the C-terminal His-tag	975	X
19076	1H, 13C, and 15N backbone chemical shift assignments of the resting-state yeast cytochrome c peroxidase with the N-terminal His-tag	905	X
19077	1H, 13C and 15N backbone and side-chain resonance assignments of the N-terminal ubiquitin-binding domain of the human deubiquitinase USP28	1362	X
19078	Human fibrillin1 EGF2-EGF3-hybrid1-cbEGF1	1759	X
19079	Solution structure of the 2A proteinase from a common cold agent, human rhinovirus RV-C02, strain W12	1485	X
19080	Backbone assignment of an unlinked NS2B and NS3 protease complex of dengue virus 2	1460	X
19081	NMR structure of the P4 hairpin of the CPEB3 ribozyme	179			X
19082	Backbone and ILV methyl resonance assignments of E. coli thymidylate synthase bound to cofactor and a nucleotide analogue	1510	X
19083	Backbone 1H, 13C, and 15N; and VL 13CH3 Side-chain Chemical Shift Assignments for Mutant SENP1 C603S Catalytic Domain	1054	X
19084	The Mengovirus Leader protein	547	X
19085	Novel method of protein purification for structural research. Example of ultra high resolution structure of SPI-2 inhibitor by X-ray and NMR spectroscopy.	379	X
19086	Solution structure of human ribosomal protein P1.P2 heterodimer	837	X
19087	The NMR chemical shift assignments for backbone 1H, 13C, and 15N of VirR (Rv0431)	910	X
19088	Backbone chemical shift assignment of Rv2140c, a phosphatidylethanolamine binding protein from Mycobacterium tuberculosis	618	X
19089	Backbone 1H, 15N Chemical Shift Assignments for wild-type Escherichia coli Adenylate Kinase with 20mM ADP at 293, 298, 303, and 313K	1436	X
19090	Backbone 1H, 15N Chemical Shift Assignments for wild-type Escherichia coli Adenylate Kinase with 20mM ADP and Calcium at 298K	270	X
19091	Backbone 1H, 15N Chemical Shift Assignments for wild-type Escherichia coli Adenylate Kinase with 20mM ADP and Magnesium at 298K	342	X
19092	Backbone 1H, 15N Chemical Shift Assignments for R156K mutant Escherichia coli Adenylate Kinase with 20mM ADP at 293K	383	X
19093	Backbone 1H, 15N Chemical Shift Assignments for R156K mutant Escherichia coli Adenylate Kinase with 20mM ADP and magnesium at 293K	377	X
19094	Enterocin 7A	316	X
19095	Backbone and side-chain 1H, 13C and 15N resonance assignments of the OB domain of the single-stranded DNA binding protein from Sulfolobus Solfataricus	1467	X
19098	Sidechain and backbone NMR resonance assignment for the RNA binding and C-terminal domain of the ribosome assembly factor Nop6 from S. cerevisiae	1653	X
19099	1H, 13C and 15N chemical shifts of human beta-2-microglobulin in solution	718	X
19101	Enterocin 7B	299	X
19102	NMR and Mass Spectrometric Studies of M-2 Branch Mini-M Conotoxins from Indian Cone Snails	113	X
19103	Solution Structure of a Chi/Lambda Conotoxin fron Conus araneosus	102	X
19104	Induced folding in RNA recognition by Arabidopsis thaliana DCL1	373	X
19105	Induced folding in RNA recognition by Arabidopsis thaliana DCL1	371	X
19106	The protease-resistant N-terminal domain of TIR-domain containing adaptor molecule-1, TICAM-1	2007	X
19107	1H, 13C and 15N Chemical Shift Assignments for Phl p 5a	2589	X
19108	NMR structure of human restriction factor APOBEC3A	1851	X
19109	Chemical Shift Assignments of the C-terminal Eps15 Homology Domain-3 EH Domain	1336	X
19110	NMR assignments of PI3-SH3 aided by protonless NMR spectroscopy	879	X
19111	USP25	1732	X
19112	Structural characterization by NMR of a double phosphorylated chimeric peptide vaccine for treatment of Alzheimer's disease	199	X
19113	Chemical shifts of human beta-2 microglobulin bound to HLA-B2709 complexed with the nonamer peptide pVIPR (RRKWRRWHL)	617	X
19114	4E-BP2	760	X
19115	Full-length mercury transporter protein MerF in lipid bilayer membranes	174	X
19116	Chemical shifts of human beta-2 microglobulin bound to HLA-B2709 complexed with the nonamer peptide TIS (RRLPIFSRL)	164	X
19117	NMR solution structure ensemble of 3-4D mutant domain 11 IGF2R in complex with IGF2 (domain 11 structure only)	1640	X
19118	Chemical shifts of human beta-2 microglobulin bound to HLA-B2709 complexed with the nonamer peptide pLMP2 (RRRWRRLTV)	160	X
19119	Chemical shifts of human beta-2 microglobulin bound to HLA-B2709 complexed with the nonamer peptide pGR (RRRWHRWRL)	183	X
19120	Chemical shifts of human beta-2 microglobulin bound to HLA-B2705 complexed with the nonamer peptide pVIPR (RRKWRRWHL)	158	X
19121	Chemical shifts of human beta-2 microglobulin bound to HLA-B2705 complexed with the nonamer peptide TIS (RRLPIFSRL)	158	X
19122	Chemical shifts of human beta-2 microglobulin bound to HLA-B2705 complexed with the nonamer peptide pLMP2 (RRRWRRLTV)	160	X
19123	Chemical shifts of human beta-2 microglobulin bound to HLA-B2705 complexed with the nonamer peptide pGR (RRRWHRWRL)	184	X
19124	NMR spatial structure of the antimicrobial peptide Tk-Amp-X2	284	X
19125	Molecular Basis of Histone Acetyllysine Recognition by the BRPF1 Bromodomain.	515	X
19126	Structure of full-length transmembrane domains of human glycine receptor 1 monomer subunit	1145	X
19128	cIn936W	49	X
19129	NMR SOLUTION STRUCTURE OF trans (MAJOR) FORM OF In936	48	X
19130	NMR SOLUTION STRUCTURE OF cis (MINOR) FORM OF In936 in Methanol	63	X
19131	SOLUTION NMR STRUCTURE OF trans (MAJOR) FORM OF In937 in Methanol	64	X
19132	SOLUTION STRUCTURE OF cis(C2-P3) trans (D5-P6) FORM OF lO959 IN WATER	40	X
19133	SOLUTION STRUCTURE OF trans(C2-P3) trans (D5-P6) of LO959 IN METHANOL	35	X
19134	Backbone assignments of 8M urea-denatured YbeA from Escherichia coli	692	X
19135	Efficient Protocol for Assignment of Large, Intrinsically Disordered Proteins. 49.2kDa MAP2c, a case study	4675	X
19136	ERG Ets Domain Backbone Chemical Shifts	498	X
19137	ERGi Backbone Chemical Shifts	543	X
19138	ERG DNA Complex	633	X	X
19139	Backbone chemical shift assignments of the talin rod domain, R7 (residues 1357-1653 (delta1454-1586))	834	X
19140	Dynorphin A R6W	137	X
19141	Dynorphin A L5S	126	X
19142	Structure of a vertebrate toxin from the badge huntsman spider	260	X
19143	Solution structure of the Escherichia coli apo ferric enterobactin binding protein	1396	X
19144	A structural model of CAP mutant (T127L and S128I) in the apo state	339	X
19145	A STRUCTURAL MODEL OF CAP MUTANT (T127L AND S128I) IN CGMP- BOUND STATE	369	X
19146	Solution structure of RING domain of E3 ubiquitin ligase Doa10	974	X
19147	ZINC Binding Domain	1042	X
19148	The actinobacterial transcription factor RbpA binds to the principal sigma subunit of RNA polymerase	512	X
19149	The actinobacterial transcription factor RbpA binds to the principal sigma subunit of RNA polymerase	524	X
19150	1H, 15N, and 13C Chemical Shift Assignments of the Light-activated State of a Cyanobacterial GAF Domain (NpF2164-GAF3)	1044	X
19151	apo_YqcA	1655	X
19152	holo_YqcA	1764	X
19153	NMR solution structure ensemble of 3-4D mutant domain 11 IGF2R	1703	X
19154	Sungsanpin	180	X
19155	NMR Structure of CbpAN from Streptococcus pneumoniae	1045	X
19156	1H, 13C, and 15N NMR Assignments of a Hedgehog Autoprocessing Domain	1923	X
19157	ATOMIC-RESOLUTION STRUCTURE OF A CROSS-BETA QUADRUPLET AMYLOID FIBRIL DETERMINED BY SOLID-STATE MAGIC ANGLE SPINNING NMR AND CRYO-EM	61	X
19158	Solution NMR structure of the d(GGGTTGGGTTTTGGGTGGG) quadruplex in sodium conditions	367		X
19159	Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions	450		X
19160	Ligand binding promiscuity of human liver fatty acid binding protein: structural and dynamic insights from an interaction study with glycocholate and oleate	920	X
19161	Backbone chemical shift assignment of porcine amelogenin in the presence of SDS micelles	569	X
19162	Structure of the p7 channel of Hepatitis C virus, genotype 5a	499	X
19163	The solution structure of the J-domain of human DnaJA1	770	X
19164	solution structure of cerebral dopamine neurotrophic factor (CDNF)	2014	X
19165	Backbone and side chain chemical shift assignments of bacterial acid-stress chaperone HdeA at pH 6	942	X
19167	Structural determination of the Citrus sinensis Poly(A)-Binding Protein CsPABP1	1181	X
19168	Solution structure of the a C-terminal domain of translation initiation factor IF-3 from Campylobacter jejuni	1231	X
19169	Solution structure of uncharacterized thioredoxin-like protein PG_2175 from Porphyromonas gingivalis	1874	X
19170	solution structure of the calmodulin-binding domain of plant calcium-ATPase ACA8	206	X
19171	transcriptional repressor domain of methylated DNA binding domain protein 1	791	X
19172	PTPN11 C-SH2 domain free form	1432	X
19173	PTPN11 C-SH2 domain bound form	1415	X
19174	Structure of the Regulatory Domain of Human Brain Carnitine Palmitoyltransferase 1	185	X
19175	[Asp2]RTD-1	168	X
19176	[Asp11]RTD-1	162	X
19177	[Asp2,11]RTD-1	162	X
19178	Enteropathogenic Escherichia coli 0111:H- str. 11128 ORF EC0111_1119 similar to bacteriophage lambda ea8.5	865	X
19179	ORF PP_3909 from Pseudomonas putida KT2440 encoding a protein similar to bacteriophage lambda ea8.5	859	X
19180	Trp-cage Circular Permutant	126	X
19181	1H, and 15N Chemical Shift Assignments for mycoloylated PorH in DMSO solution	417	X
19182	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the catalytic domain of human Aprataxin	634	X
19183	Trp-cage 16b P12W: a Hyperstable Miniprotein	125	X
19184	solution structure of the calmodulin-binding domain of plant calcium-ATPase ACA2	206	X
19185	Structure of the Type IVa Major Pilin from the Electrically Conductive Bacterial Nanowires of Geobacter sulfurreducens	675	X
19186	Chemical shift assignments of a S72-S107 peptide of 18.5kDa murine myelin basic protein (MBP)	218	X
19187	1H, 13C, and 15N Chemical Shift Assignments for the C-terminus of the minichromosome maintenance protein MCM from Methanothermobacter thermautotrophicus	1133	X
19188	Ligand binding promiscuity of human liver fatty acid binding protein: structural and dynamic insights from an interaction study with glycocholate and oleate	750	X
19189	Ligand binding promiscuity of human liver fatty acid binding protein: structural and dynamic insights from an interaction study with glycocholate and oleate	753	X
19190	Solution structure of a Beta-Hairpin Peptidomimetic antibiotic that target LptD in Pseudomonas sp.	136	X
19191	4EBP1 contains a pre-populated eIF4E-binding helix	682	X
19192	Solution Structure of a Beta-Hairpin Peptidomimetic antibiotic that target LptD in Pseudomonas sp.	147	X
19193	NMR solution structure of N-terminal domain of (Y81F)-EhCaBP1	631	X
19194	Backbone resonance assignment of the alpha-subunit within the megadalton proteasome-activator complex	465	X
19195	alfa-actinin from parasite Entamoeba histolytica	1542	X
19196	N-terminal domain of (Y81F)-EhCaBP1 structure	629	X
19197	C-terminal structure of (Y81F)-EhCaBP1	711	X
19198	NMR Structure of the protein NP_346341.1 from Streptococcus pneumoniae	778	X
19200	RXFP1 utilises hydrophobic moieties on a signalling surface of the LDLa module to mediate receptor activation	388	X
19201	TAX1BP1 UBZ1+2	833	X
19202	NMDA RECEPTOR ANTAGONIST, CONANTOKIN BK-B, NMR, 20 STRUCTURE	60	X
19203	NMR structure of RNA recognition motif 2 (RRM2) of Homo sapiens splicing factor, arginine/serine-rich 1	961	X
19204	Backbone 1H, 13C, and 15N Chemical Shift Assignments for BAF155 SWIRM	974	X
19205	Solution NMR Structure of Engineered Cystine Knot Protein 2.5D	321	X
19206	1H, 13C and 15N backbone and side-chain resonance assignments of a family 36 carbohydrate binding module of Xylanase from Paenibacillus campinasensis	1488	X
19207	backbone NMR assignments for human apo-HDHD4	1012	X
19208	Backbone resonance assignments of the 42 kDa enzyme arginine kinase in the transition state analogue form	1612	X
19209	Backbone NMR assignments for human HDHD4 in complex with calcium and N-acetylneuraminate-9-phosphate	1074	X
19210	The C-terminal Region of Disintegrin Modulate its 3D Conformation and Cooperate with RGD Loop in Regulating Recognitions of Integrins	449	X
19211	The C-terminal Region of Disintegrin Modulate its 3D Conformation and Cooperate with RGD Loop in Regulating Recognitions of Integrins	471	X
19212	The C-terminal Region of Disintegrin Modulate its 3D Conformation and Cooperate with RGD Loop in Regulating Recognitions of Integrins	471	X
19213	Blue Light-Absorbing State of TePixJ, an Active Cyanobacteriochrome Domain	1805	X
19214	Green Light-Absorbing State of TePixJ, an Active Cyanobacteriochrome Domain	1544	X
19215	Independently verified structure of gp41-M-MAT, a membrane associated MPER trimer from HIV-1 gp41	485	X
19216	Structural and Functional Analysis of Transmembrane Segment IV of the Salt Tolerance Protein Sod2	211	X
19217	SmTSP2EC2	912	X
19218	Solution structure of yeast dithiol glutaredoxin Grx8	339	X
19219	1H, 13C, and 15N Chemical Shift Assignments for a proteasome related subunit	4165	X
19220	solution structure of a proteasome related subunit N terminal domain	1885	X
19221	solution structure of a proteasome related subunit C terminal domain	2216	X
19222	NMR Studies of DNA Support the Role of Pre-Existing Minor Groove Variations in Nucleosome Indirect Readout	264		X
19223	Sequence specific backbone assignment of the catalytic domain of protein phosphatase 1B (PTP1B) in the ligand-free state	976	X
19224	Sequence specific backbone assignment of protein phosphatase 1B (PTP1B) residues 1-393	1125	X
19225	Solution structure of the carbohydrate binding module of the muscle glycogen-targeting subunit of Protein Phosphatase-1	1524	X
19226	Structure of 2'F-RNA/2'F-ANA chimeric duplex	100				X
19227	Human Pdx1 Homeodomain in the Unbound State	261	X
19228	Human Pdx1 Homeodomain in the DNA-Bound State	306	X
19229	PHD Domain from Human SHPRH	820	X
19230	Solution structure of Hdm2 with engineered cyclotide	849	X
19231	Structural Basis of DNA Recognition by the Effector Domain of Klebsiella pneumoniae PmrA	1307	X
19232	NMR structure of a two-domain RNA-binding fragment of Nrd1	525	X
19233	1H, 13C, 15N assignments for P. yoelii Merozoite Surface Protein 1	1108	X
19234	1H, 13C, 15N assignments for P. yoelii Merozoite Surface Protein 1, E28K variant	997	X
19235	Solution structure of the Aha1 dimer from Colwellia psychrerythraea	1669	X
19236	Backbone (1H, 15N, CA, CB) assignments of D. crassirhizoma Plastocyanin (Zn)	383	X
19237	Solution structure of AhPDF1 from Arabidopsis halleri	502	X
19238	Backbone 1H, 13C, 15N resonance assignments of calcium-bound calmodulin in complex with PSD95 N-terminal peptide	1164	X
19239	2C TCR	919	X
19240	Human FKBP12-Major Form	1321	X
19241	Human FKBP12-Minor Form	1320	X
19242	The solution NMR structure of E. coli apo-HisJ	1155	X
19243	Backbone chemical shifts of isolated Domain 1 from E. coli HisJ	703	X
19244	Backbone chemical shifts of isolated Domain 2 from E. coli HisJ	478	X
19245	Backbone chemical shifts from E. coli HisJ complexed with Histidine	1153	X
19246	1H, 13C and 15N resonance assignments of human GAP-43	1943	X
19247	Backbone (1H,15N, CA, CB) assignments of Populus nigra Plastocyanin (Zn)	458	X
19248	Structure of SRSF1 RRM2 in complex with the RNA 5'-UGAAGGAC-3'	998	X		X
19249	NMR structure of the PAI subdomain of Sleeping Beauty transposase	376	X
19250	STRUCTURE OF LASSO PEPTIDE ASTEXIN3	155	X
19251	Structure, function, and tethering of DNA-binding domains in 54 transcriptional activators	658	X
19252	RRM domain of HUMAN RBM7	980	X
19253	Backbone and Cbeta assignments for tau K18 in free and SDS micelle-bound states	1200	X
19254	NMR assignments and backbone amide relaxation data (T1-T2) for the complex of the Y48A mutant of the FimH adhesin carbohydrate-binding domain with heptyl-mannose	358	X
19255	Backbone amide chemical shifts and relaxation data (T1-T2) for the Y48A mutant of the FimH adhesin carbohydrate-binding domain	360	X
19256	NMR assignments and backbone amide relaxation data (T1-T2) for the complex of the FimH adhesin carbohydrate-binding domain with heptyl-mannose	1799	X
19257	1H, 13C, and 15N chemical shift assignments for alpha-synuclein in living E. coli cells	473	X
19258	Pin1 WW domain	491	X
19259	Pin1 WW domain phospho-mimic S16E	496	X
19260	A pyrimidine motif triple helix in the Kluyveromyces lactis telomerase RNA pseudoknot is essential for function in vivo	618			X
19261	HIV capsid dimer structure	919	X
19262	NMR assignment and structure of a peptide derived from the membrane proximal external region of HIV-1 gp41 in the presence of hexafluoroisopropanol	240	X
19263	NMR assignment and structure of a peptide derived from the membrane proximal external region of HIV-1 gp41 in DPC	236	X
19264	The structure of the W184AM185A mutant of the HIV-1 capsid protein	1060	X
19266	Pre-Fusion Solution NMR Structure of Neuronal SNARE Syntaxin 1A	1366	X
19267	Backbone Assignment of Outer Envelope Protein 16kDa	864	X
19268	SOLUTION NMR STRUCTURE OF THE V209M VARIANT OF THE HUMAN PRION PROTEIN (RESIDUES 90-231)	1503	X
19269	1H and 13C chemical shift assignment of the N-terminal intrinsically disordered domain of the oncoportein E7 from the Human Papilloma Virus	396	X
19270	Backbone assignment of the Sigma-1 receptor chaperone domain	616	X
19271	Backbone 1H, 13C, and 15N Chemical Shift Assignments for CRABPI	661	X
19272	1H, 15N, 13C resonance assignments of Yersinia phosphatase YopH	1302	X
19273	Structural characterization of E. coli ISC-type Ferredoxin	403	X
19274	Solution structure of the Dictyostelium discodieum Myosin Light Chain, MlcC	910	X
19275	Solution Structure and Activity Study of Bovicin HJ50, a Particular Type AII Lantibiotic	325	X
19276	Structure of d[CGCGAAGCATTCGCG] hairpin	139		X
19277	Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid	240		X
19278	Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid	266		X
19279	Structure of d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid	245		X
19280	Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybrid	263		X
19281	Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid	260		X
19282	NMR structure of the lymphocyte receptor NKR-P1A	1746	X
19283	Solution NMR structure of the RXFP2 LDLa module	404	X
19285	Optimized Ratiometric Calcium Sensors For Functional In Vivo Imaging of Neurons and T-Lymphocytes	411	X
19286	NMR Structure of BeF3 Activated Sma0114	424	X
19287	Solution structure of a chymotrypsin inhibitor from the Taiwan cobra	574	X
19288	Solution NMR Structure of E3 ubiquitin-protein ligase ZFP91 from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR7784A	1050	X
19290	NMR structure of human TDP-43 tandem RRMs in complex with UG-rich RNA	2384	X		X
19291	NMR solution structure of Pin1 WW domain mutant 5-1	234	X
19292	NMR solution structure of Pin1 WW domain mutant 5-1g	234	X
19293	Solution structure of calcium-bound human S100A12	824	X
19294	DNA-binding domain of T. brucei telomeric protein tbTRF	195	X
19295	NMR solution structure of Pin1 WW domain variant 6-1	242	X
19296	NMR solution structure of Pin1 WW domain mutant 6-1g	242	X
19297	Chemical shift assignments of the human C-type lectin DC-SIGNR (Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin related) carbohydrate recognition domain in the holo (calcium bound) form.	1048	X
19298	RBPMS2-Nter	523	X
19299	Analysis of target DNA binding sites through NMR structural analysis of the MLV IN CTD and homology modeling of the CCD domains.	900	X
19300	Solution structure of protoxin-1	325	X
19301	Redox-linked domain movements in the catalytic cycle of cytochrome P450 reductase	885	X
19302	Solution Structure of ERCC4 domain of human FAAP24	1540	X
19303	Solution Structure of (HhH)2 domain of human FAAP24	667	X
19304	Solution structure of kalata B7	182	X
19305	NMR structure of an inhibitor bound dengue NS3 protease	1466	X
19306	NMR structure of an inhibitor bound dengue NS3 protease	1466	X
19307	Magnesium bound form of UVI31+ from C. reinhardtii	533	X
19308	Biochemical effect of S-67 phosphorylation on UVI31+ from C. reinhardtii	533	X
19309	3D NMR structure of a complex between the amyloid beta peptide (1-40) and the polyphenol epsilon-viniferin glucoside	268	X
19311	Chemical shifts and structural restraints for Saccharomyces cerevisiae Est3 protein	1071	X
19312	Solution NMR Structure of Transcription Factor GATA-4 from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR4783B	710	X
19314	Solution NMR Structure of Microtubule-associated serine/threonine-protein kinase 1 from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR9151A	1294	X
19315	Solution Structure of the Catalytic Domain of HHARI	729	X
19317	Solution structure of HRDC1 domain of RecQ helicase from Deinococcus radiodurans	864	X
19318	Chemical shifts of the CPAP-interacting epitope of Danio rerio STIL	334	X
19319	Solution structure of RasGRP2 EF hands bound to calcium	766	X
19320	1H, 13C and 15N NMR assignments of RNA recognition motif of human Taf15	1145	X
19321	1H,15N,13C resonance assignments of cerato populin, a fungal PAMP from Ceratocystis populicola	1489	X
19322	LTBP1 cbEGF14-TB3-EGF3	725	X
19323	Human FKBP12.6-Major Form	623	X
19324	Human FKBP12.6-Minor Form	622	X
19325	1H, 13C, and 15N Chemical Shift Assignments for a proteasome related subunit	2351	X
19327	Solution NMR Structure of yahO protein from Salmonella typhimurium, Northeast Structural Genomics Consortium (NESG) Target StR106	912	X
19328	Solution NMR structure of PHD type Zinc finger domain of Lysine-specific demethylase 5B (PLU-1/JARID1B) from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR7375C	703	X
19329	Solution NMR Structure of the RING finger domain from the Kip1 ubiquitination-promoting E3 complex protein 1 (KPC1/RNF123) from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR8700A	745	X
19330	Sequence Specific Backbone 1H, 15N and 13C assignments of the MAPK binding domain of DUSP 16	625	X
19331	Solution NMR Structure of Zinc finger protein Eos from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR7992A	766	X
19332	Backbone 1H, 13C, and 15N Chemical Shift Assignments for p15(PAF)	754	X
19333	HIV-1 Vif SOCS-box and Elongin BC solution structure	827	X
19334	NMR structure of Temporin-1 Ta in lipopolysaccharide micelles: Mechanistic insight into inactivation by outer memebrane	76	X
19335	NMR assignments and relaxation of 5P12-RANTES-E66S	315	X
19336	NMR assignments of 5P12-RANTES-E66S in the presence of dodecylphosphocholine	301	X
19337	alpha synuclein in PBS	651	X
19338	alpha synuclein mutant A53T in PBS	637	X
19339	Backbone assignment of the R8 domain of talin.	642	X
19340	Untangling the Solution Structure of C-Terminal Domain of AciniformSpidroin	1188	X
19342	Transmembrane-cytosolic part of Trop2 explored by NMR and Molecular Dynamics	297	X
19344	alpha synuclein mutant S87N in PBS - human/mouse chimera	653	X
19345	alpha synuclein mutant A53T & S87N in PBS - human/mouse chimera	632	X
19346	mouse alpha synuclein	644	X
19347	mouse alpha synuclein T53A mutant- mouse/human chimera	641	X
19348	mouse alpha synuclein N87S mutant- mouse/human chimera	645	X
19349	mouse alpha synuclein T53A & N87S mutant- mouse/human chimera	626	X
19350	Acetylated alpha synuclein in PBS	664	X
19351	Acetylated alpha synuclein A53T familiar mutant in PBS	666	X
19353	Structure of alpha-synuclein in complex with an engineered binding protein	1307	X
19354	Solution structure of Smoothened	1607	X
19355	Lassomycin	183	X
19356	Solution structure of the chimeric hydrophobin NChi2	868	X
19357	Backbone 1H, 13C, 15N chemical shift assignments for the Met66 prodomain region of BDNF	434	X
19358	Backbone 1H, 13C, 15N chemical shift assignments for the Val66 prodomain region of BDNF	433	X
19362	Solution Structure of the STIM1 CC1-CC2 homodimer.	1925	X
19363	Solution structure of the STIM1 CC1-CC2 homodimer in complex with two Orai1 C-terminal domains.	1245	X
19364	1HN, 13C, and 15N Chemical Shift Assignments for Nupr1	411	X
19365	Solution structure of Lipid Transfer Protein from Lentil Lens Culinaris	983	X
19366	NMR structure of region 2 of E. coli sigmaE	1138	X
19367	Solution structure of the complex formed by the region 2 of E. coli sigmaE and its cognate -10 non template element TGTCAAA	1104	X	X
19368	Structure of Pex14 in complex with Pex5 LVxEF motif	1386	X
19369	calbindin D9k(P47M+C80) Apo form	361	X
19370	calbindin D9k(P47M+C80) calcium bound form	356	X
19371	calbindin D9k(P47M+C80) Magnesium bound form	350	X
19372	Solution structure of Ani s 5 Anisakis simplex allergen	1377	X
19374	Solution structure of alpha-amylase inhibitor wrightide R1 (wR1) peptide from Wrightia religiosa	194	X
19375	NMR Structure of N2-IQ-dG at the G3 position in the NarI recognition sequence	213		X
19376	Calmodulin, C-terminal domain, M144H mutant	909	X
19377	1H, 15N, 13C Backbone and 13Cbeta Chemical Shift Assignment of mouse Interleukin-10	823	X
19379	NMR structures of the alpha7 nAChR transmembrane domain.	1313	X
19380	NMR structure of the RNA polymerase alpha subunit C-terminal domain from Helicobacter pylori	1188	X
19381	Engineering G4: Towards effective incorporation of locked nucleic acid into G-quadruplexes	186		X
19382	Solution structure of hnRNP G RRM in complex with the RNA 5'-AUCAAA-3'	1075	X		X
19383	NMR Structure of the Complete Internal Fusion Loop mutant I544A from Ebolavirus GP2 at pH 5.5	570	X
19384	mu-PIIIA-1	135	X
19385	mu-PIIIA-2	147	X
19386	parallel-stranded G-quadruplex in DNA poly-G stretches	164		X
19387	Solution structure of an intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative	233		X
19389	Solution structure of a stacked dimeric G-quadruplex formed by a segment of the human CEB1 minisatellite	134		X
19390	Solution structure of the EBNA-2 N-terminal Dimerization (END) domain from the Epstein-Barr virus	686	X
19391	Solution structure of MBD3 methylcytosine binding domain while bound to hydroxymethylated DNA	814	X	X
19392	Human Bcl10 CARD	1359	X
19393	Solid-state NMR sequential assignment of Osaka-Mutant Amyloid-beta (A 1-40 E22 ) fibrils	514	X
19394	Solution Structure of the human Polymerase iota UBM1-Ubiquitin Complex	2017	X
19395	Solution Structure of human holo-PRL-3 in complex with vanadate	1470	X
19396	Lasiocepsin	327	X
19397	Backbone 1H and 15N Chemical Shift Assignments for the first domain of FAT10	348	X
19398	Solution structure of the forkhead domain of Brugia malayi DAF-16a	1219	X
19399	NMR structure of EKLF(22-40)/Ubiquitin Complex	1133	X
19400	The structure of the Box CD enzyme reveals regulation of rRNA methylation	319	X		X
19402	Structure of an antiparallel (2+2) G-quadruplex formed by human telomeric repeats in Na+ solution (with G22-to-BrG substitution)	229		X
19403	The Clip-segment of the von Willebrand domain 1 of the BMP modulator protein Crossveinless 2 is preformed	677	X
19404	Solution NMR Structure of DE NOVO DESIGNED Top7 Fold Protein Top7m13, Northeast Structural Genomics Consortium (NESG) Target OR33	1440	X
19406	K11-linked Diubiquitin average solution structure at pH 6.8, 0 mM NaCl	280	X
19407	Conformation and dynamics of the periplasmic membrane-protein chaperone complexes OmpX Skp and tOmpA Skp	523	X
19408	Conformation and dynamics of the periplasmic membrane-protein chaperone complexes OmpX Skp and tOmpA Skp	581	X
19409	Conformation and dynamics of the periplasmic membrane-protein chaperone complexes OmpX Skp and tOmpA Skp	294	X
19410	Conformation and dynamics of the periplasmic membrane-protein chaperone complexes OmpX Skp and tOmpA Skp	758	X
19411	Conformation and dynamics of the periplasmic membrane-protein chaperone complexes OmpX Skp and tOmpA Skp	494	X
19412	K11-linked Diubiquitin average solution structure at pH 6.8, 150 mM NaCl	276	X
19413	KpDsbA	2023	X
19414	PaDsbA	168	X
19415	LMO4-LIM2 in complex with DEAF-1 (404-418)	1065	X
19416	NMR Structure of Rrp7 C-terminal Domain	617	X
19417	NMR solution structure of oxidised PaDsbA	1988	X
19418	Backbone chemical shifts of the PICK1 PDZ domain with the GluA2 C-terminal	420	X
19419	1H, 13C, and 15N Chemical Shift Assignments of C-ala domain from Bizionia argentinensis	1520	X
19421	Structural Basis of a Thiopeptide Antibiotic Multidrug Resistance System from Streptomyces lividans:Promothiocin A in Complex with TipAS	1737	X
19422	Structural Basis of a Thiopeptide Antibiotic Multidrug Resistance System from Streptomyces lividans:Nosiheptide in Complex with TipAS	1736	X
19423	Solution structure of the Vav1 SH2 domain complexed with a Syk-derived singly phosphorylated peptide	1088	X
19424	Backbone chemical shift assignments of delta exon 3 mouse RyR2 domain A	566	X
19425	X-ray crystallography-solution NMR hybrid structure of mouse RyR2 domain A.	911	X
19426	1H, 13C, and 15N Chemical Shift Assignments for a peptide encompassing the first 61 residues of the Kv1.4 channel	605	X
19427	The solution structure of the C-terminal domain of BldD from Streptomyces coelicolor	1065	X
19428	A bacteriophage transcription regulator inhibits bacterial transcription initiation by -factor displacement	754	X
19429	A bacteriophage transcription regulator inhibits bacterial transcription initiation by -factor displacement	819	X
19430	Structure of Salmonella MgtR	8	X
19431	NMR structure of hypothetical protein RUMGNA_01855 from Ruminococcus gnavus ATCC 29149	1320	X
19432	Cat r 1	1614	X
19433	NMR structure of the protein YP_002937094.1 from Eubacterium rectale	1144	X
19435	Structural studies on dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence	196		X
19436	Backbone 1H, 13C, and 15N Chemical Shift Assignments for murine norovirus NS1/2 D94E mutant	911	X
19437	Membrane induced structure of the mammalian tachykinin neuropeptide gamma	105	X
19438	tgam	848	X
19439	Backbone 1H, 13C, and 15N Chemical Shift Assignments for murine norovirus NS1/2 CW3 WT	530	X
19440	NMR structure of DNA duplex	174		X
19441	NMR structure of spermine modified DNA duplex	178		X
19442	Backbone 1H, 13C, and 15N Chemical Shift Assignments for E7 protein from human Papillomavirus 16	207	X
19443	1H, 13C and 15N Backbone Assignment of the EC-1 Domain of Human E-Cadherin	544	X
19444	Backbone 1H, 13C, and 15N Chemical Shift Assignments for murine norovirus CR6 NS1/2 protein	540	X
19446	Single-stranded DNA binding protein from E. coli (SSB)	1827	X
19447	DISTINCT UBIQUITIN BINDING MODES EXHIBITED BY SH3 DOMAINS: MOLECULAR DETERMINANTS AND FUNCTIONAL IMPLICATIONS	264	X
19448	Structural studies on dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence	196		X
19449	NMR structure of a BolA-like hypothetical protein RP812 from RICKETTSIA PROWAZEKII, SEATTLE STRUCTURAL GENOMICS CENTER FOR INFECTIOUS DISEASE (SSGCID)	909	X
19450	Solution structure of ShK-like immunomodulatory peptide from Brugia malayi (filarial worm)	372	X
19451	Chemical Shift Assignment of the PNUTS PP1 Binding Domain	242	X
19452	Solution NMR structure of a putative thioredoxin (ECH_0218) in the reduced state from Ehrlichia chaffeensis, the etiological agent responsible for human monocytic ehrlichiosis. Seattle Structural Genomics Center for Infectious Disease target EhchA.00546.a	1135	X
19453	NMR structure of the protein ZP_02042476.1 from Ruminococcus gnavus	1121	X
19454	Solid-state NMR structure of piscidin 1 in aligned 3:1 phosphatidylcholine/phosphoglycerol lipid bilayers	22	X
19455	Solid-state NMR structure of piscidin 1 in aligned 1:1 phosphatidylethanolamine/phosphoglycerol lipid bilayers	21	X
19456	Solid-state NMR structure of piscidin 3 in aligned 3:1 phosphatidylcholine/phosphoglycerol lipid bilayers	21	X
19457	Solid-state NMR structure of piscidin 3 in aligned 1:1 phosphatidylethanolamine/phosphoglycerol lipid bilayers	21	X
19458	CR1-2-3	486	X
19459	CR1~1-2	1370	X
19460	Solution structure of ShK-like immunomodulatory peptide from Ancylostoma caninum (hookworm)	561	X
19461	HlyII-C major cis form	1123	X
19462	HlyII-C minor trans form	569	X
19463	p87m-BMRB	1152	X
19464	NMR structure of the HicA toxin from Burkholderia pseudomallei	571	X
19466	PICK1 PDZ with 10 C-terminal ASIC1a residues	598	X
19467	10 C-terminal PKCalpha residues	74	X
19468	Fragment based approach and binding behavior of LFampinB with Lipopolysaccharide:biophysical aspects	100	X
19469	Fragment based approach and binding behavior of LFampinB with Lipopolysaccharide: biophysical aspects	65	X
19470	Fragment based approach and binding behavior of LFampinB with Lipopolysaccharide:biophysical aspects	35	X
19471	Fragment based approach and binding behavior of LFampinB with Lipopolysaccharide: biophysical aspects	71	X
19472	1H, 13C, and 15N Chemical Shift Assignments for Sp140 PHD finger trans conformer	560	X
19473	1H, 13C, and 15N Chemical Shift Assignments for Sp140 PHD finger cis conformer	566	X
19474	Structure of uninhibited ETV6 ETS domain	1178	X
19476	NMR SOLUTION STRUCTURE OF ALPHA CONOTOXIN LO1A FROM Conus longurionis	151	X
19477	Backbone 1H and 15N Chemical Shift Assignments for P130 Cas substrate domain	476	X
19478	Backbone assignments for TNRC6B motif I (599-683)	285	X
19479	Solution Structure of an Active Site Mutant Pepitdyl Carrier Protein	981	X
19480	The Solution Structure of the Regulatory Domain of Tyrosine Hydroxylase	463	X
19481	The Solution Structure of the Regulatory Domain of Tyrosine Hydroxylase	477	X
19482	The Solution Structure of the Regulatory Domain of Tyrosine Hydroxylase	1016	X
19483	Solution structure of the WW domain of HYPB	409	X
19484	NMR structure of a two-transmembrane segment TM VI-VII of NHE1	393	X
19485	Chemical Shift Assignments for SVIP (small VCP/p97-interacting protein)	824	X
19486	Solution NMR Structure of Zinc finger protein 423 from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR7298F	598	X
19487	Solution structure of the PP2WW mutant (KPP2WW) of HYPB	484	X
19488	Solution structure of WW domain with polyproline stretch (PP2WW) of HYPB	440	X
19489	NMR SOLUTION STRUCTURE OF MSP-P56S DOMAIN/VAPB in DPC	968	X
19490	Human cytosolic dNT-1 nucleotidase	941	X
19493	NMR structure of purotoxin-2 in water	393	X
19494	HuR RRM3 WT	497	X
19495	HN, NH, CA, CB and methyl group assignments of Filamin C two Ig-domain fragment FLNc4-5	1121	X
19496	HN, NH, CA, CB and methyl group assignments of Filamin A three Ig-domain fragment FLNa3-5	1606	X
19497	calcium-free V6 domain of villin	805	X
19498	gp1.2	829	X
19499	HuR RRM3 W261E mutant	661	X
19500	HuR RRM3 S318D mutant	645	X
19501	A novel 4/7-conotoxin LvIA from Conus lividus that selectively blocks 32 vs. 6/323 nicotinic acetylcholine receptors	123	X
19502	Protein structure	981	X
19503	Circular Permutant of the WW Domain with Loop 1 Excised	225	X
19504	baa38	294	X
19505	WW Domain Strand-Swapped Dimer	192	X
19506	Human eukaryotic release factor eRF1	1120	X
19507	Backbone assignment and Secondary Structure of Intrinsically Unstructured Culture Filtrate Antigen protein (CFP10) from Mycobacterium Tuberculosis	535	X
19508	Solution structure of the human wild type FAPP1-PH domain	1201	X
19510	NMR structure of the Paracoccus denitrificans Z-subunit determined in the presence of ADP	1108	X
19511	NMR Structure of the homeodomain transcription factor Gbx1 from Homo sapiens solved in the presence of the DNA sequence CGACTAATTAGTCG	816	X	X
19512	HIV-1 gp41 clade B double alanine mutant Membrane Proximal External Region peptide in DPC micelle	397	X
19513	HIV-1 gp41 clade C Membrane Proximal External Region peptide in DPC micelle	365	X
19514	HIV-1 gp41 clade C Membrane Proximal External Region peptide in DPC micelle	370	X
19515	HIV-1 gp41 clade C Membrane Proximal External Region peptide in DPC micelle	401	X
19516	Solution NMR structure of Dot1L in complex with AF9 (Dot1L-AF9).	1141	X
19517	Micelle-solubilized transmembrane domain of the hepatitis C virus glycoprotein E1	293	X
19518	Solution NMR assignment of the heavy chain complex of the human cardiac myosin regulatory light chain	2338	X
19519	NMR solution structure of the GS-TAMAPIN MUTATION R6A.	206	X
19520	Solution Structure of BCL-xL in its p53-bound conformation determined with selective isotope labelling of I,L,V sidechains	1254	X
19521	Solution structure of BCL-xL containing the alpha1-alpha2 disordered loop determined with selective isotope labelling of I,L,V sidechains	1892	X
19522	Solution Structure of the Complex Between BCL-xL and the p53 Core Domain determined with PRE restraints	1254	X
19523	N-terminal domain of Bilbo1 from Trypanosoma brucei	1111	X
19524	NMR solution structure of the GS-TAMAPIN MUTATION R7A.	215	X
19525	Solution structure of the Nt. GR-RBP1 RRM domain	1018	X
19526	Solution NMR structure of SLED domain of Scml2	1342	X
19527	NMR solution structure of the GS-TAMAPIN MUTATION R13A.	203	X
19528	NMR solution structure of the DOUBLE GS-TAMAPIN MUTATION R6A R7A.	204	X
19530	Resonance assignment of RQC domain of human Bloom syndrome protein	1240	X
19531	NMR spatial structure of the trimeric mutant TM domain of VEGFR2 receptor.	525	X
19532	NMR spatial structure of mutant dimeric TM domain of VEGFR2 receptor	539	X
19533	Solution Structure of NusE (S10) from Thermotoga maritima	900	X
19534	Structural basis of the non-coding RNA RsmZ acting as protein sponge: Conformer L of RsmZ(1-72)/RsmE(dimer) 1to3 complex	292	X		X
19535	SGTX-Sf1a	522	X
19536	1H, 13C, 15N chemical shift assignments of Streptomyces virginiae VirA acp5a	1039	X
19538	SOLUTION STRUCTURE OF THE IMS DOMAIN OF THE MITOCHONDRIAL IMPORT PROTEIN TIM21 FROM S. CEREVISIAE	1502	X
19539	1H, 13C, 15N chemical shifts assignments of streptomyces virginiae VirA acp5b	1041	X
19540	haddock model of MyT1 F4F5 - DNA complex	217	X	X
19541	Structure of the Nucleoplasmin-like N-terminal domain of Drosophila FKBP39	2179	X
19542	Mambalgin-2	572	X
19544	Csr/Rsm protein-RNA recognition - A molecular affinity ruler: RsmZ(SL1)/RsmE(dimer) 2:1 complex	1086	X		X
19545	The Solution Structure of a cGCUUAg RNA Pentaloop from Bovine Enterovirus Vir404/03	339			X
19546	Csr/Rsm protein-RNA recognition - A molecular affinity ruler: RsmZ(SL2)/RsmE(dimer) 2:1 complex	1048	X		X
19547	Csr/Rsm protein-RNA recognition - A molecular affinity ruler: RsmZ(SL3)/RsmE(dimer) 2:1 complex	1051	X		X
19548	Csr/Rsm protein-RNA recognition - A molecular affinity ruler: RsmZ(SL4)/RsmE(dimer) 2:1 complex	1075	X		X
19549	Csr/Rsm protein-RNA recognition - A molecular affinity ruler: RsmZ(36-44)/RsmE(dimer) 2:1 complex	877	X		X
19550	Domain 1 of E. coli ribosomal protein S1	1143	X
19551	1H, 13C, and 15N Chemical Shift Assignments for human FK506 binding Protein 25	2804	X
19552	Solution structure of Blo t 19, a minor dust mite allergen from Blomia tropicalis.	784	X
19553	NMR solution structure of chitin-binding domain from dust mite group XII allergen Blo t 12.	826	X
19554	Domain 2 of E. coli ribosomal protein S1	1930	X
19555	Solution structure of the C-terminally encoded peptide of the plant parasitic nematode Meloidogyne hapla - CEP11	104	X
19556	Solution structure of the C-terminally encoded peptide of the model plant host Medicago truncatula - CEP1	114	X
19557	Solution structure of the circular g-domain analog from the wheat metallothionein Ec-1	130	X
19558	Backbone and stereospecific Methyl Ile(d1), Leu and Val chemical shift assignment of Crc	1544	X
19559	Backbone resonance assignments of Bcl-2/xL	489	X
19560	N-terminal and Middle domains of human Hsp90alpha	1989	X
19561	1H, 13C and 15N backbone NMR assignments of human Taf15-RRM-RanBP	706	X
19562	NMR solution structures of FRS2a PTB domain with neurotrophin receptor TrkB	1415	X
19563	chemical shift assignments for human dihdyrofolate reductase bound to folate	516	X
19564	chemical shift assignments and 3Jcgn & 3Jcgc' scalar couplings for human dihdyrofolate reductase bound to THF	906	X
19565	chemical shift assignments and 3Jcgn & 3Jcgc' scalar couplings for human dihdyrofolate reductase bound to NADP+ and THF	870	X
19566	chemical shift assignments and 3Jcgn & 3Jcgc' scalar couplings for human dihdyrofolate reductase bound to NADPH	894	X
19567	chemical shift assignments and 3Jcgn & 3Jcgc' scalar couplings for human dihdyrofolate reductase bound to NADP+ and folate	1032	X
19568	assignment of the transmembrane domain of insulin receptor in detergent micelles	280	X
19569	NMR chemical shift assignments of mouse Vps28 C-terminal domain	1250	X
19570	Solution NMR structure of the cactus-derived antimicrobial peptide Ep-AMP1	278	X
19571	Solution NMR structure of the d(GGGTTTTGGGTGGGTTTTGGG) quadruplex in sodium conditions.	345		X
19572	Solution NMR structure of quadruplex d(TGGGTTTGGGTTGGGTTTGGG) in sodium conditions.	180		X
19573	STRUCTURE OF LASSO PEPTIDE XANTHOMONIN II	81	X
19575	HIV-1 capsid protein in tubular assemblies	791	X
19576	Backbone resonance assignment of FAPP1 PH domain in the presence of 10% (w/v) DMPC/DHPC (q=0.25), and in the presence of 10% (w/v) DMPC/DHPC (q=0.25) plus 8mM PI4P	831	X
19577	Non-reducible analogues of alpha-conotoxin Vc1.1: [2,8]-cis dicarba Vc1.1	74	X
19578	Non-reducible analogues of alpha-conotoxin Vc1.1: [2,8]-trans dicarba Vc1.1	72	X
19579	NMR structure of C-terminal domain from A. ventricosus minor ampullate spidroin (MiSp)	1342	X
19580	PAP262-270 in SDS micelles	80	X
19581	NMR assignment and structure of a peptide derived from the trans-membrane region of HIV-1 gp41 in the presence of hexafluoroisopropanol	325	X
19582	NMR assignment and structure of a peptide derived from the membrane proximal external region of HIV-1 gp41 in the presence of hexafluoroisopropanol	330	X
19583	NMR assignment and structure of a peptide derived from the membrane proximal external region of HIV-1 gp41 in the presence of dodecylphosphocholine micelles	263	X
19584	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Dvl-2 DEP domain	458	X
19585	Solution structure of a computational designed dimer based on the engrailed homeodomain structure	737	X
19586	Solution Structure of Calmodulin bound to the target peptide of Endothelial Nitrogen Oxide Synthase phosphorylated at Thr495	1523	X
19587	Non-reducible analogues of alpha-conotoxin Vc1.1: [3,16]-trans dicarba Vc1.1	72	X
19589	NMR assignment of the RhoGAP domain from the Rgd1 protein of Saccharomyces cerevisiae	2494	X
19590	Aliphatic 13C Chemical Shift Assignments For the Unfolded State of the Fyn SH3 Domain G48A Mutant	164	X
19591	Aliphatic 13C Chemical Shift Assignments For the Intermediate State of the FF Domain L24A Mutant	203	X
19592	Molecular Binding of TFF1 Estrogen Response Element by a DNA Bis-intercalating Anticancer Drug XR5944	287		X
19593	Truncated EGF-A	220	X
19594	Solution structure of a G-quadruplex bound to the bisquinolinium compound Phen-DC3	168		X
19595	NMR solution structure of oxytocin	84	X
19596	C-terminal disordered region of the pancreatic duodenal homeobox protein 1	677	X
19597	Solution structures and model membrane interactions of Ctriporin, an Anti-Methicillin-Resistant Staphylococcus aureus peptide from scorpion venom	132	X
19598	1H, 13C, and 15N Chemical Shift Assignments for human EPRS WHEP domains	2277	X
19599	Human EPRS R12 Repeats	1507	X
19600	CEH37 Homeodomain	694	X
19601	Solution structure of CXCL5	438	X
19602	Zinc induced dimer of the metal binding domain 1-16 of human amyloid beta-peptide with Alzheimer`s disease pathogenic English mutation H6R	526	X
19603	Solution structures and model membrane interactions of Ctriporin, an Anti-Methicillin-Resistant Staphylococcus aureus peptide from scorpion venom	130	X
19604	1H, 13C, and 15N chemical shift assignments for the complex of calmodulin with minimal binding domain from HIV-1 matrix protein	2080	X
19605	PonA2-PASTA	708	X
19606	Solution Structure of the UBA Domain of Human NBR1	582	X
19607	The C-terminal domain of SRA1p has a fold more similar to PRP18 than to an RRM and does not directly bind to the SRA1 RNA STR7 region.	1455	X
19608	Solution structure of the mitochondrial translocator protein (TSPO) in complex with its high-affinity ligand PK11195	2075	X
19609	Solution Structure of Protein-RNA Ternary Complex	1916	X		X
19610	Solution NMR structure of the p300 Taz2:ETAD1 complex	1533	X
19611	Enzymatic cyclisation of kalata B1 using sortase A	258	X
19613	Structural insights into the DNA recognition and protein interaction domains reveal fundamental homologous DNA pairing properties of HOP2	877	X
19614	The basic-helix-loop-helix region of the transcriptional repressor HES-1 is preorganized to bind DNA	1722	X
19615	Ligand-dependent dynamics of the active-site lid in bacterial dimethylarginine dimethylaminohydrolase	959	X
19616	Ligand-dependent dynamics of the active-site lid in bacterial dimethylarginine dimethylaminohydrolase	963	X
19617	Solution structure of the Big domain from Leptospira interrogans	797	X
19618	1H, 15N and 13C resonance assignment of a transport protein	1338	X
19619	Structure and NMR assignments of lantibiotic NAI-107 in DPC micelles	154	X
19620	Solution structure of DNA duplex containing N3T-ethylene-N1I interstrand cross-link	116		X
19621	1H, 13C and 15N chemical shift assignments for the cyclic-nucleotide binding homology domain of the KCNH channel from Zebrafish	1524	X
19622	Solution structure of oxidized [2Fe-2S] ferredoxin PetF from Chlamydomonas reinhardtii	1034	X
19623	GA-79-MBP cs-rosetta structures	329	X
19624	1H and 15N chemical shift assignments for circular sortase A	1051	X
19625	TNPX	1448	X
19626	1H,13C and 15N assignment of Rsa1p(317-352)/Hit1p((70-164)	1715	X
19627	NMR strucutre of the hypothetical protein BACUNI_03114 from Bacteroides uniformis ATCC 8492	1266	X
19628	NMR structure of the protein NP_419126.1 from CAULOBACTER CRESCENTUS	867	X
19629	1H, 15N, and 13C Chemical Shift Assignments of the Dark State of a Cyanobacterial GAF Domain (NpF2164-GAF3)	702	X
19632	NMR structure of protein NP_254181.1 from Pseudomonas aeruginosa PA01	828	X
19633	Solution structure of a EF-hand domain from sea urchin polycystin-2	1086	X
19634	Solution structure of the CR4/5 domain of medaka telomerase RNA	863			X
19635	Solution structure of TpsB4 N-terminal POTRA domain from Pseudomonas aeruginosa	1078	X
19637	NMR solution Structure of the E.coli Outer Membrane Protein W	824	X
19638	Solution structure of cytochrome c Y67H	667	X
19641	3rCWP7D, variant of Imunoglobulin light-chain of lambda 3	978	X
19642	NMR structure of the first RRM domain of the protein RBM39 from homo sapiens	1123	X
19643	NMR Solution State Structure of the PSD-95 PDZ1 - 5-HT2c Complex	1051	X
19644	CD79a cytosolic domain native	288	X
19645	CD79a cytosolic domain denatured	293	X
19646	Solution structure of the major factor VIII binding region on von Willebrand factor	959	X
19648	CD79a cytosolic domain phosphorylated	292	X
19649	CD79a cytosolic domain phosphorylated, denatured state	293	X
19650	CD79b cytosolic domain	235	X
19651	CD79b cytosolic domain denatured	235	X
19653	RRM domain from C. elegans SUP-12	1250	X	X
19654	NMR Structure of human Mcl-1	1876	X
19655	CD79b cytosolic domain phosphorylated	235	X
19656	CD79b cytosolic domain phosphorylated, denatured state	232	X
19657	Solution Structure of Penicillium Antifungal Protein PAF	591	X
19658	The solution NMR structure of maximin-4 in SDS micelles	188	X
19659	Structure of Exocyclic R,R N6,N6-(2,3-Dihydroxy-1,4-butadiyl)-2'-Deoxyadenosine Adduct Induced by 1,2,3,4-Diepoxybutane in DNA	201		X
19660	Structure determination of the salamander courtship pheromone Plethodontid Modulating Factor	579	X
19661	Structure of Exocyclic S,S N6,N6-(2,3-Dihydroxy-1,4-butadiyl)-2'-Deoxyadenosine Adduct Induced by 1,2,3,4-Diepoxybutane in DNA	198		X
19662	NMR structure of the I-V kissing-loop interaction of the Neurospora VS ribozyme	484			X
19663	Somatostatin-14 solution structure in 5% D-mannitol	74	X
19664	Structure of EcDsbA-sulfonamide complex	421	X
19666	Structure of insect-specific sodium channel toxin mu-Dc1a	679	X
19667	Solution structure of the carboxyterminal domain of NusG from Mycobacterium tuberculosis	769	X
19668	NMR structure and chemical shift assignments for a3Y	883	X
19669	Backbone 1H, 15N, and 13C resonance assignments of the N-terminal carbohydrate-binding domain of beta-glucan recognition protein 2 from Manduca sexta	396	X
19670	Solution structure of lysine-free (K0) ubiquitin	547	X
19671	3rC34Y, variant of Imunoglobulin light-chain of lambda 3	822	X
19672	NMR Characterization of the Near Native and Unfolded States of the PTB Domain of Dok1: Alternate Conformations and Residual Clusters	362	X
19673	NMR structure of p75 transmembrane domain in DPC micelles	503	X
19674	Solution structure of the CLAVATA encoded peptide of Arabidopsis thaliana - AtCLE10	123	X
19675	Solution structure of the CLAVATA encoded peptide of Arabidopsis thaliana - AtCLE44	108	X
19677	Solution structure of the CLAVATA-like encoded peptide of Meloidogyne hapla - MhCLE4	91	X
19678	Solution structure of the CLAVATA-like encoded peptide of Meloidogyne hapla - MhCLE5	112	X
19679	Solution structure of the CLAVATA-like encoded peptide of Meloidogyne hapla - MhCLE6/7	124	X
19680	ASD-1 RRM domain	534	X
19681	NMR structure of E. coli LpoB	2118	X
19682	Solution NMR Structure of PHD Type 1 Zinc Finger Domain 1 of Lysine-specific Demethylase Lid from Drosophila melanogaster, Northeast Structural Genomics Consortium (NESG) Target FR824J	1115	X
19683	NMR structure of the S-linked glycopeptide sublancin 168	327	X
19684	Solution NMR Structure of SH3 Domain 1 of Rho GTPase-activating Protein 10 from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target: HR9129A	773	X
19685	RRM3 intermediate state	1063	X
19686	ASD-1 RRM domain bound to UGCAUGG RNA	359	X		X
19687	immune signalling subunit	1381	X
19688	1H, 15N and 13C resonance assignments of the yeast Pih1 and Tah1 C-terminal domains complex	1394	X
19689	Resonance assignments of a phytocystatin from Sesamum indicum L.	2357	X
19692	NMR Localization of Divalent Cations at the Active Site of the Neurospora VS Ribozyme Provides Insights Into RNA-Metal Ion Interactions	496			X
19693	Solution structure of oxidized dimeric form of human defensin 5	692	X
19694	Structure of FHL2 LIM adaptor and its Interaction with Ski	1005	X
19695	NMR studies of N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA: Impact of adduct stereochemistry, size, and local DNA structure on solution conformations	137		X
19696	Nuclear magnetic resonance studies of N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA: Impact of adduct stereochemistry, size, and local DNA structure on solution conformations	140		X
19697	Tv1	153	X
19698	Solution NMR structure of a preQ1 Class II riboswitch from Streptococcus pneumoniae	1034			X
19699	Structure of the m04/gp34 mouse Cytomegalovirus Immunoevasin core domain	697	X
19700	Spatial structure of P33A mutant of non-conventional toxin WTX from Naja kaouthia	534	X
19701	NMR structure of the soluble A 17-34 peptide	106	X
19702	Structure of the dimerization domain of the human polyoma, JC virus agnoprotein is an amphipathic alpha-helix.	256	X
19703	Backbone 1H, 13C, and 15N Chemical Shift Assignments and structure of Iron-sulfur cluster binding protein from Ehrlichia chaffeensis	1054	X
19707	Solution structure of the extracellular sensor domain of DraK histidine kinase	1073	X
19708	Voltage Sensor Domain of human KCNQ1 (VSD-Q1)	552	X
19709	Solution NMR structure of beta-adaptin appendage domain of human adaptor protein complex 4 subunit beta, Northeast Structural Genomics Consortium (NESG) Target HR8998C	1701	X
19710	Solution structure of CDYL2 chromodomain	652	X
19711	Backbone and side chain 1H, 13C, and 15N chemical Shift assignments for native split Npu DnaE intein	1537	X
19712	Designed Exendin-4 analogues	250	X
19713	Solution Structure of Domain-Swapped GLPG	691	X
19714	Transport protein A	1096	X
19715	13C, 15N and 1H backbone and sidechain chemical shift assignment of receiver domain of ethylene receptor ETR1	1513	X
19716	Zn-binding domain of eukaryotic translation initiation factor 3, subunit G	254	X
19717	Yah1 Oxidized	881	X
19718	Yah1 reduced	792	X
19719	Resonance assignments of the PHIST domain of P. falciparum protein PFI1780w	981	X
19720	NMR backbone assignment of WT apo-HasAp from Pseudomonas aeruginosa	501	X
19721	NMR backbone assignment of Y75A apo-HasAp from Pseudomonas aeruginosa	462	X
19722	NMR backbone assignment of H83A apo-HasAp from Pseudomonas aeruginosa	471	X
19723	Backbone 1H, 13C, and 15N Chemical Shift Assignments of the Cytoplasmic Tail of Ig-alpha (CD79a) in a Heterodimeric Construct	518	X
19724	Backbone 1H, 13C, and 15N Chemical Shift Assignments of the Cytoplasmic Tail of Ig-beta (CD79b) in a Heterodimeric Construct	485	X
19725	Backbone 1H and 15N Chemical Shift Assignments of a Double Y to E Mutant of the Cytoplasmic Tail of Ig-alpha (CD79a) in a Heterodimeric Construct	285	X
19726	Protein-RNA structure	1540	X		X
19727	HIFABP_Ketorolac_complex	1390	X
19728	A tetrahelical DNA fold adopted by alternating GGG and GCG tracts	112		X
19729	NMR STRUCTURE OF HEN EGG BETA-DEFENSIN GALLIN (CHICKEN OVO-DEFENSIN)	289	X
19730	Structural Mapping of a Chaperone Substrate Interaction Surface	52	X
19731	Solution structure of peptidyl-tRNA hyrolase from Vibrio cholerae	2295	X
19732	The solution NMR structure of the NLRC5 caspase recruitment domain (CARD)	1202	X
19733	Structural Mapping of a Chaperone Substrate Interaction Surface	56	X
19734	Complete chemical shift assignment of the ssDNA in the filamentous bacteriophage fd report on its conformation and on its interface with the capsid shell	44	X	X
19735	Structure, dynamics and RNA binding of the multi-domain splicing factor TIA-1	2218	X
19736	1H, 13C, and 15N Chemical Shift Assignments of a the mature form of Trypanosoma brucei 1-C-Grx1	1595	X
19737	Solution structure of a C terminal fragment of the neuronal isoform of the polypyrimidine tract binding protein (nPTB)	1769	X
19738	Solution structures of second bromodomain of Brd4 with Di-acetylated Twist peptide	1446	X
19739	Structural Insights into Calcium Bound S100P - V Domain of the receptor for advanced glycation end products (RAGE) Complex	738	X
19740	The delicate conformational balance of a redox enzyme: Cytochrome P450cam does not open but remains closed when its partner putidaredoxin binds.	1563	X
19741	NMR structure of p75 transmembrane domain C257A mutant in DPC micelles	447	X
19742	Ligand-dependent dynamics of the active-site lid in bacterial dimethylarginine dimethylaminohydrolase	956	X
19743	Ligand-dependent dynamics of the active-site lid in bacterial dimethylarginine dimethylaminohydrolase	1022	X
19744	Ligand-dependent dynamics of the active-site lid in bacterial dimethylarginine dimethylaminohydrolase	956	X
19745	Solution NMR structure of a mismatch DNA	212		X
19746	Solution structure of synthetic Mamba-1 peptide	268	X
19747	13C and 15N Chemical Shift Assignments for the M13 Bacteriophage	291	X	X
19748	Solution structure of Lactodifucotetraose (LDFT) beta anomer	54				X
19749	Solution NMR structure of N-terminal domain (SH2 domain) of human Inositol polyphosphate phosphatase-like protein 1 (INPPL1) (fragment 20-117), Northeast Structural Genomics Consortium Target HR9134A.	1243	X
19750	Solution NMR structure of gp41 ectodomain monomer on a DPC micelle	388	X
19751	Solution structure of ORF2	1329	X
19752	Solution structure of a protein domain	1565	X
19753	Solution NMR Structure plectin repeat domain 6 (4403-4606) of Plectin from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR6354E	1340	X
19754	Chemical shifts assignments of diacylglycerol kinase (DAGK) by solid-state NMR	463	X
19755	Structure determination of substrate binding domain of MecA	1117	X
19757	1H, 15N and 13C resonance assignments of the two TPR domains of the human RPAP3 protein	1462	X
19758	1H, 15N and 13C resonance assignments of the two TPR domains of the human RPAP3 protein	1549	X
19759	Tetra-O-GalNAc glycosylated mucin sequence from alpha dystroglycan mucin domain	181	X			X
19760	PlpA plays a central role in lipid homeostasis in Gram-negative bacterial outer membranes	1881	X
19763	The delicate conformational balance of a redox enzyme: Cytochrome P450cam does not open but remains closed when its partner putidaredoxin binds.	414	X
19764	Spatial structure of the dimeric transmembrane domain of Toll-like receptor 3	486	X
19765	gbvb5	175	X
19766	Cooperative Structure of the Heterotrimeric pre-mRNA Retention and Splicing Complex	2073	X
19767	Solid-state NMR assignment of metal-free SOD1 fibrillar structures	107	X
19768	Resonance assignment and secondary structure determination of full length human Dickkopf 4 (hDkk4), a secreted, disulphide-rich Wnt inhibitor protein	1882	X
19769	Backbone Chemical Shifts of the designed protein Z-L2LBT variant A	283	X
19770	Backbone NMR Assignment of Humicola insolens cutinase	803	X
19771	Solution structure of CPEB1 ZZ domain in the free state	566	X
19773	Backbone chemical shifts for the E81 deletion mutant from RAP80 tandem UIMs	285	X
19774	Backbone chemical shifts for the tandem UIMs of wild-type RAP80.	311	X
19775	Solution structure of tandem RRM domains of cytoplasmic polyadenylation element binding protein 1 (CPEB1) in free state	2037	X
19776	Solution structure of tandem RRM domains of cytoplasmic polyadenylation element binding protein 4 (CPEB4) in complex with RNA	1845	X		X
19777	Solution structure of tandem RRM domains of cytoplasmic polyadenylation element binding protein 4 (CPEB4) in free state	1720	X
19778	Structural model of tandem RRM domains of cytoplasmic polyadenylation element binding protein 1 (CPEB1) in complex with RNA	1463	X		X
19779	Solution structure of the SGTA N-terminal domain	861	X
19782	Chemical shifts assignments of the RodA hydrophobin from the opportunistic pathogen Aspergillus fumigatus	1667	X
19783	Solution structure of the fourth constant immunoglobulin domain of nurse shark IgNAR	1195	X
19784	Solution structure of the G-triplex truncated-TBA	194		X
19787	Human FKBP51-FK506 binding domain 1	715	X
19788	Human FKBP52-FK506 binding domain 1	563	X
19789	N domain of cardiac troponin C bound to the switch fragment of fast skeletal troponin I at pH 6	592	X
19791	Structural Characterization of a Complex Between the Acidic Transactivation Domain of EBNA2 and the Tfb1/p62 subunit of TFIIH.	1432	X
19792	NMR structure of the RRM domain of RBMX from homo sapiens	1039	X
19796	hinge region of human Col7	298	X
19797	STRUCTURE OF THE NA,K-ATPASE REGULATORY PROTEIN FXYD2b IN MICELLES	458	X
19798	Solution Structure of 6aJL2-R24G Amyloidogenic Light Chain Protein	1173	X
19799	Solution structure of LysM the peptidoglycan binding domain of autolysin AtlA from Enterococcus faecalis	652	X
19800	Structure of the PrgK first periplasmic domain	707	X
19801	solution structure of a protein C-terminal domain	1665	X
19803	NMR resonance assignment of the N-terminal polypeptide of the Anthrax Lethal Factor	1254	X
19805	13C and 15N Chemical Shift Assignments for the dsDNA in Bacteriophage T7	53		X
19806	NMR structure of hypothetical protein ZP_02064002.1 from Bacteroides ovatus ATCC 8483	1697	X
19807	NMR structure of hypothetical protein ZP_02069618.1 from Bacteroides uniformis ATCC 8492.	1670	X
19808	Ginsentides: Characterization, Structure and Application of a New Class of Highly Stable Cystine Knot Peptides in Ginseng	162	X
19809	Solution structure of YSCUCN in a micellar complex with SDS	205	X
19810	Solution structure of BmKTX-D19K	246	X
19811	NMR solution structure of a computational designed protein based on template of human erythrocytic ubiquitin	901	X
19813	Solution structure of BmKTX-D19K/K6D	240	X
19814	Backbone 1H, 13C, and 15N Chemical Shift Assignments Cterminal domain (residues 374-426)of mPannexin 1	649	X
19815	NMR Assignment of Coiled Coil Domain of Myosin Binding Subunit of Myosin Light Chain Phosphatase	602	X
19816	NMR structure of the C-domain of troponin C bound to the anchoring region of troponin I	689	X
19817	NMR structure of the dilated cardiomyopathy mutation G159D in troponin C bound to the anchoring region of troponin I	732	X
19818	Murine Neuroglobin, Fe3+ form (metNgB)	1731	X
19819	Murine Neuroglobin, Fe3+ form, liganded to cyanide (cyanometNgB)	1700	X
19821	Stf76 from the Sulfolobus islandicus plasmid-virus pSSVx	566	X
19822	NMR structure of B25-(alpha, beta)-dehydro-phenylalanine insulin	510	X
19823	Structure of Lasso Peptide Caulonodin V	110	X
19824	Solution structure of a TrkAIg2 domain construct for use in drug discovery	1244	X
19825	HLA-B*35:01 with peptide VPLRAMTY	1045	X
19826	Solution structure of sortase A from S. aureus in complex with benzo[d]isothiazol-3-one based inhibitor	1822	X
19828	HUMAN CCR2 MEMBRANE-PROXIMAL C-TERMINAL REGION (PRO-C) IN A MEMBRANE BOUND FORM	209	X
19829	HUMAN CCR2 MEMBRANE-PROXIMAL C-TERMINAL REGION (PRO-C) IN A FROUNT BOUND FORM	163	X
19830	Structural and biochemical characterization of Jaburetox	868	X
19831	13C and 15N Chemical Shift Assignments for the cellulose-binding protein CBM3b-Cbh9A	633	X
19832	Structure of the antimicrobial peptide LsbB in DPC micelles	356	X
19833	LsbB TFE	357	X
19834	New Cyt-like delta-endotoxins from Dickeya dadantii - CytC protein	2103	X
19835	NMR structure of E. coli Trigger Factor in complex with unfolded PhoA220-310	2462	X
19836	NMR structure of E. coli Trigger Factor in complex with unfolded PhoA1-150	2682	X
19837	NMR structure of E. coli Trigger Factor in complex with unfolded PhoA365-471	2096	X
19838	H, N, Calpha and Cbeta assignments of oxidized Escherichia coli DsbA at pH 6.8	714	X
19839	H, N, Calpha and Cbeta assignments of reduced Escherichia coli DsbA at pH 6.8	712	X
19840	ToxB	652	X
19841	Solution Structures of active Ptr ToxB and its Inactive Ortholog	687	X
19842	Backbone and sidechain 1H, 13C, and 15N chemical shift assignments for the HEAT2 domain of human eIF4G	2547	X
19843	Solution NMR structure of the ternary complex of human ileal bile acid-binding protein with glycocholate and glycochenodeoxycholate	1564	X
19844	1H, 13C, and 15N backbone assignment of human ribonuclease 4	430	X
19845	Structure of a Conserved Golgi Complex-targeting Signal in Coronavirus Envelope Proteins	784	X
19846	solution structure of alpha-amylase inhibitor peptide aS4 from Allatide scholaris	191	X
19847	solution structure of alpha amylase inhibitor peptide aS1 from Allatide scholaris	187	X
19848	NMR solution structure of PA3793 from Pseudomonas aeruginosa	1311	X
19849	Solution structure of reduced BolA2 from Arabidopsis thaliana	784	X
19850	NMR-based docking model of GrxS14-BolA2 apo-heterodimer from Arabidopsis thaliana	712	X
19851	NMR structure of the protein YP_001712342.1 from Acinetobacter baumannii	1227	X
19852	NUCLEOTIDE-FREE HUMAN RAN GTPASE	2589	X
19853	AFB1 FAPY modified AGA duplex	161		X
19854	Structural Characterization of the Mengovirus Leader Protein Bound to Ran GTPase by Nuclear Magnetic Resonance	2631	X
19855	Structural Characterization of the Mengovirus Leader Protein Bound to Ran GTPase by Nuclear Magnetic Resonance	441	X
19856	Structure of a peptoid analogue of maculatin G15 in DPC micelles	216	X
19857	NMR Studies of the Phosphorylation of the Mengovirus Leader Protein Reveal Stabilization of Intermolecular Domain Interactions	437	X
19858	NMR Studies of the Phosphorylation of the Mengovirus Leader Protein Reveal Stabilization of Intermolecular Domain Interactions	438	X
19859	Solution structure of the mature form, GK cecropin-like peptide from Ae. aegypti mosquito	324	X
19860	Solution structure of a ribosomal protein	1022	X
19861	AFB1 FAPY modified AGT duplex	140		X
19862	E isomer of AFB1 FAPY modified AGC duplex	133		X
19863	AFB1 FAPY modified AG(7-deaza)G duplex	128		X
19864	H, N, Halpha, Calpha and Cbeta assignments of R1 peptide at pH 5 and 313 K	220	X
19865	LASSO PEPTIDE BASED INTEGRIN INHIBITOR: MICROCIN J25 VARIANT WITH RGDF SUBSTITUTION OF GLY12-ILE13-GLY14-THR15	130	X
19866	NMR assignment of the amylase-binding protein A from Streptococcus Parasanguinis	1927	X
19867	Structure of M. tuberculosis CrgA membrane protein in lipid bilayer	126	X
19868	Backbone 1H, 13C, and 15N Chemical Shift Assignments for p15(PAF) in complex with PCNA	388	X
19869	ZapA mutant dimer from B. stearothermophilus	895	X
19870	Solution Structure of 6aJL2 Amyloidogenic Light Chain Protein	1120	X
19872	Solution structure of the apo form of human glutaredoxin 5	1265	X
19873	D loop of tRNA(Met)	204			X
19874	Solution Structure of kalata B1[W23WW]	175	X
19875	Backbone resonance assignments of the pyrin domain of human Pyrin	584	X
19876	3D structure of YmoB. A modulator of biofilm formation.	1494	X
19878	Structure of Platypus 'Intermediate' Defensin-like Peptide (Int-DLP)	216	X
19879	NMR solution structure of a computational designed protein based on structure template 1cy5	713	X
19880	NMR structure of Copsin	2303	X
19881	transport protein m	1088	X
19882	NMR structure of a peptoid analogue of maculatin G15 containing cis-Nleu at position 13	182	X
19883	peptoid analogue of maculatin G15 - peptoid trans-Nleu at position 13	201	X
19884	Yeast cytochrome c peroxidase assignment	1237	X
19885	Backbone 1H, 13C, and 15N; and VL 13CH3 Side-chain Chemical Shift Assignments for SENP1 Catalytic Domain	1213	X
19886	MINOR GROOVE RECOGNITION OF DNA BY THIAZOTROPSIN ANALOGUES	98		X
19887	oligonucleotide model of miR-21 pre-element	100			X
19888	MINOR GROOVE RECOGNITION OF DNA BY THIAZOTROPSIN ANALOGUES	82		X
19889	MINOR GROOVE RECOGNITION OF DNA BY THIAZOTROPSIN ANALOGUES	96		X
19890	MINOR GROOVE RECOGNITION OF DNA BY THIAZOTROPSIN ANALOGUES	82		X
19891	A Mechanism for the cAMP-Dependent Auto-Inhibition of HCN	1243	X
19892	REFINED STRUCTURE OF OUTER MEMBRANE PROTEIN X IN NANODISC BY MEASURING RESIDUAL DIPOLAR COUPLINGS	235	X
19893	Chemical Shift Assignments and structure of Q4D059, a hypothetical protein from Trypanosoma cruzi	933	X
19901	1H, 13C, and 15N Chemical Shift Assignments for Thymosin alpha 1	281	X
19902	Solution NMR structure of the reovirus p15 fusion-associated small transmembrane (FAST) protein fusion-inducing lipid packing sensor (FLiPS) motif in dodecyl phosphocholine (DPC) micelles	205	X
19904	Solution structure of the PPIase domain of TbPar42	1413	X
19905	Phosphorylated 4E-BP2	515	X
19906	Backbone and side chain 1H, 13C, and 15N Chemical Shift Assignments for EDB and specific binding aptide	1113	X
19907	NMR resonance assignment of the archaeal ribosomal protein L7Ae	681	X
19908	NMR resonance assignment of the archaeal ribosomal protein L7Ae bound to a 25 nt RNA	647	X		X
19910	Solution structure of the P22S mutant of N-terminal CS domain of human Shq1	1005	X
19911	HP24wt derived from the villin headpiece subdomain	242	X
19912	MAJOR GROOVE ORIENTATION OF THE (2S)-N6-(2-HYDROXY-3-BUTEN-1-YL)-2'-DEOXYADENOSINE DNA ADDUCT INDUCED BY 1,2-EPOXY-3-BUTENE	163		X
19913	NMR Structure of KDM5B PHD1 finger	541	X
19914	NMR Structure of KDM5B PHD1 finger in complex with H3K4me0(1-10aa)	612	X
19915	Backbone 1H, 13C, and 15N Chemical Shift Assignments for cold shock protein, TaCsp	601	X
19916	Backbone 1H, 13C, and 15N Chemical Shift Assignments for cold shock protein, TaCsp with dT7	601	X
19917	Solution NMR structure of DNA dodecamer containing the 5-hydroxycytosine	70		X
19921	hIFABP-oleate complex	1550	X
19922	Backbone 1H, 13C, and 15N Chemical Shift Assignments of human TDP-43 RRM2	359	X
19923	Backbone 1H Chemical Shift Assignments for BuIIIB[C5U,C17U,C6A,C23A]	125	X
19925	Solution NMR structure of DNA dodecamer with A:C mismatch	72		X
19926	Backbone resonance assignments of the R42W mutant of pyrin domain of human Pyrin	447	X
19927	NMR study of non-structural proteins - 1H, 13C, 15N resonance assignment of macro domain from Mayaro virus (MAYV)	1494	X
19928	Chemical shift assignments BamA-P4P5	1812	X
19929	HP24stab derived from the villin headpiece subdomain	276	X
19930	Human p38 alpha ILVM methyl resonance assignments in non-phosphorylated apo state	616	X
19931	DC-SIGN	608	X
19932	Solution NMR structure of peptide ImI1 (peak 2)	67	X
19933	Membrane induced structure of novel human tachykinin Hemokinin-1 (hHK1)	50	X
19934	Dual-phospholyrated apo Human p38 alpha ILVM methyl resonance assignments	616	X
19935	Dual-phosphorylated human p38 alpha ILVM methyl resonance assignments in ADP-bound state	504	X
19936	Dual-phosphorylated human p38 alpha ILVM methyl resonance assignments in substrate-peptide-bound state	580	X
19937	Dual-phosphorylated human p38 alpha ILVM methyl resonance assignments in ADP and substrate-peptide-bound state	504	X
19938	Solution NMR structure of a putative thioredoxin (ECH_0218) in the oxidized state from Ehrlichia chaffeensis, the etiological agent responsible for human monocytic ehrlichiosis. Seattle Structural Genomics Center for Infectious Disease target EhchA.00546.a	1169	X
19939	Solution structure of MBD4 methyl-cytosine binding domain bound to methylated DNA	892	X	X
19940	Chemical shifts and structural constraints of outer membrane protein A	749	X
19941	Structural insights of TM domain of LAMP-2A in DPC micelles	431	X
19942	Solution structure of the terminal Ig-like domain from Leptospira interrogans LigB	1020	X
19943	3D NMR structure of the cytoplasmic rhodanese domain of the inner membrane protein YgaP from Escherichia coli	1125	X
19945	holo FldA	2048	X
19946	3D NMR structure of the cytoplasmic rhodanese domain of the full-length inner membrane protein YgaP from Escherichia coli	1113	X
19947	Structure of Bitistatin_A	789	X
19948	The proline-rich region of 18.5-kDa myelin basic protein requires long-range interactions with residues upstream to interact with the SH3-domain of Fyn	289	X
19949	The proline-rich region of 18.5-kDa myelin basic protein requires long-range interactions with residues upstream to interact with the SH3-domain of Fyn	289	X
19951	Resonance assignments and secondary structure of apolipoprotein E C-terminal domain in complex with DHPC	612	X
19952	Solution structure of StAR-related lipid transfer domain protein 6 (STARD6)	2434	X
19953	Receptor for Advanced Glycation End Products (RAGE) Specifically Recognizes Methylglyoxal Derived AGEs.	1050	X
19954	Structure of Nrd1p CID - Trf4p NIM complex	1475	X
19955	solution structure of tandem SH3 domain of Sorbin and SH3 domain-containing protein 1	1653	X
19957	Assignment of DNA-MC1 protein complex	1054	X	X
19958	Protein Phosphorylation upon a Fleeting Encounter	416	X
19959	Structural basis for binding of Pan3 to Pan2 and its function in mRNA recruitment and deadenylation	442	X
19960	Solution structure of the human chemokine CCL19	901	X
19961	Solution structure of SUMO Dimer in Complex with SIM2-3 from RNF4	1516	X
19962	Truncated L126Z-sod1 in DPC micelle	599	X
19963	Structure of Bitistatin_B	765	X
19966	Structure and function of the JAK interaction region in the intrinsically disordered N-terminus of SOCS5	747	X
19967	Solution NMR assignment of C-terminal RRM domain of La protein from D. discoideum.	1311	X
19968	1H, 13C, and 15N resonance assignments for the tandem PHD finger motifs of human CHD4	1392	X
19970	NMR structure of NKR-5-3B	531	X
19971	CupS	1866	X
19972	The proline-rich region of 18.5-kDa myelin basic protein requires long-range interactions with residues upstream to interact with the SH3-domain of Fyn	310	X
19973	Solution structure of an potent antifungal peptide Cm-p5 derived from C. muricatus	150	X
19974	NMR structure of BA42 protein from the psychrophilic bacteria Bizionia argentinensis sp. nov.	1770	X
19976	1H, 13C and 15N backbone resonance assignments for beta-lactamase BlaP with proline-glycine inserted at position 197	1234	X
19977	Solution structure human HCN2 CNBD in the cAMP-unbound state	1886	X
19978	Solution structure of the [AibB8,LysB28,ProB29]-insulin analogue	348	X
19979	Solution structure of B24G insulin	261	X
19980	NMR resonance assignments of the catalytic domain of human serine/threonine phosphatase calcineurin in unligated state	248	X
19981	NMR resonance assignments of the catalytic domain of human serine/threonine phosphatase calcineurin in VIVIT-bound state	254	X
19982	NPM-N (Nucleophosmin) pentamer assignment	544	X
19984	1H, 13C, 15N Resonance Assignment of the Chitin-Active Lytic Polysaccharide Monooxygenase BlLPMO10A from Bacillus licheniformis	1921	X
19985	Backbone, side chain and heme resonance assignments of the triheme cytochrome PpcD from Geobacter sulfurreducens	719	X
19986	NMR structure of Xenopus RecQ4 zinc knuckle	204	X
19987	Characterization and structure of the MIT1 domain of a chitin synthase from the Oomycete Saprolegnia monoica	845	X
19988	Solution structure of the PR domain of FOG-1	1323	X
19989	Structural Basis of Receptor Sulfotyrosine Recognition by a CC Chemokine: the N-terminal Region of CCR3 Bound to CCL11/Eotaxin-1	875	X
19990	ShK toxin at pH 5.4 and 7.0	309	X
19991	NMR assignement of salt stabilised Yeast Frataxin YFH1.	1348	X
19992	Kelch domain of human Keap1	504	X
19993	Lysyl t-RNA synthetase 1-72	453	X
19994	3D NMR structure of the transmembrane domain of the full-length inner membrane protein YgaP from Escherichia coli	371	X
19995	LysRS Anticodon Binding Domian 72-207	521	X
19996	Backbone chemical shifts of the murine ROQUIN-1 ROQ domain in complex with Tnf CDE 23mer RNA	776	X		X
19998	Solution structure of the sodium channel toxin Hd1a	398	X
19999	1H, 15N, 13C resonance assignment of human osteopontin	2306	X
20001	A novel lectin-like peptide from Odorrana grahami	104	X
20002	Solution structure of RgIA	77	X
20003	NMR Structure of Leucine-Enkephalin in Water	52	X
20004	NMR Solution Structure of Leucine-Enkephlain in DMPC+CHAPS (1:4) bicelles in 90% H2O/10% D2O of pH 6.6 at 298K	52	X
20005	NMR Solution Structure of Leucine-Enkephlain in DMPC+CHAPS (1:4) bicelles in 90% H2O/10% D2O of pH 6.6 at 298K	52	X
20007	Solution structure of conopressin-T	50	X
20008	Solution structure of L7P Conopressin-T	44	X
20009	NMR STRUCTURE OF THE MUTANT OF CHIGNOLIN, CLN025	66	X
20012	Tertiary structure and lipid interactions of short recombinant antimicrobial peptide	84	X
20013	Tertiary structure and lipid interactions of short recombinant antimicrobial peptide	84	X
20014	STRUCTURE OF ANTIBACTERIAL PEPTIDE CAPISTRUIN: A 19-RESIDUE LARIAT PROTOKNOT WITH A THREADED 9-MEMBER SIDECHAIN TO-BACKBONE RING	110	X
20015	NMR structure of a V3 (SF2 isolate) peptide	87	X
20016	NMR structure of Temporin-SHa in micellar SDS	151	X
20017	NMR structure of Temporin-SHb in micellar SDS	161	X
20018	NMR structure of Temporin-SHc in micellar SDS	152	X
20019	NMR structure of a V3 (MN isolate) peptide	96	X
20020	NMR structure of a V3 (LAI isolate) peptide	113	X
20022	1H Chemical Shift Assignments for metastin analog, s5a	61	X
20023	Structure, dynamics and selectivity of the sodium channel blocker mu-conotoxin SIIIA	189	X
20026	Mutagenesis and nuclear magnetic resonance analyses of the fusion peptide of Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus F protein	137	X
20027	Brome Mosaic Virus protein 1a Helix A bound to SDS micelle	186	X
20028	Structures of 1-15 peptide fragment of Statherin	94	X
20029	13C and 1H atom assignments and structure for Apelin 17 (Human form) at 35C	201	X
20030	13C, 1H chemical shifts and structure of apelin 17(human form, major conformation) at 5C	206	X
20031	13C, 1H chemical shifts and structure of Apelin 17 (Human form, minor conformation at 5C)	205	X
20032	Solution structure of Gelatinase Biosynthesis-Activating Pheromone (GBAP), a 11-residue peptide lactone, from the Gram-positive bacterium Enterococcus faecalis	70	X
20033	Solution structure of dicarba-ImI: an alpha-conotoxin with a non-reducible cystine analogue	111	X
20034	Solution NMR Structure of 4F Associated With DMPC Disc	137	X
20036	Cyclic Pseudotetrapeptide L-Phe-L-Trp-L-Lys-L-Thr	31	X
20037	Cyclic Pseudotetrapeptide D-Phe-L-Trp-L-Lys-L-Thr	33	X
20038	Cyclic Pseudotetrapeptide L-Phe-D-Trp-L-Lys-L-Thr	32	X
20039	Cyclic Pseudotetrapeptide L-Phe-L-Trp-D-Lys-L-Thr	31	X
20040	Cyclic Pseudotetrapeptide D-Phe-D-Trp-D-Lys-L-Thr	30	X
20041	Cyclic Pseudotetrapeptide L-Phe-D-Trp-D-Lys-L-Thr	31	X
20042	Cyclic Pseudotetrapeptide L-Phe-L-Trp-D-Lys-D-Thr	28	X
20043	Cyclic Pseudotetrapeptide L-Phe-D-Trp-L-Lys-D-Thr	29	X
20044	NMR structure of the Interleukin-8 C-terminal domain in solution with SDS micelles	156	X
20045	SOLUTION NMR STRUCTURE OF HUMAN IAPP-1-19	104	X
20046	SOLUTION NMR STRUCTURE OF RAT IAPP-1-19	106	X
20047	INTERACTION OF THE DENGUE VIRUS FUSION PEPTIDE WITH MEMBRANES ASSESSED BY NMR: THE ESSENTIAL ROLE OF THE ENVELOPE PROTEIN TRP101 FOR MEMBRANE FUSION	71	X
20048	NMR solution structure of an analgesic Mu-contoxin KIIIA	122	X
20049	NMR solution structure of Mu-KIIIA[C1A,C9A]	121	X
20050	NMR STRUCTURE OF DPAKKR, A CYCLIC PENTAPEPTIDE MIMIC OF BDNF	41	X
20051	Biological and structural study of Obestatin and its analogues Structural importance of Obestatin and its biology	137	X
20052	Solution NMR Structure of Insulin A-chain peptide	130	X
20053	Solution NMR structure of Insulin A-chain variant peptide	165	X
20054	Tetramer of KIA7W peptide	202	X
20055	Tetramer of KIA7H peptide	161	X
20056	LSEAL penta-peptide Calpain inhibitor	37	X
20057	NMR structure of designed peptide, YI12WF in the presence of Lipopolysaccharide	81	X
20058	Solution structure of designed peptide, YI12WW in the presence of Lipopolysaccharide	85	X
20059	Solution structure of designed peptide, YI12WY in the presence of LPS bilayer	84	X
20060	Solution structure of designed peptide, YI12FF in the presence of LPS bilayer	80	X
20061	Solution structure of designed peptide GG8WF in the presence of LPS bilayer	47	X
20062	3D NMR models of MBP83-99 peptide in DMSO	131	X
20063	NMR STRUCTURE OF A MODEL PEPTIDE BOUND TO GROEL	82	X
20064	Design, Synthesis, Biological Evaluation, and Structural Characterization of Potent Histone Deacetylase Inhibitors Based on Cyclic alpha/beta-tetrapeptide architectures	30	X
20065	Design, Synthesis, Biological Evaluation, and Structural Characterization of Potent Histone Deacetylase Inhibitors Based on Cyclic alpha/beta-tetrapeptide architectures	39	X
20066	Design, Synthesis, Biological Evaluation, and Structural Characterization of Potent Histone Deacetylase Inhibitors Based on Cyclic alpha/beta-tetrapeptide architectures	38	X
20067	Design, Synthesis, Biological Evaluation, and Structural Characterization of Potent Histone Deacetylase Inhibitors Based on Cyclic alpha/beta-tetrapeptide architectures	44	X
20068	Design, Synthesis, Biological Evaluation, and Structural Characterization of Potent Histone Deacetylase Inhibitors Based on Cyclic alpha/beta-tetrapeptide architectures	44	X
20069	Design, Synthesis, Biological Evaluation, and Structural Characterization of Potent Histone Deacetylase Inhibitors Based on Cyclic alpha/beta-tetrapeptide architectures	44	X
20070	Design, Synthesis, Biological Evaluation, and Structural Characterization of Potent Histone Deacetylase Inhibitors Based on Cyclic alpha/beta-tetrapeptide architectures	43	X
20071	Probing the Bioactive Conformation of an Archetypal Natural Product HDAC Inhibitor Using Conformationally Homogeneous Triazole-Modified Cyclic Tetrapeptides	15	X
20072	Probing the Bioactive Conformation of an Archetypal Natural Product HDAC Inhibitor Using Conformationally Homogeneous Triazole-Modified Cyclic Tetrapeptides	30	X
20073	Probing the Bioactive Conformation of an Archetypal Natural Product HDAC Inhibitor Using Conformationally Homogeneous Triazole-Modified Cyclic Tetrapeptides	15	X
20074	Protein Fibril	144	X
20075	Solution structure of the N(1-21)MeuTXK-beta in presence of TFE	161	X
20076	NMR Solution Structure of a TC5b_D9E miniprotein	134	X
20078	Solution Structure of Antimicrobial Peptide Hedistin	156	X
20079	NMR solution structure of the loopregion Tyr67 - Leu77 of visual arrestin in complex with lightactivated rhodopsin	74	X
20080	Structure and interactions in membranes of human and bovine Catestatin by solution and solid-state NMR spectroscopy	132	X
20081	solution structures of bradykinin - penta-O-galloyl-D-glucopyranose complexe	57	X
20082	Apelin17 bound to SDS micelles	223	X
20084	DIRHODIUM PEPTIDE COMPLEX	126	X
20085	Solution structure of SFT-L1	68	X
20086	Helical Agonist of Nociceptin (NOP) Receptor	82	X
20087	Novel Helix-Constrained Nociceptin Derivatives Are Potent Agonists and Antagonists of ERK Phosphorylation and Thermal Analgesia in Mice	127	X
20088	Novel Helix-Constrained Nociceptin Derivatives Are Potent Agonists and Antagonists of ERK Phosphorylation and Thermal Analgesia in Mice	127	X
20089	Novel Helix-Constrained Nociceptin Derivatives Are Potent Agonists and Antagonists of ERK Phosphorylation and Thermal Analgesia in Mice	127	X
20090	KAAAD, single alpha helix turn	29	X
20091	RSV_1nal	88	X
20092	To be advised	89	X
20093	REV_HIV peptides	128	X
20094	Effects of Peptoid Residue Substitutions on Structural Flexibility and Bacterial-Cell Selectivity of Piscidin 1	159	X
20095	Effects of Peptoid Residue Substitutions on Structural Flexibility and Bacterial-Cell Selectivity of Piscidin 1	159	X
20098	Effects of Peptoid Residue Substitutions on Structural Flexibility and Bacterial-Cell Selectivity of Piscidin 1	156	X
20101	Lipid-induced Conformation of Substance P	74	X
20102	C-Terminal helix of the SERCA2b Ca2+ pump (ATP2A2B)	133	X
20103	Structural studies of antimicrobial peptide XT-7 and its Lysine4 analogue	128	X
20104	structural studies of antimicrobial peptide XT-7 and its Lysine mutated peptide	116	X
20105	BI-32169	108	X
20107	NMR structure of conotoxin ImI analogue	66	X
20108	Conformational Flexibility of SecA IRA1 Loop Region	126	X
20109	CHARACTERIZATION OF THE LIGAND-FREE CONSTITUTIVE ACTIVITY OF THE THROMBOXANE A2 RECEPTOR BY THE INTEGRATED APPROACHES OF NMR SPECTROSCOPY AND A RECOMBINANT RECEPTOR	104	X
20110	Solution structure of PV1-VPgpU	165	X
20111	Conformational Flexibility of SecA IRA1 Loop Region	120	X
20112	CHARACTERIZATION OF THE LIGAND-FREE CONSTITUTIVE ACTIVITY OF THE THROMBOXANE A2 RECEPTOR BY THE INTEGRATED APPROACHES OF NMR SPECTROSCOPY AND A RECOMBINANT RECEPTOR	112	X
20113	1H, 13C assignments and NMR structure of temporin-SHf	173	X
20114	alpha-conotoxin FI	89	X
20115	Substance P 40 structures in water pH 5.5 298 K NMR DATA & STRUCTURES	88	X
20116	Substance P in DMPC:CHAPS q=0.25 bicelles	88	X
20117	Substance P 40 structures in water pH 5.5 298 K NMR DATA & STRUCTURES	88	X
20118	A 15-residue peptide corresponding to the C-terminal domain of the Gq protein alpha subunit (Gaq-Ct peptide) was synthesized and characterized using NMR spectroscopic studies.	88	X
20119	Assembling NMR structures for the intracellular loops of the human thromboxane A2 receptor: Implication of the G protein-coupling pocket	137	X
20121	Tubulysin conformation bound to tubulin	56	X
20122	Solution structure of CCAP-vil with one disulfide bond from Conus villepinii	57	X
20123	NS4A(1-22)	198	X
20124	Structure and lipid interactions of an anti-atherogenic Apolipoprotein J peptide using solution NMR	85	X
20125	DPC micelle bound VK22	116	X
20126	Alpha-conotoxin Vc1.2	152	X
20127	Nociceptin Agonist	78	X
20128	solution structure of conotoxin qc16a	47	X
21000	Lasso peptide based integrin inhibitor: Microcin J25 variant with RGD substitution of Gly12-Ile13-Gly14	112	X
21001	NMR solution of a tridimensional peptidic structure in bilayer lipids: Example with neurotensin in Small Unilamellar Vesicle environment	109	X
21002	Solution NMR structure of TZ2C-BG	87	X
21006	alpha-conotoxin ImI cystathionine 2-4	65	X
21007	alpha-conotoxin ImI cystathionine 1-3	66	X
21008	LPS bound structure of Temporin-1Tl	98	X
21009	The Binding Mechanism of a Peptidylic Cyclic Serine Protease Inhibitor - upain-1	119	X
21010	The Binding Mechanism of a Peptidylic Cyclic Serine Protease Inhibitor - extended upain	177	X
21011	LPS bound structure of Cysteine deleted TachyplesinI	90	X
21013	DPC micelle bound RI23	147	X
21014	solution structure of conotoxin lt14a	77	X
21015	solution structure of conotoxin pu14a	122	X
21018	Compstatin 10	102	X
21019	NMR structure, localization and vesicle fusion of Chikungunya Virus Fusion Peptide	69	X
21022	MDCSGCSRPG cyclic + copper(I) from acidic	48	X
21023	MDCSGCSRPG head-to-tail cyclic peptide + Cu(I) no metal constraint - high energy ensemble (B)	48	X
21024	MDCSGCSRPG cyclic peptide bound to Cu(I) from acidic conditions	48	X
21025	MDCSGCSRPG+Zn from acidic conditions	48	X
21026	MDCSGCSRPG + Zn from basic conditions	47	X
21027	MDCSGCSRPG + Zn from basic conditions - tridentate binding	47	X
21028	MDCSGCSRPG-Zn-water complex from acidic conditions	48	X
21031	Solution structure of Lewis a [Gal-beta1_3-(Fuc-alpha1_4-)GlcNAc-beta-Me]	49				X
21032	Solution structure of 1,3-Fucosylated chitobiose	130				X
21033	Solution structure of Lewis x (Gal-beta1,4-[Fuc-alpha1,3]-GlcNAc-beta) attached to a protein	48	X			X
21034	Solution structure of Lewisx (Gal-beta1,4-[Fuc-alpha1,3-]GlcNAc-beta-OMe) at 277 K	98				X
21035	AIP-III	45	X
21036	AIP-III_D4A	55	X
21037	AIP-III_DF5	52	X
21038	AIP-III_DL7	53	X
21039	AIP-III_F5A cyclic peptide	49	X
21040	AIP-III_L7A	48	X
21041	tAIP-III	41	X
21042	tAIP-III_D2A	42	X
21045	AIP-I	50	X
21046	AIP-II	53	X
21047	AIP-IV	54	X
21053	Solution structure of fucosylated LacDiNAc (LDNF)	76				X
21054	Solution structure of the amphibian egg glycan Bv9 from Bombina variegata	66				X
21056	SFTI-TCTR N12 N14 NMeSer6	91	X
21057	SFTI-TCTR N12 N14	89	X
21058	PapMA	151	X
21059	Trans-PapMA-k	151	X
21060	conotoxin Eb1.6	91	X
21062	conotoxin Im10A	56	X
21064	Beta-proline alternating homotetramer made of 5-phenylpyrrolidine-2,4-dicarboxylate monomeric units. EZZ conformation.	68	X
21065	Beta-proline alternating homotetramer made of 5-phenylpyrrolidine-2,4-dicarboxylate monomeric units. ZZZ conformation.	97	X
21066	Beta-proline alternating homotetramer made of 5-phenylpyrrolidine-2,4-dicarboxylate monomeric units. ZEZ conformation.	94	X
21067	Beta-proline alternating homotetramer made of 5-phenylpyrrolidine-2,4-dicarboxylate monomeric units. ZZE conformation.	89	X
21068	Beta-proline alternating homopentamer made of 5-phenylpyrrolidine-2,4-dicarboxylate monomeric units. ZZEZ conformation.	78	X
21069	Beta-proline alternating homopentamer made of 5-phenylpyrrolidine-2,4-dicarboxylate monomeric units. ZEZZ conformation.	73	X
21070	Beta-proline homodimer made of 5-(2-(trifluoromethyl)phenyl)pyrrolidine-2,4-dicarboxylate monomeric units	79	X
21071	Beta-proline homodimer made of 5-(2-(trifluoromethyl)phenyl)pyrrolidine-2,4-dicarboxylate monomeric units, Z conformation	79	X
21072	Beta-proline alternating heterodimer made of 5-(2-(trifluoromethyl)phenyl)pyrrolidine-2,4-dicarboxylate monomeric units, E conformation	79	X
21073	Beta-proline alternating heterodimer made of 5-(2-(trifluoromethyl)phenyl)pyrrolidine-2,4-dicarboxylate monomeric units, Z conformation	79	X
21074	Structure of the membrane proximal region of ITBG3 - residues 722-739	124	X
21075	NMR Structure of Lactam Constrained beta3-Integrin Cytoplasmic Domain Fragment (K724-D728)	130	X
21076	NMR Structure of Lactam Constrained beta3-Integrin Cytoplasmic Domain Fragment (K725-D729)	123	X
21077	NMR Structure of Lactam Constrained beta3-Integrin Cytoplasmic Domain Fragment (K728-D732)	126	X
21078	NMR Structure of Lactam Constrained beta3-Integrin Cytoplasmic Domain Fragment (K729-D733)	123	X
21079	Influenza Hemagglutinin Peptide	153	X
21082	HAL-2/27	201	X
21084	Beta-proline alternating trimer made of 5-(2-(trifluoromethyl)phenyl)pyrrolidine-2,4-dicarboxylate monomeric units, ZZ conformation	103	X
21085	Beta-proline heterochiral trimer made of 5-(2-(trifluoromethyl)phenyl)pyrrolidine-2,4-dicarboxylate monomeric units, ZZ conformation	94	X
21086	Beta-proline heterochiral trimer made of 5-(2-(trifluoromethyl)phenyl)pyrrolidine-2,4-dicarboxylate monomeric units, ZE conformation	83	X
21098	Solution structure of the Secapin-like peptide U17-MYRTX-Tb1a from Ant venom.	260	X
21099	Solution structure of U3-MYRTX-Tb1a peptide from Ant venom.	296	X
21100	Solution structure of M-MYRTX-Tb1a peptide (Bicarinalin) from Ant peptide venom.	262	X
21101	Solution structure of U9-MYRTX-Tb1a from Ant peptide venom.	253	X
25000	WW3 domain of Nedd4L in complex with its HECT domain PY motif	366	X
25001	Structural insight into host recognition and biofilm formation by aggregative adherence fimbriae of enteroaggregative Esherichia coli	1652	X
25002	Solution structure of the LysM region of the E. coli Intimin periplasmic domain	947	X
25003	1H, 13C and 15N backbone resonance assignments for the class A beta-lactamase BlaP from Bacillus licheniformis 749/C with proline-glycine inserted at position 216	1273	X
25004	Chemical shift assignments for the parallel in-register D23N Iowa Mutant Beta Amyloid Fibrils	59	X
25005	THREE-DIMENSIONAL STRUCTURE OF CAP-GLY DOMAIN ASSEMBLED ON MICROTUBULES DETERMINED BY MAS NMR SPECTROSCOPY	312	X
25007	STRUCTURAL CHARACTERIZATION OF THE C3 DOMAIN OF CARDIAC MYOSIN BINDING PROTEIN-C	1196	X
25008	Phosphotyrosine binding domain	692	X
25009	Cysteine Deleted Protegrin-1 (CDP-1): Anti-bacterial Activity, Outer-Membrane Disruption and Selectivity	65	X
25010	Structural Characterization of the Hypertrophic Cardiomyopathy-Related R502W Mutant of the C3 Domain of Cardiac Myosin Binding Protein-C	1096	X
25011	Cysteine Deleted Protegrin-1 (CDP-1): Anti-bacterial Activity, Outer-Membrane Disruption and Selectivity	57	X
25012	Cysteine Deleted Protegrin-1 (CDP-1): Anti-bacterial Activity, Outer-Membrane Disruption and Selectivity	54	X
25016	Solution structure of Y125F mutant of eRF1 N-domain	1562	X
25018	Solution NMR Structure of DE NOVO DESIGNED PROTEIN LFR1 WITH FERREDOXIN FOLD, Northeast Structural Genomics Consortium (NESG) Target OR414	1366	X
25019	Sequential backbone HN, N, Ca and Cb assignments of E.coli dihydrofolate reductase-folate binary complex at pH 7.0 and 308 K	575	X
25020	Solution structure of E55Q mutant of eRF1 N-domain	1556	X
25021	Backbone chemical shifts of murine Roquin-1 ROQ domain (147-326), apo form	735	X
25022	Polyglutamine binding peptide 1 (QBP1)	128	X
25023	15N HSQC assignment of Drosophila ELF domain from FANCL	155	X
25024	3D structure of RP domain of MiSp	511	X
25025	Conformational Plasticity Surrounding the Active Site of NADH Oxidase from Thermus thermophilus	794	X
25026	NMR structure of putative beta-lactamase (NP_372339.1) from Staphylococcus aureus Mu50	1656	X
25027	NMR structure of the hypothetical protein BVU_0925 from Bacteroides vulgatus ATCC 8482	1085	X
25028	NMR structure of the hypotheical protein Lreu_0056 from Lactobacillus reuteri	1403	X
25029	Specific and Non-Specific Interactions in Ultra-Weak Protein-Protein Associations Revealed by Solvent Paramagnetic Relaxation Enhancements	751	X
25030	Solution structure of Escherichia coli Outer membrane protein A C-terminal domain	254	X
25031	NMR structure of spider toxin Mu-TRTX-Hhn2b	392	X
25032	Solution structure of a bacterial immunoglobulin-like domain form a surface protein of Leptospira	788	X
25033	Solution structure of the Chlamydomonas reinhardtii NAB1 cold shock domain, CSD1	764	X
25034	Amide 1H and 15N chemical shift assignments and 15N relaxation parameters of the troponin C-troponin I hybrid proteins cChimera	278	X
25035	Amide 1H and 15N chemical shift assignments and 15N relaxation parameters of the troponin C-troponin I hybrid proteins cChimeraX	390	X
25036	Solution structure of CsUbl	796	X
25037	Solution structure of N terminal domain of the MuB AAA+ ATPase	705	X
25038	Structural Investigation of hnRNP L	1098	X
25039	Structural Investigation of hnRNP L	1287	X
25040	Structural Investigation of hnRNP L	2075	X
25041	Structural Investigation of hnRNP L bound to RNA	1200	X		X
25042	Structural Investigation of hnRNP L bound to RNA	1425	X		X
25043	Structural Investigation of hnRNP L bound to RNA	2389	X		X
25044	Hug1 is an Intrinsically Disordered Protein that inhibits RNR activity.	592	X
25046	Backbone 1H, 15N Chemical Shift Assignments of the DC-SIGNR carbohydrate recognition domain in the Apo state.	168	X
25047	RRM-Peptide and RES Complex	1420	X
25048	Transient Collagen Triple Helix Binding to a Key Metalloproteinase in Invasion and Development: Spin Labels to Structure	950	X
25049	A Structure based mechanism for tRNA and retroviral RNA remodeling during primer annealing	720			X
25050	Hm-3	324	X
25052	A structure-based mechanism for tRNA and retroviral RNA remodeling during primer annealing	252	X		X
25059	Backbone assignment for cold shock domain 1 of Drosophila Upstream of N-ras	767	X
25060	Backbone assignment for cold shock domain 1 of Drosophila Upstream of N-ras bound with RNA	456	X		X
25061	Solution NMR Structure of De novo designed Protein, Northeast Structural Genomics Consortium (NESG) Target OR457	1661	X
25062	Solution NMR Structure of De novo designed protein, Northeast Structural Genomics Consortium (NESG) Target OR462	1707	X
25063	The backbone chemical shift assignments of [ZnZn]-IMP-1 metallo-beta-lactamase	947	X
25064	apo structure of the Peptidyl Carrier Protein Domain 7 of the teicoplanin producing Non-ribosomal peptide synthetase	1961	X
25065	holo structure of the Peptidyl Carrier Protein Domain 7 of the teicoplanin producing Non-ribosomal peptide synthetase	1892	X
25066	NMR structure of UBA domain of DNA-damage-inducible 1 protein (Ddi1)	341	X
25067	Solution NMR Structure of De novo designed protein, Northeast Structural Genomics Consortium (NESG) Target OR459	1372	X
25068	NMR Structure and 1H, 13C and 15N Chemical Shift Assignments for High mobility group protein from Plasmodium falciparum 3D7.	928	X
25069	Solution structure of human Ca2+-loaded S100A4 cys-free mutant	1137	X
25070	NMR structure of the Rad18-UBZ/ubiquitin complex	1276	X
25071	NMR structure of the ubiquitin-binding zinc finger (UBZ) domain from human Rad18	297	X
25072	Sex-lethal in complex with Upstream-to-N-Ras and msl2 mRNA	434	X		X
25076	Solid-state NMR resonance assignments of the filament-forming CARD domain of the innate immunity signaling protein MAVS	571	X
25077	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the PDZ domain and the linker of the Protein Tyrosine phosphatase non-receptor type 4	599	X
25078	CSD1-UNR bound to msl2 mRNA and Sex-lethal	217	X
25079	Assignment of the transmembrane domain of the erythropoietin receptor	302	X
25080	The backbone chemical shift assignments of [FeZn]-IMP-1 metallo-beta-lactamase	474	X
25081	Fyn SH2 bound	1386	X
25082	Fyn SH2 domain in complex with the natural inhibitory phosphotyrosine peptide	57	X
25083	Backbone 1H, 13C, and 15N Chemical Shift Assignments and NMR structure for potential drug target from Burkholderia thailandensis E264'	865	X
25084	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Sp Cdc5-D3	304	X
25085	Solution structure of the rhodanese domain of YgaP from E. coli	1241	X
25086	truncated EcMazE	776	X
25087	Resonance assignments of myristoylated Y28F/Y67F mutant of the Mason-Pfizer monkey virus matrix protein	1629	X
25088	NMR solution structure of the Ubiquitin like domain (UBL) of DNA-damage-inducible 1 protein (Ddi1)	986	X
25092	truncated EcMazE-DNA complex	126	X	X
25093	full-length EcMazE	913	X
25094	full-length EcMazE-DNA complex	159	X
25096	Solution Structure of MciZ from Bacillus subtilis	263	X
25098	NMR solution structure of copper binding protein in the apo form	952	X
25099	Dimeric structure of the Human A-box	100		X
25100	Solution NMR structure pf tRNApro:MLV-Nucleocapsid (1:2) Complex	336	X		X
25101	Solution NMR structure of tRNApro:MLV Nucleocapsid Protein (1:1) Complex	283	X		X
25102	The NMR structure of the rubredoxin domain of the NO Reductase Flavorubredoxin from Escherichia coli	422	X
25104	CYCLOPHILIN A COMPLEXED WITH A FRAGMENT OF CRK-II	1865	X
25105	BAZ2B bromodomain	527				X
25106	Structural dynamics of double-helical RNA having CAG motif	33			X
25107	Human Telomeric G-quadruplex DNA sequence (TTAGGGT)4 complexed with Flavonoid Quercetin	61		X
25108	Backbone Chemical Shift Assignment for the pfPP1 phosphatase regulator pfI2 of Plasmodium falciparum	488	X
25109	Solution NMR structure of MAVS CARD	1256	X
25110	Solution structure of a left-handed G-quadruplex	267		X
25111	Resonance assignment of the ligand-free cyclic nucleotide-binding domain from the murine ion channel HCN2	1833	X
25112	Structural and immunological analysis of circumsporozoite protein peptides: a further step in the identification of potential components of a minimal subunit-based, chemically synthesised antimalarial vaccine.	87	X
25113	Domain Orientation and Dynamics of the 38.8 kDa Staphylococcus aureus Hemoglobin Receptor, IsdH	2227	X
25114	NMR data-driven model of GTPase KRas-GDP tethered to a lipid-bilayer nanodisc	44	X
25115	NMR data-driven model of GTPase KRas-GNP tethered to a lipid-bilayer nanodisc	44	X
25116	NMR data-driven model of GTPase KRas-GNP:ARafRBD complex tethered to a lipid-bilayer nanodisc	52	X
25117	1H, 13C, and 15N Chemical Shift Assignments for SAIL-DsbA	3821	X
25118	Chemical shift assignments for human cardiac troponin I, residues 1-73	593	X
25119	Chemical shift assignments for human cardiac troponin I, residues 1-73, bound to cardiac troponin C	783	X
25120	Human cardiac troponin C (aCys) in complex with cTnI[1-73] and cTnI[144-163]	1685	X
25121	The influenza hemagglutinin fusion domain is an amphipathic helical-hairpin that functions by inducing negative membrane curvature	96	X
25122	NMR SOLUTION STRUCTURE OF SCORPION VENOM TOXIN Ts11 (TsPep1) FROM Tityus serrulatus	238	X
25123	13C,15N solid-state NMR chemical shift assignments for microcrystallized Ubiquitin in MPD	408	X
25124	Solution Structure and Chemical Shift Assignments for BeF3 activated Receiver Domain of Nitrogen Regulatory Protein C ( NtrC ) at 35C	1565	X
25125	Solution Structure and Chemical Shift Assignments for the Apo form of the Receiver Domain of Nitrogen Regulatory Protein C ( NTRC ) at 35C	1557	X
25127	NMR structure of a putative phosphoglycolate phosphatase (NP_346487.1) from Streptococcus pneumoniae TIGR4	2213	X
25128	cGm9a	164	X
25129	cBru9a	137	X
25130	Solution structure of LEDGF/p75 IBD in complex with MLL1 peptide (140-160)	1195	X
25131	1H chemical shift assignment of Kindlin-2 F2	112	X
25132	NMR study of non-structural proteins - 1H, 13C, 15N resonance assigment of macro domain of Venezuelan equine encephalitis virus (VEEV)	1776	X
25133	HOXD13 Solution NMR Chemical Shift Coordinates	608	X
25134	H, N, Calpha assignments of AMA1-bound R1 peptide at pH 7 and 313k	39	X
25135	Solution structure of the MLKL N-terminal domain	1994	X
25136	Backbone and Side Chain Chemical Shift Assignments for S100A4dC	472	X
25137	Ligand-induced folding of a receiver domain	1528	X
25138	Chemical shift assignments of DRB4(1-153), a dsRNA binding protein in A. thaliana RNAi pathway	1658	X
25139	The solution structure of the MANEC-type domain from Hepatocyte Growth Factor Inhibitor 1 reveals an unexpected PAN/apple domain-type fold	2133	X
25140	Backbone chemical shift assingment of apo EL_LovR	626	X
25141	Backbone chemical shift assignment of EL_LovR bound to magnesium chloride	372	X
25142	Solution structure of Hox homeodomain	773	X
25143	Solution structure of the RING finger of the tripartite 19 from human.	599	X
25145	Solution structure of the B1 box monomer of the tripartite 19 from human.	586	X
25146	Solid-state NMR chemical shifts of amyloid-like fibrils formed by huntingtin N-terminal fragments (httNTQ30P10K2)	150	X
25147	Struture of -24 DNA binding domain of sigma 54 from E. coli	854	X
25148	NTD-NUSA	1529	X
25149	Isolated Ring domain	837	X
25150	Solution structure of the human ubiquitin conjugating enzyme Ube2w	710	X
25151	Solution structure of spider-venom peptide Hs1a	378	X
25152	Solution structure MTAbl13, a grafted MCoTI-II	241	X
25153	holo_FldB	2094	X
25154	Backbone 1H, 15N and 13C resonance assignments of murine STING in complex with DMXAA	1118	X
25155	apo_FldB	1732	X
25156	Structure of decorin binding protein A from strain N40 of Borrelia burgdorferi	1246	X
25157	Strcucture of Decorin Binding Protein A from strain PBr of Borrelia garinii	1810	X
25158	Solution structure of Doc48S	859	X
25159	Solution structure of the La motif of human LARP6	1183	X
25160	NMR structure of the RRM1 of human LARP6	1254	X
25161	Carnolysin A1'	225	X
25162	Carnolysin A2'	166	X
25163	NMR structure of the III-IV-V three-way junction from the VS ribozyme	693			X
25164	NMR structure of the III-IV-V three-way junction from the VS ribozyme and identification of magnesium-binding sites using paramagnetic relaxation enhancement	693			X
25165	Solution NMR Structure of DE NOVO DESIGNED DE NOVO DESIGNED FR55, Northeast Structural Genomics Consortium (NESG) Target OR109	1084	X
25166	1H, 15N, and 13C resonance assignments of the ectodomain of the B. subtilis RodZ	1367	X
25167	Backbone 1H, 13C, and 15N Chemical Shift Assignments for CS domain of human Shq1	433	X
25168	flpp3sol BMRB submission	1179	X
25169	Backbone 1H, 13C, and 15N Chemical Shift Assignments for RCB-1 peptide	181	X
25170	Assignment for last 50 residues from three different organisms	914	X
25171	Solution structure of MLL-IBD complex	1425	X
25172	H, 13C and 15N assignments of EGF domains 4 to 7 of human Notch-1	1387	X
25173	Backbone 1H, 13C, and 15N Chemical Shift Assignments for N-terminal domain of NikR	240	X
25174	Non-reducible analogues of alpha-conotoxin RgIA: [2,8]-cis dicarba RgIA	120	X
25175	NMR resonance assignment of the N-terminal domain of the lantibiotic immunity protein NisI	1393	X
25176	The structure of Filamin repeat 21 bound to integrin	1430	X
25177	Solution Structure of a De Novo Designed Peptide that Sequesters Toxic Heavy Metals	824	X
25178	Three-dimensional structure of the p7 protein of hepatitis C virus in phospholipid bilayers by solid-state NMR	133	X
25179	Backbone resonance assignments of the wt NS4A N-terminal domain of DENV	351	X
25180	Backbone resonance assignments of the mutant NS4A N-terminal domain of DENV (L6E;M10E)	342	X
25181	Three-Dimensional Structure and Interaction Studies of Hepatitis C Virus p7 in 1,2-Dihexanoyl-sn-glycero-3-phosphocholine by Solution Nuclear Magnetic Resonance	177	X
25182	Backbone chemical shift assignment of FG-NUP (274 -399) under in-cell condition.	568	X
25183	Backbone chemical shift assignment of FG-NUP (274 -398) in buffer condition.	587	X
25184	Backbone chemical shift assignment of FG-NUP (49-172) under in cell condition.	412	X
25185	Backbone chemical shift assignment of FG-NUP (48-172) in buffer condition.	592	X
25186	Non-reducible analogues of alpha-conotoxin RgIA: [3,12]-cis dicarba RgIA	125	X
25187	Non-reducible analogues of alpha-conotoxin RgIA: [3,12]-trans dicarba RgIA	115	X
25188	Solution Structure of the YTH Domain of YT521-B in complex with N6-Methyladenosine containing RNA	1976	X		X
25189	Evidence supporting the hypothesis that specifically modifying a malaria peptide to fit into HLA-DR 1*03 molecules induces antibody production and protection	123	X
25190	Protection against experimental P. falciparum malaria is associated with short AMA-1 peptide analogue alpha-helical structures	134	X
25191	3D structure determination of STARP peptides implicated in P. falciparum invasion of hepatic cells	140	X
25192	Haddock model of Bacillus subtilis L,D-transpeptidase in complex with a peptidoglycan hexamuropeptide	576	X			X
25193	NMR resonance assignment of the lantibiotic immunity protein NisI	1075	X
25194	NMR resonance assignment of the C-terminal domain of the lantibiotic immunity protein NisI	1511	X
25195	Solution structure of a putative arsenate reductase from Brucella melitensis. Seattle Structural Genomics Center for Infectious Disease target BrabA.00073.a	1440	X
25196	haloSRC assignment	379	X
25197	wrapping silk W2	1534	X
25199	Backbone (HN, NH, CO and CA) Chemical Shift Assignments for Ca(2+)-bound Myristoylated GCAP-2 in the Presence of 10 mM CHAPS	690	X
25200	3D structure determination of STARP peptides implicated in P. falciparum invasion of hepatic cells	153	X
25201	Shortening and modifying the 1513 MSP-1 peptide's alpha-helical region induces protection against malaria	127	X
25202	Distorting malaria peptide backbone structure to enable fitting into MHC class II molecules renders modified peptides immunogenic and protective.	136	X
25203	Changing ABRA protein peptide to fit the HLA-DR B1*0301 molecule renders it protection-inducing	144	X
25204	Shifting the Polarity of some Critical Residues in Malarial Peptides Binding to Host Cells is a Key Factor in Breaking Conserved Antigens	161	X
25205	Solution structure of the analgesic sea anemone peptide APETx2	250	X
25206	Structural modifications to a high-activity binding peptide located whitin the PfEMP1 NTS domain induce protection against P. falciparum malaria in Aotus monkeys	109	X
25207	Structure Immunogenicity and Protectivity Relationship for the 1585 Malarial Peptide and Its Substitution Analogues	176	X
25208	Backbone and Side Chain Chemical Shift Assignments for S100A4dC in complex with MPT	878	X
25209	Binding activity, structure, and immunogenicity of synthetic peptides derived from Plasmodium falciparum CelTOS and TRSP proteins	147	X
25210	Shotgun proteolysis: A practical application	1488	X
25211	Protective cellular immunity against P. falciparum malaria merozoite is associated with a different P7 and P8 residue orientation in the MHC-peptide-TCR complex	166	X
25212	High-resolution NMR structure of the protegrin-2 docked to DPC Micelles	107	X
25213	HIGH-RESOLUTION NMR STRUCTURES OF THE DOMAINS OF SACCHAROMYCES CEREVISIAE THO1	589	X
25214	HIGH-RESOLUTION NMR STRUCTURES OF THE DOMAINS OF SACCHAROMYCES CEREVISIAE THO1	787	X
25215	Plasmodium falciparum SERA protein peptide analogues having short helical regions induce protection against malaria	153	X
25217	1H, 13C, and 15N Chemical Shift Assignments for AUX/IAA17	1138	X
25218	Chemical shifts of amyloid beta (1-42) peptide in aqueous solution	362	X
25219	Solution Structure of the UBM1 domain of human HUWE1/ARF-BP1	565	X
25220	N6-Methyladenosine RNA	120			X
25221	Solution structure of the PHD domain of Yeast YNG2	602	X
25222	Monomeric phospholamban, R14del mutant	98	X
25223	mu-SLPTX3-Ssm6a	537	X
25224	Backbone 1H, 13C, and 15N resonance assignments of the Fc fragment of human immunoglobulin G glycoprotein	937	X
25225	Structure of the trans-(Tyr39-Pro40) form of the Human Secreted Ly-6/uPAR Related Protein-1 (SLURP-1)	849	X
25226	Structure of the cis-(Tyr39-Pro40) form of the Human Secreted Ly-6/uPAR Related Protein-1 (SLURP-1)	864	X
25227	1H, 13C, and 15N chemical shift assignments for alpha-synuclein monomer (WT)	788	X
25228	1H, 13C, and 15N chemical shift assignments for alpha-synuclein (H50Q)	805	X
25229	Solution Structure of the Human FAAP20 UBZ	465	X
25230	Solution Structure of the Human FAAP20 UBZ-Ubiquitin Complex	1504	X
25231	14-3-3 Zeta Backbone Assignment	756	X
25232	Solution structure of the F231L mutant ERCC1-XPF dimerization region	2040	X
25233	NOE-based model of the influenza A virus S31N mutant (19-49) bound to drug 11	7	X
25234	NOE-based model of the influenza A virus M2 (19-49) bound to drug 11	7	X
25235	The solution structure of the FtsH periplasmic N-domain	34	X
25236	ssNMR structure of a designed rocker protein	1	X
25237	Solution NMR Structure of Maltose-binding protein from Escherichia coli, Northeast Structural Genomics Consortium (NESG) Target ER690	2189	X
25238	Solution NMR structure of Human Relaxin-2	420	X
25239	NMR Chemical Shift Assignments of La-RRM1 of La protein.	2153	X
25240	Solution structure of Twinstar from Drosophila melanogastor	1806	X
25241	The N-domain of the AAA metalloproteinase Yme1 from Saccharomyces cerevisiae	886	X
25242	SKELEMIN ASSOCIATION WITH ALFA2B,BETTA3 INTEGRIN: A STRUCTURAL MODEL	4285	X
25243	AN ARSENATE REDUCTASE IN OXIDIZED STATE	1555	X
25244	1H, 15N and 13C resonance assignments of the RRM1 domain of the key post-transcriptional regulator HuR	1184	X
25247	Chemical Shift 1H, 13C, 15N Assignments of FliG bound to unlabeled FliF C-terminal peptide	1103	X
25248	1H, 13C, and 15N Chemical Shift Assignments for the W972R mutant of Arkadia (RNF111) E3 RING domain	427	X
25249	1H, 13C, and 15N Chemical Shift Assignments for the W972A mutant of Arkadia (RNF111) E3 RING domain	421	X
25250	Solution structure of Ovis Aries PrP with mutation delta190-197	1608	X
25251	Solution structure of Ovis Aries PrP with mutation delta193-196	1070	X
25253	Chemical Shifts of Y99E,N111D mutant CaM with iNOS	916	X
25254	Solution structure of the toxin, RhTx	161	X
25255	Denatured state of HIV-1 protease	1772	X
25257	Chemical Shifts of Y99E mutant CaM with eNOS	282	X
25259	NMR structure of hypothetical protein NP_344732.1 from Streptococcus pneumoniae TIGR4	1898	X
25260	Solution structure of human insulin at pH 1.9	526	X
25261	Solution structure of [GlnB22]-insulin mutant at pH 1.9	344	X
25263	NMR assignments of the CUS-3 phage coat protein insertion domain.	1322	X
25264	ctNsa-2 1-84	354	X
25265	Structural insight into an essential assembly factor network on the pre-ribosome	1087	X
25266	Solution structure of decorin binding protein B from Borrelia burgdorferi	1888	X
25267	Backbone 1H, 13C and 15N Chemical Shift Assignments for Human TRIM25 (PRYSPRY) domain	910	X
25268	SpoVM structure determination	283	X
25269	Structure of ASM1	431	X
25270	SpoVM P9A mutant structure	297	X
25271	NMR assignments of the prolyl peptidyl isomerase domain of the ribosome-associated molecular chaperone trigger factor from Escherichia coli	997	X
25272	Backbone 1H, 13C and 15N and 13Ca and 13Cb chemical shift assignment of Bet v 1.0101	694	X
25273	Solution structure of phosphorylated cytosolic part of Trop2	143	X
25274	Solution structure of cytosolic part of Trop2	281	X
25275	Solution structure of eEF1Bdelta CAR domain	491	X
25276	Solution structure of eEF1Bdelta CAR domain in TCTP-bound state	453	X
25277	Solution structure of the lantibiotic self-resistance lipoprotein MlbQ from Microbispora ATCC PTA-5024	1002	X
25278	Backbone chemical shift assignments for the sensor domain of the Burkholderia pseudomallei histidine kinase RisS. Seattle Structural Genomics Center for Infectious Disease target BupsA.00863.i.	399	X
25279	Met e- and Ile d1-methyl 1H and 13C Chemical Shift Assignments for the HECT domain of the human Smurf2 ubiquitin ligase	116	X
25280	1H, 13C, and 15N chemical shift assignments of mouse BMAL1 transactivation domain	558	X
25281	NMR STRUCTURE OF YERSINIA PESTIS AIL (ATTACHMENT INVASION LOCUS) IN DECYLPHOSPHOCHOLINE MICELLES	572	X
25282	Backbone assignment of native and 8M urea-denatured MJ0366	982	X
25283	Solution structure of scoloptoxin SSD609 from Scolopendra mutilans	243	X
25284	Solution Structure of the 3,7-dioxo-octyl Actinorhodin Acyl Carrier Protein from Streptomyces coelicolor	974	X
25285	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Scapharca dimeric hemoglobin (HbI) bound to CO	701	X
25286	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Scapharca dimeric hemoglobin (HbI) in the unliganded state	659	X
25287	Solution Structure of the 5-phenyl-3-oxo-pentyl Actinorhodin Acyl Carrier Protein from Streptomyces coelicolor	1015	X
25288	Solution structure of the TRIM19 B-box1 (B1) of human promyelocytic leukemia (PML)	1168	X
25289	Atomic-resolution 3D structure of amyloid-beta fibrils: the Osaka mutation	568	X
25290	Solid-state NMR 13C and 15N resonance assignments of a seven-transmembrane helical protein Anabaena Sensory Rhodopsin in the E. coli Inner Membrane	249	X
25291	RNA duplex	133			X
25292	HIV-1 reverse transcriptase N terminal 216 residues (Fingers and Palm subdomain)	546	X
25293	Kalata B7 Ser mutant	270	X
25294	NMR structure of the protein NP_809137.1 from Bacteroides thetaiotaomicron	1270	X
25296	Hha-H-NS46 charge zipper complex	235	X
25297	Solution-state NMR structure of the lasso peptide streptomonomicin	173	X
25298	Tetramerization domain of the Ciona intestinalis p53/p73-b transcription factor protein	611	X
25299	Backbone fold of Human Small Ubiquitin like Modifier protein-1 (SUMO-1) based on Prot3D-NMR approach.	917	X
25300	Structure of the bee venom toxin melittin with [(C5H5)Ru]+ fragment attached to the tryptophan residue	196	X
25301	Ig1 domain of human obscurin	419	X
25302	Solution NMR structure of a novel cysteine framework containing Conus peptide Mo3964	401	X
25303	Titin M10 bound to obscurin ig1	158	X
25304	obscurin Ig1 bound to titin M10	152	X
25305	titin M10 domain	404	X
25306	1H, 13C and 15N chemical shift assignments for Oscillatoria agardhii agglutinin	1507	X
25307	solution structure of SATB1 homeodomain	155	X
25308	Chemical shift assignments of human obscurin Ig58	1092	X
25309	FBP28 WW2 , mutation Y438R	218	X
25310	FBP28 WW2 mutant Y446L	222	X
25311	FBP28 WW2 mutant W457F	220	X
25312	SOLUTION STRUCTURE OF HUMAN MBD1 CXXC1 DOMAIN	406	X
25313	FBP28 WW2 mutant Y438R DNDC	173	X
25314	FBP28 WW2 mutant Y238R L453A DNDC	168	X
25315	FBP28 WW2 mutant Y438R DN	204	X
25324	NMR solution structure of ligand-free OAA	1507	X
25325	NMR Chemical Shifts of the hybrid protein Beta-Synuclien HC	526	X
25326	The structure of the carboxy-terminal domain of DNTTIP1	1224	X
25327	Bd0108	628	X
25328	Backbone assignment of the homodimer HUA2 from E.coli	426	X
25329	Backbone Assignment Of the homodimer HUB2 from E.coli at 293K	422	X
25330	Backbone Assignment of the heterodimer HUAB from E. coli at 293K	837	X
25331	Solution structure of Family 1 Carbohydrate-Binding Module from Trichoderma reesei Cel7A with O-mannose residues at Thr1 and Ser3	220	X
25332	Family 1 Carbohydrate-Binding Module from Trichoderma reesei Cel7A with O-mannose residues at Thr1, Ser3, and Ser14	220	X
25333	BILE SALT RECOGNITION BY HUMAN LIVER FATTY ACID BINDING PROTEIN	510	X
25334	Hybrid structure of the Type 1 Pilus of Uropathogenic E.coli	800	X
25335	Backbone and 1H assignments for VG16KRKP, an antimicrobial peptide in LPS	100	X
25336	Backbone assignments for cyclophilin from Geobacillus Kaustophilus with saturating concentrations of the model peptide GSFGPDLRAGD	529	X
25337	Backbone assignments for human Cyclophilin A with saturating concentrations of the model peptide GSFGPDLRAGD	612	X
25338	Backbone assignments for human Cyclophilin B with saturating concentrations of the model peptide GSFGPDLRAGD	638	X
25339	Backbone amide assignments for human Cyclophilin C with saturating concentrations of the model peptide GSFGPDLRAGD	350	X
25340	Backbone assignments for human Cyclophilin D with saturating concentrations of the model peptide GSFGPDLRAGD	591	X
25341	Backbone assignments for human Cyclophilin C	1408	X
25342	NMR structure of the protein YP_193882.1 from Lactobacillus acidophilus NCFM in presence of FMN	1792	X
25343	Talin-F3 / RIAM N-terminal Peptide complex	841	X
25344	Calcium bound calmodulin C-terminal domain, E140Q mutant	849	X
25345	Second calciumbinding domain from P. falciparum CDPK3	413	X
25346	MG200 EAGR box	620	X
25347	Solution structure of 53BP1 tandem Tudor domains in complex with a p53K370me2 peptide	1641	X
25348	Solution structure of 53BP1 tandem Tudor domains in complex with a p53K382me2 peptide	1638	X
25349	Nedd4 WW3	525	X
25350	Solution structure of PsbQ from spinacia oleracea	1710	X
25351	1H, 13C and 15N Chemical Shift Assignments of the H962C mutant from Arkadia (RNF111) E3 RING domain	800	X
25352	Acidocin B	377	X
25353	Backbone 1H and 15N Chemical Shift Assignments for P177A mutant of Adenylate Kinase	396	X
25354	SH3 domain from yeast Abp1p	583	X
25355	EphB2 kinase domain and juxtamembrane segment, S677A/S680A/D754A	1279	X
25356	Thiopurine methyltransferase *1 15-245	802	X
25357	Backbone 1H and 15N Chemical Shift Assignments for Y171W mutant of Adenylate Kinase	400	X
25358	Resonance assignments of the periplasmic domain of a cellulose-sensing trans-membrane anti-sigma factor from Clostridium thermocellum	2128	X
25359	BamA barrel in nanodiscs	81	X
25360	Backbone 1H and 15N Chemical Shift Assignments for P177A mutant of Adenylate Kinase in complex with Ap5a	362	X
25361	Backbone 1H and 15N Chemical Shift Assignments for Y171W mutant of Adenylate Kinase in complex with Ap5a for state a	388	X
25362	Backbone 1H and 15N Chemical Shift Assignments for Y171W mutant of Adenylate Kinase in complex with Ap5a for state b	122	X
25363	1H and 13C chemical shift assignments and structure calculation for crotalicidin in DPC micelles	781	X
25364	Backbone 1H, 13C, and 15N Chemical Shift Assignments drosophila stem-loop binding protein complexed with histone mRNA stem-loop	272	X		X
25365	Backbone 1H, 13C, and 15N Chemical Shift Assignments for drosophila histone mRNA stem-loop-binding protein	166	X
25366	1H and 13C chemical shift assignments for Crotalicidin-Nt in DPC micelles	548	X
25367	Chemical Shifts of the designed Armadillo Repeat Protein YMRRA	765	X
25368	Backbone 1H, 13C and 15N chemical shifts for Staphylococcus aureus EF-GC3, a truncated form of elongation factor G comprising domains III-V.	1195	X
25369	Solution Structure of DNA Dodecamer with 8-oxoguanine at 10th Position.	160		X
25370	1H and 13C chemical shift assignments for crotalicidin-Ct in DPC micelles	527	X
25371	NMR assignments of a novel lectin from sea mussel Crenomytilus grayanus	1571	X
25372	Solution Structure of the Mediator Gall11 KIX Domain of C. Glabrata	1980	X
25375	Assignment of PTP1B bound to the inhibitor CPT-157633	668	X
25376	The RING Domain of human Promyelocytic Leukemia Protein (PML)	599	X
25377	MDMX-P53	585	X
25378	A structure of G-quadruplex	232		X
25379	Resonance assignment of PsbP an extrinsic protein from photosystem II of Spinacia oleracea	2197	X
25380	Solution structure of HP0268 from Helicobacter pylori	867	X
25381	Structure of the E. coli threonylcarbamoyl-AMP synthase TsaC	1993	X
25382	UBX-L domain of VCIP135	1033	X
25383	Backbone chemical shift assignment of human TRAP1-NTD (60-296)	788	X
25384	The Beclin 1 N-terminal Domain (BecN-150CSY)	873	X
25385	NMR assignments of Ssa1 substrate binding domain	2012	X
25386	Chemical shift assignments of Zinc finger Domain of Methionine amino peptidase 1 from Homo sapiens	771	X
25387	Backbone and side-chain 1H, 15N, 13C assignment and secondary structure of BPSL1445 from Burkholderia pseudomallei	1914	X
25389	Backbone 1HN,15N assignments, 15N relaxation data and 3JHNHA coupling constants for wild-type Hydrogenobacter thermophilus cytochrome c552	150	X
25390	Backbone 1HN,15N assignments, 15N relaxation data and 3JHNHA coupling constants for the C10A/C13A variant of Hydrogenobacter thermophilus cytochrome c552	150	X
25391	1H, 15N and 13C resonance assignments of translationally-controlled tumor protein from Nannochloropsis oceanica	1977	X
25393	Backbone 1H, 13C, and 15N Chemical Shift Assignments for IST1 residues 303-366	301	X
25394	complex structure of Dvl PDZ domain with ligand	89	X
25395	Solution structure of the internal EH domain of gamma-synergin	1244	X
25396	assignment of the transmembrane domain of the mouse erythropoietin receptor	431	X
25397	NMR structure of N-terminal domain from A. ventricosus minor ampullate spidroin (MiSp) at pH 7.2	1501	X
25398	NMR structure of N-terminal domain from A. ventricosus minor ampullate spidroin (MiSp) at pH 5.5	1492	X
25399	1H, 15N, 13C resonance assignment of the aortic medial amyloid protein medin.	258	X
25400	Solution structure of firefly light organ fatty acid binding protein (lcFABP)	1501	X
25401	1H, 15N 13C Chemical shift assignments for CCL28	1242	X
25402	Solution structure of the full length sorting nexin 3	2071	X
25403	NMR Structural Mapping Reveals Promiscuous Interactions between Clathrin Box Motif Peptides and the N-Terminal Domain of the Clathrin Heavy Chain	1406	X
25404	Solution structure of VPg of porcine sapovirus	787	X
25405	Solution structure of the C-terminal domain of MvaT	588	X
25406	Titin M10 H56P mutation	152	X
25407	Structure of the DNA complex of the C-Terminal domain of MvaT	750	X	X
25408	NMR resolved structure of VG16KRKP, an antimicrobial peptide in D8PG micelles	93	X
25409	NMR resolved structure of VG16KRKP, an antimicrobial peptide in SDS	93	X
25410	Backbone assignments of a construct of the Sigma-1 receptor spanning residues 35-223	766	X
25411	MPMV MA T41I T78I	1161	X
25413	Lipid-Bilayer-Bound Conformation of an Integral Membrane beta-Barrel Protein by Multidimensional MAS NMR	327	X
25414	Structural features of a 3' splice site influenza A: 11-nt hairpin	107			X
25415	Structural features of a 3' splice site influenza A: 19-nt duplex	154			X
25416	Structural features of a 3' splice site in influenza A: 39-nt hairpin	166			X
25417	NMR resonance assignments of CadC 1-159 from E.coli	1393	X
25418	Human Cytochrome c WT ferric form (oxidized)	393	X
25419	NMR solution structure of -TRTX-Tp1a from the tarantula Thrixopelma pruriens	225	X
25420	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the ferrous form of the G41S mutant of Human Cytochrome c	382	X
25421	NMR structure of spider toxin- G7W/N24S mutant of TRTX-Hhn2b	402	X
25422	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the ferric form of the G41S mutant of Human Cytochrome c	459	X
25423	Solution structure of NDP52 ubiquitin-binding zinc finger	378	X
25424	The solution structure of DEFA1, a highly potent antimicrobial peptide from the horse	148	X
25425	Backbone and side-chain 13C, 15N resonance assignments of artificially disordered FAS 1-4 A546T domain of TGFBIp dissolved in 95 % of DMSO in presence of water	836	X
25426	MBD2 intrinsically disordered region	803	X
25427	DNA/RNA (28-MER)	1026				X
25428	NMR structure of the acidic domain of SYNCRIP (hnRNPQ)	1022	X
25429	42-Residue Beta Amyloid Fibril	103	X
25430	GADD34; PP1-binding domain	518	X
25432	Solution NMR assignment of the 6th TOG domain of minispindles	3252	X
25433	NMR structure of the first Zinc Finger domain of RBM10	407	X
25434	Solution NMR Structure of the OCRE Domain of RBM10	936	X
25435	Structure of Amylase binding Protein A of Streptococcous gordonii: a potential receptor for human salivary amylase enzyme	1808	X
25436	Solution structure of hnRNP C RRM in complex with the 5'-AUUUUUC-3' RNA	1371	X		X
25437	Endo T5-ZN+2	1542	X
25439	Solution structure and 1H, 13C, and 15N chemical shift assignments for Bud31p	1698	X
25440	1H and 113Cd chemical shift assignments for the cysteins and metals of Bud31p Cd3	49	X
25441	Backbone chemical shift assignments for human Rotavirus P[19] VP8* domain of VP4	750	X
25442	Snu17p-Bud13p structure intermediate during RES complex assembly	1688	X
25443	Snu17p-Pml1p structure intermediate during RES complex assembly	1637	X
25445	HN,N,CA,CB assignments of A2A-ct	577	X
25446	solution Structure of KstB-PCP in kosinostatin biosynthesis	930	X
25447	solution Structure of KstB-PCP in kosinostatin biosynthesis	980	X
25448	Solution structure of N-terminal domain of human TIG3	1211	X
25449	Solution structure of RNA recognition motif of a cyclophilin33 - like protein from Plasmodium falciparum	998	X
25451	Solution structure of the dithiolic glutaredoxin 2-C-Grx1 from the pathogen Trypanosoma brucei brucei	1138	X
25452	Omega-Tbo-IT1 selective inhibitor of insect calcium channels isolated from Tibellus oblongus spider venom	361	X
25453	1H, 13C and 15N assignment of the C-terminal domain of human galectin 8	1455	X
25454	Solution structure of a bacterial chaperone	947	X
25455	Backbone, side chain and heme resonance assignments of cytochrome OmcF from Geobacter sulfurreducens	848	X
25456	Cullin3 - BTB interface: a novel target for stapled peptides	134	X
25457	Cullin3 - BTB interface: a novel target for stapled peptides	129	X
25458	NMR structure of an Odin-Sam1 fragment	315	X
25459	Solution structure of Fungus protein Q8J180_MAGGR	817	X
25460	Solution structure of Fungus protein B9WZW9_MAGOR	819	X
25461	Structure of the CUE domain of yeast Cue1	884	X
25462	Backbone Chemical Shift Assignments for the Monomeric [R238A] Mutant of Non-Structural Protein 1 Effector Domain from Influenza B Virus	680	X
25463	Backbone Chemical Shift Assignments for the Wild-Type Dimeric Non-Structural Protein 1 Effector Domain from Influenza B Virus	647	X
25464	Solution structure of an MbtH-like protein from Mycobacterium marinum. Seattle Structural Genomics Center for Infectious Disease target MymaA.01649.c	744	X
25465	ConRlBNQO	191	X
25466	BCL-XL	595	X
25467	Backbone H, N and C assignments for PLAT domain of human polycystin-1, W3128A mutant	543	X
25468	Solution NMR Structure of PDFL2.1 from Arabidopsis thaliana	602	X
25469	Solution structure of hnRNP C RRM in complex with 5'-UUUUC-3' RNA	1321	X		X
25470	Phosphorylation of CB1Cannabinoid Receptor Fourth Intracellular Loop Peptides: Effects on Structure and Function	82	X
25471	Phosphorylation of CB1Cannabinoid Receptor Fourth Intracellular Loop Pepducins: Effects on Structure and Function	75	X
25472	Solution Structure of mu-SLPTX-Ssm6a	233	X
25473	Pcf11 second N-terminal domain	1326	X
25474	NMR structure of Protegrin-3 (PG3) in the presence of DPC micelles	192	X
25475	Structure of Tau(267-312) bound to Microtubules	43	X
25476	Solution NMR structure of Salmonella typhimurium transcriptional regulator protein Crl	1626	X
25477	Solution structure of oxidized triheme cytochrome PpcA from Geobacter sulfurreducens	445	X
25478	Phosphorylation of CB1Cannabinoid Receptor Fourth Intracellular Loop pepducins: Effects on Structure and Function	84	X
25479	Role of a non-canonical surface of Rad6 in ubiquitin conjugating activity	152	X
25481	Backbone 1H, 13C and 15N chemical shift assignment for perforin C2 quad mutant	427	X
25482	Solution structural studies of GTP:adenosylcobinamide-phosphate guanylyltransferase (CobY) from Methanocaldococcus jannaschii	2225	X
25483	Metal Binding of Glutaredoxins	1030	X
25484	Characterization of the p300 Taz2-p53 TAD2 Complex and Comparison with the p300 Taz2-p53 TAD1 Complex	1270	X
25485	NMR Solution Structure of the PRO Form of Human Matrilysin (proMMP-7)	2746	X
25486	Purotoxin-2 NMR structure in water	82	X
25487	Purotoxin-2 NMR structure in DPC micelles	653	X
25488	NMR Solution Structure of the PRO Form of Human Matrilysin (proMMP-7) in Complex with Zwitterionic Membrane	1503	X
25489	NMR Solution Structure of the PRO Form of Human Matrilysin (proMMP-7) in Complex with Anionic Membrane	1509	X
25490	Structure of Conantokin Rl-B	205	X
25491	Structure of Conantokin Rl-B	208	X
25492	NMR structure of the HLTF HIRAN domain in its DNA-bound conformation.	1335	X
25493	Human Med26 N-Terminal Domain (1-92)	1065	X
25494	First and second KH domains of hnRNP E1	1124	X
25495	Structure and dynamics of the acidosis-resistant a162H mutant of the switch region of troponin I bound to the regulatory domain of troponin C	1053	X
25496	NMR structure of the RRM3 domain of Gbp2	1144	X
25497	NMR structure of the RRM1 domain of Hrb1	1036	X
25498	NMR structure of the RRM2 domain of Hrb1	1146	X
25499	NMR structure of the RRM3 domain of Hrb1	1066	X
25500	Backbone chemical shift assignments for the folded/unfolded drkN SH3 protein in the presence of DnaK chaperone at pH 7.2	534	X
25501	Backbone chemical shift assignments for the folded/unfolded drkN SH3 protein at pH 7.2	513	X
25502	Extending the eNOE data set of large proteins by evaluation of NOEs with unresolved diagonals	1749	X
25504	Staphylococcus aureus FusB:EF-GC3 complex.	812	X
25505	CCR5-ECL2 helical structure, residues Q186-T195.	60	X
25506	Synthesis, Characterization and In Vitro Evaluation of New 99mTc/Re(V)-cyclized Octreotide Analogues: An Experimental and Computational Approach	88				X
25507	Synthesis, Characterization and In Vitro Evaluation of New 99mTc/Re(V)-cyclized Octreotide Analogues: An Experimental and Computational Approach	90				X
25508	1H, 13C, and 15N Chemical Shift Assignments and structure of Probable Fe(2+)-trafficking protein from Burkholderia pseudomallei 1710b.	946	X
25509	1H, 13C, 15N chemical shift assignments for APOBEC3G NTD variant, sNTD	753	X
25510	NMR Solution structure of AIM2 PYD from Mus musculus	1061	X
25511	Structure and dynamics of the acidosis-resistant a162H mutant of the switch region of troponin I bound to the regulatory domain of troponin C	182	X
25512	NMR structure of VirB9 C-terminal domain in complex with VirB7 N-terminal domain from Xanthomonas citri's T4SS.	1444	X
25513	SOLUTION STRUCTURE OF THE A147T VARIANT OF THE MITOCHONDRIAL TRANSLOCATOR PROTEIN (TSPO) IN COMPLEX WITH PK11195	1930	X
25514	Solution Structure of the phosphorylated J-domain of Human Cysteine String Protein (CSP)	1155	X
25515	Solution Structure of the non-phosphorylated J-domain of Human Cysteine String Protein (CSP)	1161	X
25516	Design of a Highly Stable Disulfide-Deleted Mutant of Analgesic Cyclic alpha-Conotoxin Vc1.1	129	X
25517	Short hydrophobic peptide, 11mer	20	X
25518	Atomic-resolution structure of alpha-synuclein fibrils	174	X
25519	NMR structure of Neuromedin C in aqueous solution.	115	X
25520	NMR structure of Neuromedin C in 10% TFE	115	X
25521	NMR structure of Neuromedin C in 25% TFE	115	X
25522	NMR structure of Neuromedin C in 40% TFE	112	X
25523	NMR structure of Neuromedin C in 60% TFE	113	X
25524	NMR structure of Neuromedin C in 90% TFE	113	X
25525	NMR structure of Neuromedin C in presence of SDS micelles	115	X
25526	Re-refined solution NMR Structure of the 27 nucleotide engineered neomycin sensing riboswitch RNA-ribostamycin complex	420			X
25527	Chemical shift assignments and structure of the alpha-crystallin domain from human, HSPB5	1076	X
25528	Solution Structure of DNA Dodecamer with 8-oxoguanine at 4th Position	162		X
25529	NMR Solution Structure and Model Membrane Interaction Studies of the Peptide Hylin a1 from the Arboreal South American Frog Hypsiboas albopunctatus	123	X
25530	AQ1974	1049	X
25531	N2-dG-IQ modified DNA at the G1 position of the NarI recognition sequence	156		X
25532	Conformation and dynamics of the Gag polyprotein of the human immunodeficiency virus 1 studied by NMR spectroscopy.	1665	X
25533	1H, 13C and 15N assignments of EGF domains 8 to 11 of human Notch-1	1479	X
25534	RNA structure determination by solid-state NMR spectroscopy	231			X
25535	Further exploration of the conformational space of alpha-synuclein fibrils: Solid-state NMR assignment of a high-pH polymorph	265	X
25536	MDMX-057	1197	X
25537	Backbone 1H, Chemical Shift Assignments for Cn-APM1	39	X
25538	Mdmx-SJ212	1186	X
25539	Three dimensional structure of EPI-X4, a human albumin-derived peptide that regulates innate immunity through the CXCR4/CXCL12 chemotactic axis and antagonizes HIV-1 entry	126	X
25540	NMR structure of the complex between the C-terminal domain of the Rift Valley fever virus protein NSs and the PH domain of the Tfb1 subunit of TFIIH.	1693	X
25541	Solution structure of MyUb (1080-1122) of human Myosin VI	651	X
25542	Solution structure of MyUb (1080-1131) of human Myosin VI	766	X
25543	Solution structure of human Myosin VI isoform3 (998-1071)	901	X
25544	Solution structure of human Myosin VI isoform3 (1050-1131)	1062	X
25545	Complex structure of MyUb (1080-1122) of human Myosin VI with K63-diUb	1999	X
25546	MDMX-295	1162	X
25548	structure of a peptide	207	X
25549	1H, 13C, 15N backbone chemical shift assignments of mouse BMAL2 transactivation domain	166	X
25551	Backbone amide chemical shift assignments of the CN-bound yeast cytochrome c peroxidase covalently cross-linked to yeast iso-1 cytochrome c	458	X
25552	STIL binding to Polo-box 3 of PLK4 regulates centriole duplication - NMR solution structure of human Polo-box 3	540	X
25553	Docked structure between SUMO1 and ZZ-domain from CBP	198	X
25554	NMR solution structure of nucleotide-free Ran GTPase	2589	X
25555	Structure of PvHCt, an antimicrobial peptide from shrimp litopenaeus vannamei	160	X
25556	Solution structure of the MRG15-MRGBP complex	2618	X
25557	Backbone chemical shift assignments for reduced peroxiredoxin Q from the plant pathogen Xanthomonas campestris.	806	X
25558	MAX1 peptide fibril	41	X
25559	Structure of C-terminal domain of human polymerase Rev1 in complex with PolD3 RIR-motif	1172	X
25560	Solution structure of the GBII-beta MRH domain W409A point mutant	1071	X
25561	Structure and assembly of the mouse ASC filament by combined NMR spectroscopy and cryo-electron microscopy	392	X
25562	Structure of the PR domain from PRDM16	2065	X
25564	Structure of the Third Type III Domain from Human Fibronectin	1219	X
25565	Solution structure of the BCOR PUFD	1238	X
25566	Backbone chemical shift assignments for oxidized peroxiredoxin Q from the plant pathogen Xanthomonas campestris	327	X
25567	NMR structure of the apo-form of the flavoprotein YP_193882.1 from Lactobacillus acidophilus NCFM	1636	X
25568	Solution structure of VSTx1	433	X
25569	PIN1 WW domain in complex with a phosphorylated CPEB1 derived peptide	235	X
25570	Structure of the C-terminal membrane domain of HCV NS5B protein	338	X
25571	HIV-1 Core Packaging Signal	695			X
25572	Dad2 C terminal	214	X
25573	NMR Structure of the Myristylated Feline Immunodeficiency Virus Matrix Protein	1001	X
25574	Spatial Structure of Antimicrobial Peptide SmAMP2-2c from Seeds of Stellaria media	243	X
25575	Structure of SAP30L corepressor protein	795	X
25576	Solution structure of human SUMO1	1234	X
25577	Solution structure of human SUMO2	1183	X
25582	structure of a protein	209	X	X
25584	NMR structure of the complex between the PH domain of the Tfb1 subunit from TFIIH and the N-terminal activation domain of EKLF (TAD1)	1660	X
25585	Contryphan-Vc1	347	X
25586	Backbone resonance assignments of the wt NS4A N-terminal domain of DENV in aqueous solution	174	X
25587	Solution structures of Miz-1 zinc fingers 2 to 4	1018	X
25588	Direct attack of vanilloids on the regulation of the pain receptor TRPV1	3289	X
25590	1H, 13C and 15N resonance assignments and second structure information of Fag s 1: Fagales allergen from Fagus sylvatica	1878	X
25591	Solid-state NMR structure of Vpu	159	X
25592	Solution-state NMR structure of Vpu cytoplasmic domain	298	X
25593	Spatial structure of HER2/ErbB2 dimeric transmembrane domain in the presence of cytoplasmic juxtamembrane domains	693	X
25595	NMR Structure of TDP-43 prion-like hydrophobic helix in DPC	312	X
25596	Structure of DNA G-quadruplex adopted by ALS and FTD related GGGGCC repeat with G21 to Br-G21 substitution	166		X
25597	Solution NMR structure of Dynorphin 1-13 bound to Kappa Opioid Receptor	161	X
25598	SOLUTION NMR STRUCTURE OF ASTEROPSIN F FROM MARINE SPONGE ASTEROPUS	306	X
25599	Solution structure of Sds3 in complex with Sin3A	1790	X
25600	Solution structure of LigA4 Big domain	830	X
25601	Ensemble structure the closed state of Lys63-linked diubiquitin in the absence of a ligand	270	X
25602	Tom1 negatively modulates binding of Tollip to phosphatidylinositol 3-phosphate via a coupled folding and binding mechanism	437	X
25603	Structure of murine tumour necrosis factor alpha CDE RNA	387			X
25604	Solution structure of a double base-pair inversion mutant of murine tumour necrosis factor alpha CDE-23 RNA	353			X
25605	NMR solution structure of HsAFP1	475	X
25606	1H, 13C and 15N assignment of HA, HB, HN, CA, CB, C' and N of human Androgen Receptor-4Q	991	X
25607	1H, 13C and 15N assignment of HA, HB, HN, CA, CB, C' and N of human Androgen Receptor-25Q	1139	X
25609	NMR solution structure of RsAFP2	540	X
25610	NMR solution structure of the pheromone Ep-1 from Euplotes petzi	163	X
25611	Solution NMR Structure of DE NOVO DESIGNED PROTEIN (FDA_60), Northeast Structural Genomics Consortium (NESG) Target OR303	1061	X
25612	Solution NMR Structure of DE NOVO DESIGNED Ferredoxin Fold PROTEIN sfr3, Northeast Structural Genomics Consortium (NESG) Target OR358	884	X
25613	Solution structure of [B26-B29 triazole cross-linked]-insulin analogue at pH 1.9	459	X
25614	Solution structure of [B26-B29 triazole cross-linked]-insulin analogue at pH 8.0	371	X
25615	Solution structure of [GlyB24,B27-B29 triazole cross-linked]-insulin analogue at pH 1.9	343	X
25616	Backbone 1H, 13C, and 15N chemical shift assignments for dimeric KaiB from the Thermosynechococcus elongatus BP-1 cyanobacterial species	459	X
25617	Backbone 1H, 13C, and 15N chemical shift assignments for dimeric KaiB in complex with the CI domain of KaiC from the Thermosynechococcus elongatus BP-1 cyanobacterial species	232	X
25618	Backbone 1H, 13C, and 15N chemical shift assignments for N-SasA, the N-terminal domain of SasA, from the Thermosynechococcus elongatus BP-1 cyanobacterial species	333	X
25619	Backbone 1H, 13C, and 15N chemical shift assignments for N-SasA, the N-terminal domain of SasA, in complex with the CI domain of KaiC from the Thermosynechococcus elongatus BP-1 cyanobacterial species	373	X
25620	Backbone 1H, 13C, and 15N chemical shift assignments for the ground state-like fold of the single mutant G89A of dimeric KaiB from the Thermosynechococcus elongatus BP-1 cyanobacterial species	321	X
25621	Backbone 1H, 13C, and 15N chemical shift assignments for the ground state fold of the single mutant D91R of dimeric KaiB from the Thermosynechococcus elongatus BP-1 cyanobacterial species	270	X
25622	Backbone 1H, 13C, and 15N chemical shift assignments for the thioredoxin-like fold of the single mutant D91R of dimeric KaiB from the Thermosynechococcus elongatus BP-1 cyanobacterial species	398	X
25623	Backbone 1H, 13C, and 15N chemical shift assignments for the double mutant G89A,D91R of dimeric KaiB from the Thermosynechococcus elongatus BP-1 cyanobacterial species	441	X
25624	Backbone 1H, 13C, and 15N chemical shift assignments for the double mutant G89A,D91R of KaiB from the Thermosynechococcus elongatus BP-1 cyanobacterial species	497	X
25625	Backbone 1H, 13C, and 15N chemical shift assignments for the double mutant G89A,D91R of KaiB in complex with the CI domain of KaiC from the Thermosynechococcus elongatus BP-1 cyanobacterial species	253	X
25626	Backbone 1H, 13C, and 15N chemical shift assignments for the double mutant G88A,D90R of KaiB from the Synechococcus elongatus PCC 7942 cyanobacterial species	340	X
25627	Solution structure of the meiosis-expressed gene 1 (Meig1)	1132	X
25628	Backbone 1H, 13C and 15N Chemical Shift Assignments for G56C_T163C mutant of Adenylate Kinase at oxidized condition	642	X
25629	Backbone 1H, 13C and 15N Chemical Shift Assignments for G56C_T163C mutant of Adenylate Kinase at reduced condition	816	X
25630	NMR spatial structure of nonspecific lipid transfer protein from the dill Anethum graveolens L.	1089	X
25631	structure of ace-pvhct-nh2	154	X
25632	Tom1 negatively modulates binding of Tollip to phosphatidylinositol 3-phosphate via a coupled folding and binding mechanism	471	X
25634	Fusion to a Highly Stable Consensus Albumin Binding Domain Allows for Tunable Pharmacokinetics	642	X
25636	Solution structure of AVR-Pia	718	X
25638	NMR solution structure of a C-terminal domain of the chromodomain helicase DNA-binding protein 1	1325	X
25639	Solution structure of LEDGF/p75 IBD in complex with POGZ peptide (1389-1404)	1036	X
25640	STRUCTURE OF OXIDIZED HORSE HEART CYTOCHROME C ENCAPSULATED IN REVERSE MICELLES	1196	X
25642	Atomic structure of the cytoskeletal bactofilin BacA revealed by solid-state NMR	617	X
25643	Amino-terminal domain of Latrodectus hesperus MaSp1 with neutralized acidic cluster	1251	X
25645	Chemical Shift Assignments and Structure of HSPB1_ACD	490	X
25646	Backbone chemical shift assignment of rat p75NTR transmembrane and intracellular domains in lipid/protein nanodiscs	468	X
25647	Backbone and sidechain chemical shift assignment of rat p75NTR transmembrane and intracellular juxtamembrane domains in DPC micelles	718	X
25648	Backbone chemical shift assignment of rat p75NTR transmembrane and juxtamembrane intracellular domains in lipid/protein nanodiscs	352	X
25649	Human Brd4 ET domain in complex with MLV Integrase C-term	991	X
25650	Solution structure of RNA recognition motif-1 of Plasmodium falciparum serine/arginine-rich protein 1.	931	X
25651	Isolation and structural characterization of an active G-quadruplex motif from AGRO100	247		X
25652	Structure of PTB RRM1(41-163) bound to an RNA stemloop containing a structured loop derived from viral internal ribosomal entry site RNA	1667	X		X
25653	SOLUTION NMR STRUCTURE OF ASTEROPSIN G FROM MARINE SPONGE ASTEROPUS	307	X
25654	NMR structure of the II-III-VI three-way junction from the VS ribozyme	956			X
25655	NMR structure of the II-III-VI three-way junction from the VS ribozyme and identification of magnesium-binding sites using paramagnetic relaxation enhancement	956			X
25656	NMR Assignments and structure of Translation initiation factor IF-1 from Burkholderia thailandensis E264.	720	X
25657	Proteasome protein fragment	1024	X
25658	NMR STRUCTURE OF A 180 RESIDUE CONSTRUCT ENCOMPASSING THE N- TERMINAL METAL-BINDING SITE AND THE MEMBRANE PROXIMAL DOMAIN OF SILB FROM CUPRIAVIDUS METALLIDURANS CH34	1807	X
25659	Solution Structure of TDP-43 Amyloidogenic Core Region	345	X
25660	NMR structure of the Y48pCMF variant of human cytochrome c in its reduced state	1244	X
25661	1H, 13C, and 15N chemical shift assignments of a the GTP class II RNA aptamer in complex with GTP	676			X
25662	Solution NMR Structure of DE NOVO DESIGNED PROTEIN, Rossmann2x2 Fold, Northeast Structural Genomics Consortium (NESG) Target OR446	1242	X
25663	SOLUTION STRUCTURE OF THE LINK MODULE OF HUMAN TSG-6 IN PRESENCE OF A CHONDROITIN 4-SULFATE HEXASACCHARIDE	1114	X
25664	Solution NMR Structure of DE NOVO DESIGNED PROTEIN Top7NNSTYCC, Northeast Structural Genomics Consortium (NESG) Target OR34	1011	X
25665	1H, 13C, and 15N Resonance Assignments of an Enzymatically Active Domain from the Catalytic Component (CDTa) of a Clostridium difficile Binary Toxin	1241	X
25666	Solution NMR Structure of DE NOVO DESIGNED PROTEIN Top7NNSTYCC, Northeast Structural Genomics Consortium (NESG) Target OR34	1011	X
25667	Solution Structure of the G335D Mutant of TDP-43 Amyloidogenic Core Region	327	X
25668	Solution Structure of the Q343R Mutant of TDP-43 Amyloidogenic Core Region	276	X
25669	Solution structure of a self complementary Xylonucleic Acid duplex	153			X
25670	Solution Structure of Enterocin HF, an Antilisterial Bacteriocin Produced by Enterococcus faecium M3K31	241	X
25671	1H Chemical Shift Assignments of the HIV ISS element	172			X
25672	Base-displaced intercalated structure of the N-(2'deoxyguanosin-8-yl)-3-aminobenzanthrone DNA adduct	184		X
25673	NMR structure for a 3-stranded parallel beta-sheet	172	X
25674	Backbone Assignment of the MALT1 Paracaspase by Solution NMR	1940	X
25675	SOLUTION STRUCTURE OF THE N-TERMINAL DOMAIN OF TDP-43	1013	X
25676	Backbone resonance assignments of the mutant NS4A N-terminal domain	216	X
25677	Solution NMR structure of CBX8 in complex with AF9 (CBX8-AF9)	1036	X
25678	FBP28 WW L453D	230	X
25679	FBP28 WW L453E	224	X
25680	FBP28 WW L453W	233	X
25681	FBP28 WW E454Y	228	X
25682	FBP28 WW T456D	240	X
25683	FBP28 WW T456Y	246	X
25684	SOLUTION STRUCTURE OF THE LIPID DROPLET ANCHORING PEPTIDE OF CGI-58 BOUND TO DPC MICELLES	949	X
25685	Structure of the Transmembrane Electron Transporter CcdA	765	X
25686	Structure of a G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome	209		X
25688	Novel Structural Components Contribute to the High Thermal Stability of Acyl Carrier Protein from Enterococcus faecalis	818	X
25689	1H, 15N and 13C resonance assignments of the C-terminal domain of the TolAIII domain of Vibrio cholerae.	1410	X
25690	NMR structure of the C-terminal region of human eukaryotic elongation factor 1B	1647	X
25691	The solution structure of the kallikrein inhibitor SPINK6	318	X
25692	SOLUTION STRUCTURE OF OVIS ARIES PRP	984	X
25693	Solution structure of a disulfide stabilized XCL1 dimer	716	X
25694	Structure of constitutively monomeric CXCL12 in complex with the CXCR4 N-terminus	1315	X
25696	human CFTR NBD1 deltaRI chemical shift assignments	987	X
25697	human CFTR NBD1 deltaRI I539T mutant chemical shift assignments	1007	X
25698	human CFTR NBD1 deltaRI F508del mutant chemical shift assignments	746	X
25699	Structure of an N-terminal membrane-anchoring region of the glycosyltransferase WaaG	303	X
25700	Solution Structure of R. palustris CsgH	1130	X
25701	Backbone assignments and ILV methyl assignments for EcoRV bound to 16-mer double stranded DNA (GCAAAGATATCTTTCG) without Lu3+	787	X	X
25702	Structures of the reduced and oxidized state of the mutant D24A of yeast thioredoxin 1: insight into the mechanism for the closing of the water cavity	1081	X
25703	Structure of the reduced and oxidized state of the mutant D24A of yeast thioredoxin 1: insight into the mechanism for the closing of the water cavity	1178	X
25704	Solution NMR structure of the lasso peptide chaxapeptin	202	X
25705	Backbone assignment of the N-terminal domain of human respiratory syncytial virus nucleoprotein	1061	X
25706	1H, 13C, and 15N Chemical Shift Assignments of PKS domains	919	X
25707	Methyl resonances of ubiquitin in complex with R0RBR domain (141-465) of parkin	178	X
25708	Methyl and backbone amide resonances of ubiquitin S65E	328	X
25709	Methyl resonances of ubiquitin S65E in complex with R0RBR domain (141-465) of parkin	152	X
25710	Structure of high-density lipoprotein particles	689	X
25711	Chemical shifts of the HLA-B2705 heavy chain in complex with the peptide TIS	753	X
25712	Solution structure of the dehydroascorbate reductase 3A from Populus trichocarpa	1856	X
25713	Chemical shifts of the HLA-B2709 heavy chain in complex with the peptide pVIPR	1482	X
25714	Chemical shifts of the HLA-B2705 heavy chain in complex with the peptide pVIPR	1263	X
25715	Chemical shifts of the HLA-B2709 heavy chain in complex with the peptide TIS	1359	X
25716	PltL-holo	1148	X
25717	PltL-pyrrolyl	1061	X
25718	Regnase-1 N-terminal domain	600	X
25719	Regnase-1 Zinc finger domain	338	X
25720	Regnase-1 C-terminal domain	744	X
25721	1H, 15n, 13C chemical shifts assignments of VirA DD in complex with VirFGDD	475	X
25722	Unveiling the structural determinants of KIAA0323 binding preference for NEDD8	231	X
25723	Universal Base oligonucleotide structure	152		X
25724	Universal base control oligonucleotide structure	149		X
25725	Solution structure of cystein-rich peptide jS1 from Jasminum sambac	179	X
25726	cFLIP-derived R4 peptide	71	X
25727	1H, 13C, and 15N Chemical Shift Assignments for Histamine-Binding Protein (D24R) bound to histamine	908	X
25728	1H, 13C, and 15N Chemical Shift Assignments for Histamine-Binding Protein (D24R) apo	860	X
25729	Spatial structure of EGFR transmembrane and juxtamembrane domains in DPC micelles	724	X
25730	1H, 15N and 13C backbone assignments of GDP-bound human H-Ras mutant G12V	802	X
25731	Ensemble Solution structure of the phosphoenolpyruvate-Enzyme I complex from the bacterial hosphotransferase system	190	X
25732	Solution structure of the cyanobacterial cytochrome b6f complex subunit PetP	973	X
25734	TBK1 recruitment to cytosol-invading Salmonella induces anti-bacterial autophagy	622	X
25735	The selective autophagy receptor TAX1BP1 is required for autophagy-dependent capture of cytosolic Salmonella typhimurium	678	X
25736	TBK1 recruitment to cytosol-invading Salmonella induces anti-bacterial autophagy	337	X
25737	The NMR solution structure of octyl-tridecaptin A1 in DPC micelles	81	X
25738	Synthesis, Characterization and In Vitro Evaluation of New 99mTc/Re(V)-cyclized Octreotide Analogues: An Experimental and Computational Approach	83				X
25739	Synthesis, Characterization and In Vitro Evaluation of New 99mTc/Re(V)-cyclized Octreotide Analogues: An Experimental and Computational Approach	84				X
25740	C-terminal domain of Cdc37 cochaperone	1020	X
25741	Solution NMR structure of octyl-tridecaptin A1 in DPC micelles containing Gram-negative lipid II	79	X
25742	TBK1 recruitment to cytosol-invading Salmonella induces anti-bacterial autophagy	347	X
25743	Backbone and side-chain NMR assignments for the Bromodomain of mouse BAZ1A (ACF1)	1165	X
25744	NMR structure and dynamics of the resuscitation promoting factor RpfC catalytic domain	749	X
25745	Structure of the N-terminal domain of the metalloprotease PrtV from Vibrio cholerae	985	X
25746	G-quadruplex structure	114		X
25748	ddFLN5+110	597	X
25749	C4VG16KRKP	101	X
25750	NMR Structure of the C-terminal Coiled-Coil Domain of CIN85	657	X
25751	Disulphide linked homodimer of designed antimicrobial peptide VG16KRKP	102	X
25752	Backbone assignments and ILV methyl assignments for EcoRV bound to 16-mer double stranded DNA (GCAAAGATATCTTTCG) with Lu3+	779	X	X
25753	NMR Structure of sweeter mutant (D40K) of sweet protein Brazzein	562	X
25754	Astexin1	227	X
25755	NMR structure of non-sweet mutant (ins18RI19) of sweet protein Brazzein	577	X
25756	Backbone Assignment of the Tyrosine Kinase Src Catalytic Domain	898	X
25757	NMR structure of a human calmodulin / rat connexion-36 peptide hybrid	1575	X
25758	NMR structure of the de-novo toxin Hui1	279	X
25759	Solution structure for quercetin complexed with c-myc G-quadruplex DNA	57		X
25760	NMR structure of the 140-315 fragment of the N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	2041	X
25761	NMR structure of a DUF1491 family protein (CC_1065) from Caulobacter crescentus CB15	1177	X
25762	Structure of Pleiotrophin	1280	X
25763	Solution structure of an MbtH-like protein from Mycobacterium avium, Seattle Structural Genomics Center for Infectious Disease target MyavA.01649.c	619	X
25764	NMR structure for a 2-stranded parallel beta-sheet	120	X
25765	NMR structure for a 2-stranded parallel beta-sheet	121	X
25766	Solution structure of Zmp1, a zinc-dependent metalloprotease secreted by Clostridium difficile	2373	X
25767	NMR structure of the Vta1NTD-Did2(176-204) complex	2177	X
25768	Solution NMR structure of Outer Membrane Protein G from Pseudomonas aeruginosa	920	X
25769	Structural elucidation of the frog skin-derived peptide Esculentin-1a[Esc(1-21)NH2] in Lipopolysaccharide and correlation with their function	120	X
25770	N-terminal domain of the telomerase catalytic subunit Est2 from Ogataea polymorpha	1495	X
25771	1H assignment at 288K of Cementoin	266	X
25772	1H assignment of Elafin at 288K	388	X
25773	1H, 13C, 15N assignments of Trappin-2	1148	X
25774	Chemical Shift Assignments and Structure Determination for spider toxin, U4-agatoxin-Ao1a	346	X
25775	Structure of spider-venom peptide Hm1a	356	X
25776	Solution NMR structure of Outer Membrane Protein G P92A mutant from Pseudomonas aeruginosa	798	X
25777	Solution NMR structure of Tetrahymena telomerase RNA pseudoknot	264			X
25778	Chemical shift assignments and structure calculation of spider toxin U4-hexatoxin-Hi1a	904	X
25779	Partial 1H, 13C and 15N backbone resonance assignments for the carboxy-terminal RNA recognition motif of Plasmodium falciparum Ser/Arg-rich protein 1	273	X
25780	Structure of CssA4 (bottom stem) of CssA thermometer	308			X
25781	NMR Assignment and NMR Structure of CssA3 (top stem) of CssA thermometer	312			X
25782	Astexin2-dC4	189	X
25783	Astexin3	228	X
25784	NMR Assignment and structure of CssA Thermometer from Neisseria meningitidis	344			X
25785	NMR Assignment and structure of CssA5 (middle region) of CssA thermometer from Neisseria meningitidis	254			X
25786	Solution structure of holo ArCP from yersiniabactin synthetase	1032	X
25787	Solution structure of the salicylate-loaded ArCP from yersiniabactin synthetase	1003	X
25788	Two-fold symmetric structure of the 18-60 construct of S31N M2 from Influenza A in lipid bilayers	399	X
25789	NMR structure of CmPI-II, a serin protease inhibitor isolated from mollusk Cenchitis muricatus	495	X
25790	Solution structure of regulatory protein	880	X
25791	Solution structure of kinase in complex with its regulatory protein	1807	X
25792	p65dd	505	X
25793	Solution Structure of the RNA-Binding domain of non-structural protein 1 from the 1918 H1N1 influenza virus	840	X
25796	NMR solution structure of a complex of PEP-19 bound to the C-domain of apo calmodulin	1258	X
25797	The structural and functional effects of the Familial Hypertrophic Cardiomyopathy-linked cardiac troponin C mutation, L29Q	926	X
25798	NMR structure of human I-type lectin domain	1778	X
25799	NMR structure of human I-type lectin domain-glycan complex	1819	X			X
25800	Solution structure of Plasmodium falciparum SR1-RRM1 in complex with ACAUCA RNA	856	X		X
25801	UBL domain of the human DNA damage-inducible protein homolog 2	994	X
25802	Resonance assignments of [15N, 13C] human DCL-1 (CD302) extracellular domain	1740	X
25803	UBL domain of the yeast DNA damage-inducible protein homolog 1	1063	X
25804	muO-conotoxin MfVIA	341	X
25805	Structure of the cyclic nucleotide-binding homology domain of the hERG channel	1478	X
25806	NMR structure of the prolactin receptor transmembrane domain	440	X
25807	Sidechain chi1 distribution in B3 domain of protein G from extensive sets of residual dipolar couplings	510	X
25808	Unveiling the structural determinants of KIAA0323 binding preference for NEDD8	238	X
25809	1H, 13C, 15N assignments of W60G mutant of human beta2-microglobulin	971	X
25810	NMR structure of the N-domain of troponin C bound to the switch region of troponin I and the covalent levosimendan analog i9.	1145	X
25811	NMR-SAXS/WAXS Structure of the core of the U4/U6 di-snRNA	60			X
25813	NMR structure of Peptide PG-989 in DPC micelles	74	X
25814	NMR Structure of Peptide PG-990 in DPC micelles	74	X
25816	Solution structure of PDZ domain	950	X
25817	Structure of the transmembrane domain of human nicastrin in SDS micelles	434	X
25818	Structure of the transmembrane domain of human nicastrin in DPC micelles	419	X
25819	Solution Structure of Leptospiral LigA4 Big Domain	790	X
25820	NMR structure of Peptide PG-992 in DPC micelles	80	X
25821	1H, 13C and 15N backbone resonance assignments for the class A beta-lactamase BlaP from Bacillus licheniformis 749/C	753	X
25825	UBL protein	1177	X
25826	solution structure of microRNA 20b pre-element	328			X
25827	Backbone 1H, 13C, and 15N chemical shift assignments for metal-binding domain 1 of ATP7B	792	X
25828	RIP2 CARD	1280	X
25829	p75NTR DD:RhoGDI	2848	X
25830	Solution Structure of Lipid Transfer Protein From Pea Pisum Sativum	1098	X
25831	solution structure of the complex of microRNA 20b pre-element with Rbfox RRM	1519	X		X
25832	NMR assignment of CPR3 from Saccharomyces cerevisiae	1807	X
25833	p75NTR DD:RIP2 CARD	2315	X
25834	Solution structure of the FHA domain of TbPar42	2078	X
25835	NMR structure of OtTx1a - AMP in DPC micelles	444	X
25836	NMR structure of OtTx1a - ICK	475	X
25837	Chemical shift assignment, NMR constraints and PDB for chromodomain 3 (CD3) of cpSRP43	717	X
25838	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the C-terminal intrinsically disordered domain of Alb3	351	X
25839	THE STRUCTURE OF KBP.K FROM E. COLI	1879	X
25840	Tetrameric i-motif structure of dT-dC-dC-CFL-CFL-dC at acidic pH	51		X
25844	CYSTEIN KNOT WITH INTEGRIN AVB6 CANCER RECOGNITION SITE	67	X
25845	CYSTEIN KNOT WITH 2FP INTEGRIN AVB6 CANCER RECOGNITION SITE	67	X
25846	In silico designed antimicrobial peptide Lavracin	152	X
25847	three-dimensional structure of cyclic PVIIA	360	X
25848	Chemical shift assignments and structure calculation of spider toxin pi-hexatoxin-Hi1a	876	X
25849	NMR Structure of the homeodomain transcription factor Gbx1[E17R,R52E} from Homo sapiens	836	X
25850	Solution NMR Structure of Designed Protein DA05, Northeast Structural Genomics Consortium (NESG) Target OR626	1245	X
25851	TRIM24 PHD-Bromo dual-domain backbone assignment	793	X
25852	Structure and 15N relaxation data of Calmodulin bound to the endothelial Nitric Oxide Synthase Calmodulin Binding Domain Peptide at Physiological Calcium Concentration	1525	X
25853	Chemical Shift Assignments and Structure Determination for spider toxin, U33-theraphotoxin-Cg1c	845	X
25854	Zipcode-binding-protein-1 KH3KH4(DD) domains in complex with the RNA target CACACCC	1344	X		X
25855	Zipcode-binding-protein-1 KH3(DD)KH4 domains in complex with the RNA target UCGGACU	1344	X		X
25856	Solution structure of translation initiation factor from Staphylococcus aureus Mu50	712	X
25857	NMR Solution Structure of Lacticin Q and Aureocin A53	403	X
25858	Solution Structure of Lacticin Q and Aureocin A53	391	X
25859	Productive complex between MMP-12 and synthetic triple-helical collagen, revealed through paramagnetic NMR	1753	X
25860	Backbone resonance assignments for S. aureus DHFR complexed with NADPH and Trimethoprim	723	X
25861	Backbone resonance assignments for S. aureus DHFR complexed with NADPH	648	X
25863	Adenylate cyclase toxin RTX domain from Bordetella pertussis	1199	X
25864	Solution Structure of the rNedd4 WW1 Domain by NMR	408	X
25865	Solution Structure of the rNedd4 WW2 Domain-Cx43CT Peptide Complex by NMR	420	X
25866	Solution Structure of the rNedd4 WW2 Domain by NMR	376	X
25867	An NMR/SAXS structure of the PKI domain of the honeybee dicistrovirus, Israeli acute paralysis virus (IAPV) IRES	58			X
25868	Solution NMR Structure of Designed Protein DA05R1, Northeast Structural Genomics Consortium (NESG) Target OR690	1208	X
25869	Solution structure of LptE from Pseudomonas Aerigunosa	1766	X
25870	Holo form of Calmodulin-Like Domain of Human Non-Muscle alpha-actinin 1	1690	X
25871	Apo form of Calmodulin-Like Domain of Human Non-Muscle alpha-actinin 1	1660	X
25872	TrkA transmembrane domain NMR structure in DPC micelles	468	X
25873	Free RSK1 683-735 peptide	88	X
25874	A key amino acid in the control of different functional behavior within the triheme cytochrome family from Geobacter sulfurreducens	495	X
25875	Backbone assignment of Calcium loaded C-terminus of Troponin C isoform 2	627	X
25877	Solution structure of cecropin P1 with LPS	346	X
25878	Holo N-terminal TnC F2 backbone assignment	883	X
25879	Backbone assignment of Apo C-terminal F2-TnC	326	X
25880	Backbone assignment of N-terminal fragment of F2-TnC from Lethocerus	424	X
25881	Chemical shift assignment of yeast Hit1 protein zinc finger	962	X
25882	Structural basis for DNA cleavage by the potent antiproliferative agent (-)-lomaiviticin A	163		X
25883	DD homodimer	969	X
25885	RBM24 RRM domain	1262	X
25886	Solution structure of acyl carrier protein LipD from Actinoplanes friuliensis	1059	X
25887	Solution structure of the SLURP-2, a secreted isoform of Lynx1	866	X
25888	1H, 13C and 15N chemical shift assignments and solution structure for PARP-1 F1F2 domains in complex with a DNA single-strand break	1564	X	X
25889	1H, 13C and 15N chemical shift assignments for PARP-1 F1F2 domains (at 200mM NaCl)	382	X
25890	1H chemical shift assignments for 45 nucleotide DNA dumbbell (model for single-strand break with one-nucleotide gap)	340		X
25891	1H, 13C and 15N chemical shift assignments for PARP-1 F1F2F3 domains in complex with a DNA single-strand break	1018	X	X
25892	1H, 13C and 15N chemical shift assignments for PARP-1 F1F2F3 domains	1014	X
25893	1H, 13C and 15N chemical shift assignments for PARP-1 F3 domain	1801	X
25894	1H and 15N chemical shift assignments for PARP-1 F1F2F3 domains in complex with PARP-1 WGR domain and a DNA single-strand break	888	X	X
25895	1H, 13C and 15N chemical shift assignments for PARP-1 WGR domain	818	X
25896	Backbone Assignment of Apo Troponin C from Lethocerus Indicus	749	X
25897	Holo F2 TnC	935	X
25898	3D Structure of Decoralin-NH2 by Solution NMR	97	X
25899	Solution NMR Structure of Antiparallel Myosin-10:GCN4 Tandem Coiled-Coil	1714	X
25900	NRAS Isoform 5	150	X
25901	Structure of SUMO-2 bound to phosphorylated RAP80 SIM.	392	X
25902	actinin-1 EF hand 3,4 Bound to Cav1.2 IQ Motif	755	X
25903	Glucose as non natural nucleobase	212		X
25904	Sequence-specific 1H, 13C, and 15N backbone resonance assignment of the monomeric 2-Deoxy-D-ribose-5-phosphate aldolase (DERA) mutant (K58E-Y96W)	995	X
25905	Solution structure of the bromodomain of Trypanosoma brucei Bromodomain Factor 2(BDF2)	905	X
25906	Glucose as a nuclease mimic in DNA	235		X
25907	solution structure of reduced human cytochrome c	1339	X
25908	Solution structure of oxidized human cytochrome c	1320	X
25909	1H, 13C, and 15N Chemical Shift Assignments for in vitro GB1	697	X
25910	1H, 13C, and 15N Chemical Shift Assignments for in-cell GB1	596	X
25911	VG16KRKP solution structure in C.neoformans live cells	82	X
25912	Backbone 1H, 13C, and 15N Chemical Shift of bacterial IscA protein	527	X
25913	Solution structure of RNF126 N-terminal zinc finger domain	482	X
25914	Solution structure of RNF126 N-terminal zinc finger domain in complex with BAG6 Ubiquitin-like domain	1546	X
25915	Photoswitchable G-quadruplex	82		X
25916	Novel antimicrobial peptide PaDBS1R1 designed from the ribosomal protein L39E from Pyrobaculum aerophilum using bioinformatics	228	X
25917	ProTx-II	335	X
25918	Solution NMR structure of Erythrobacter litoralis PhyR response regulator REC domain	1601	X
25919	LC3 FUNDC1 complex structure	1620	X
25920	Structure of the Integrin alphaIIb-beta3(A711P) Transmembrane Complex	429	X
25921	NMR assignment of the 65-residue-long inactivating factor of glutanmine synthetase I from cyanobacterirum Synechocystis sp. PCC 6803	572	X
25922	Solution structure of K1 lobe of double-knot toxin	262	X
25923	ULD complex	1151	X
25924	Drosha Quad	721	X
25925	Chemical shift assignments of rv3053c from Mycobacterium tuberculosis in the oxidized state	1019	X
25926	NMR Structure of KR-12: A minimalized domain derived from the human cathelicidin LL-37	103	X
25927	Curli secretion specificity factor CsgE W48A/F79A mutant	1333	X
25928	NMR solution structure of vitamin B12 conjugates of PYY3-36	214	X
25929	Transmembrane domain of mouse Fas/CD95 death receptor	102	X
25930	Transmembrane domain of human Fas/CD95 death receptor	99	X
25931	Transmembrane Structure of the Cytokine Receptor Common Subunit beta	204	X
25932	Transmembrane Structure of the P441A Mutant of the Cytokine Receptor Common Subunit beta	202	X
25933	NSD1-PHD_5-C5HCH tandem domain structure	1038	X
25934	Nizp1-C2HR zinc finger structure	304	X
25935	Membrane-bound mouse CD28 cytoplasmic tail	544	X
25939	Solution structure of K2 lobe of double-knot toxin	200	X
25941	NMR Structure of retro-KR-12: A reversed sequence of a minimalized domain derived from human cathelicidin LL-37	99	X
25942	Full-length WT SOD1 in DPC MICELLE	1158	X
25943	3D NMR solution structure of NLRP3 PYD	987	X
25944	Solution structure of AVR3a_60-147 from Phytophthora infestans	1125	X
25945	The NMR Structure of the Cdc42-interacting region of TOCA1	1322	X
25946	Structural insights into interaction of KYE28 and lipopolysachharide	201	X
25947	Solution structure of KYE28A in lipopolysachharide	183	X
25948	Ex-4[1-16]/pl14a	161	X
25949	Ex-4[1-27]/pl14a	242	X
25950	1H, 13C, and 15N chemical shift assignments of the mannose-bound lectin from Ralstonia solanacearum	465	X
25951	1H, 13C, and 15N chemical shift assignments of the fucose-bound lectin from Ralstonia solanacearum	922	X
25952	1H, 13C, and 15N chemical shift assignments of the free lectin from Ralstonia solanacearum	448	X
25953	Structure of CCHC zinc finger domain of Pcf11	825	X
25954	Bt1.8 peptide	90	X
25955	Solution structure of reduced and zinc-bound RsrA	980	X
25956	Solution structure of oxidised RsrA and without zinc ion	1100	X
25957	Structure of D19S variant of the Penicillium Antifungal Protein (PAF)	450	X
25958	p63/p73 hetero-tetramerisation domain	2706	X
25959	nigellin-1.1	347	X
25961	Solution structure of Q388A3 PDZ domain	952	X
25962	NMR solution structure of PawS Derived Peptide 9 (PDP-9)	103	X
25963	NMR solution structure of PawS Derived Peptide 10 (PDP-10)	100	X
25964	Structure of human islet amyloid polypeptide in complex with an engineered binding protein	1040	X
25965	Solution structure of N-terminal extramembrane domain of SH protein	163	X
25966	Solution structure of C-terminal extramembrane domain of SH protein	331	X
25967	Solution structure of ZitP zinc finger	481	X
25968	NMR resonance assignments of the apple allergen Mal d 1.0101	1680	X
25969	Solution NMR structure of the DNA-binding type IV pilin ComP from Neisseri subflava	1427	X
25970	NMR structure of the Acidic domain of SYNCRIP (24-140)	1382	X
25971	Resonance assignments and structure determination of poneritoxin, omega-PONTX-Ae1a, from Anochetus emarginatus	158	X
25972	Solution structure of V26A mutant of Ubiquitin at pH 6.0	779	X
25973	Solution structure of V26A mutant of Ubiquitin at pH 2.0	768	X
25974	Structure of calcium-bound form of Penicillium antifungal protein (PAF)	350	X
25975	Structure and Dynamics of the Geobacillus stearothermophilus IF2 G3-subdomain	1165	X
25976	Solution structure of the HYD1 hydrophobin from Schizophyllum commune	1044	X
25979	protein complex	1509	X
25982	Peptide model of 4-stranded beta-arch.	215	X
25983	Solution NMR structure of ligand free sterol carrier protein 2 like 2 from Aedes aegypti	1217	X
25984	Solution NMR structure of palmitated SCP2L2 from Aedes aegypti	1213	X
25985	NMR Structure of the C-Terminal Domain of human APOBEC3B	2228	X
25986	Solution structure of the F87M/L110M variant of transthyretin in the monomeric state	1116	X
25987	Solution structure of the T119M variant of transthyretin in its monomeric state	1293	X
25988	BAZ2B PHD	266	X
25989	1H, 13C, and 15N Chemical Shift Assignments of HAdV E1A243 (E1A 12S)	1658	X
25990	1H, 13C, and 15N Chemical Shift Assignments of HAdV E1A289 (E1A-13S)	906	X
25991	1H, 13C, and 15N Chemical Shift Assignments of HAdV E1ACR3 (E1A CR3)	527	X
25992	Backbone and Side Chain Chemical Shift Assignments for the myosin IIA fragment 1893-1937 (MPT)	428	X
25993	The Solution Structure of Human gammaC-crystallin	1844	X
25994	Backbone 1H, 13C, and 15N Chemical Shift Assignments for designed protein E_1r26	1008	X
25995	Protein complex	1645	X
25996	Solution structure of the J-K region of EMCV IRES	90			X
25997	Solution structure of the J domain of EMCV IRES	297			X
25998	Solution structure of the K domain of EMCV IRES	343			X
25999	Solution structure of the St domain of EMCV IRES	352			X
26000	Solution structure of the delta-J-delta-K domain of EMCV IRES	274			X
26001	Structure, Dynamics and functional Aspects of the antifungal protein sfPAFB	583	X
26002	HIGH RESOLUTION SOLUTION NMR STRUCTURE OF THE SPIDER VENOM PEPTIDE U3-SCYTOTOXIN-STH1A	379	X
26003	HIGH RESOLUTION SOLUTION NMR STRUCTURE OF THE SPIDER VENOM PEPTIDE U3-SCYTOTOXIN-STH1H	651	X
26004	HIGH RESOLUTION SOLUTION NMR STRUCTURE OF THE SPIDER VENOM PEPTIDE U5-SCYTOTOXIN-STH1A	651	X
26005	Solution Structure of N-Allosylated Pin1 WW Domain	228	X
26006	Solution Structure of N-Galactosylated Pin1 WW Domain	231	X
26007	Solution Structure of N-Xylosylated Pin1 WW Domain	231	X
26008	Solution Structure of N-L-idosylated Pin1 WW Domain	230	X
26009	Antimicrobial peptide protegrin PG-5	119	X
26010	NMR structure of the Mycobacterium tuberculosis LppM (Rv2171) protein folded domain.	1682	X
26011	Apo solution structure of Hop TPR2A	1672	X
26012	Structural Model for the N-terminal Domain of Human Cdc37	1399	X
26016	Solution Structure of Ca2+-bound C2 domain from Protein Kinase C alpha in the form of complex with V5-pHM peptide	1719	X
26021	Sr33 Coiled-coil domain	1491	X
26022	Solution structure of translation initiation factor IF1 from wolbachia endosymbiont strain TRS of Brugia malayi	1078	X
26024	RNA Bulge Loop that Specifically Binds Metal Ions	273			X
26025	1H, 13C, and 15N Chemical Shift Assignments for Q4DY78	1275	X
26026	Solution Structure of the PriC DNA replication restart protein	1496	X
26027	Chemical shift assignment of the natively disordered N-terminus (= NORS, residues 1-75) of M. tuberculosis protein kinase G (PknG)	306	X
26028	Chemical shift assignment of residues 1-147 of M. tuberculosis protein kinase G (PknG) including the natively disordered N-terminus and the reduced, metal bound rubredoxin-like domain	633	X
26029	Chemical shift assignment of the oxidized, unfolded rubredoxin-like domain (= RD, residues 74-147) of M. tuberculosis protein kinase G (PknG)	242	X
26030	Chemical shift assignment of the reduced, metal bound rubredoxin-like domain (= RD, residues 74-147) of M. tuberculosis protein kinase G (PknG)	387	X
26031	Solution structure of BOLA3 from Homo sapiens	1040	X
26032	Structural insights of r(CGG) motif found in Fragile X Syndrome and Fragile-X associated tremor/ataxia syndrome (FXTAS) at 45 degree C	38			X
26033	Structural insight for dynamics of r(CGG) motif RNA found in Fragile X syndrome/ Fragile X tremor ataxia at 25 degree C	42			X
26034	NMR assignment and structure of a peptide derived from the membrane proximal external region of HIV-1 gp41 in the presence of dodecylphosphocholine micelles	381	X
26035	NMR assignment and structure of a peptide derived from the membrane proximal external region of HIV-1 gp41 in the presence of hexafluoroisopropanol	593	X
26036	KYE21 structure in LPS micelles	157	X
26037	RWS21 structure in LPS	153	X
26038	WWWKYE21 structure in LPS	181	X
26040	Solution structure of pseudin-2 analog (Ps-P)	164	X
26041	Solution NMR structures of BRD4 ET domain in complex with NSD3_1 peptide	1074	X
26042	Solution NMR structures of BRD4 ET domain with LANA peptide	1130	X
26043	Solution NMR structures of BRD4 ET domain in complex with NSD3_3 peptide	1057	X
26044	1HN, 13C, and 15N Resonance Assignments of the CDTb-Interacting Domain (CDTaBID) from the Clostridium difficile Binary Toxin Catalytic Component (CDTa, residues 1-216)	1044	X
26045	Solution structure of the de novo mini protein HHH_06	507	X
26046	Solution structure of the de novo mini protein EEH_04	399	X
26047	Lysine dimethylated FKBP12	1394	X
26048	1H, 13C, 15N backbone and side-chain resonance assignment of Nostoc sp. C139A variant of the heme nitric oxide/oxygen binding (H-NOX) domain	1669	X
26049	STRUCTURE OF DK17 IN GM1 LUVS	114	X
26050	STRUCTURE OF DK17 IN POPC:POPG:CHOLESTEROL:GM1 LUVS	116	X
26051	STRUCTURES OF DK17 IN TBLE LUVS	113	X
26052	Solution structure of MapZ extracellular domain first subdomain	1535	X
26053	Solution structure of MapZ extracellular domain second subdomain	1216	X
26054	NMR structure of omega-agatoxin IVA in DPC micelles	346	X
26055	Solution Structure of BMAP-28(1-18)	158	X
26056	SOLUTION STRUCTURE OF HELATX1	128	X
26057	Solution Structure of Mutant of BMAP-28(1-18)	190	X
26058	Backbone 1H, 13C, and 15N Chemical Shift Assignments for a 58 truncated variant of the CI repressor from the temperated bacteriophage Tp901-1	480	X
26059	Solution NMR structures of AF9 yeats domain in complex with histon H3 acetylation at K18	1803	X
26060	Solution NMR structures of AF9 yeats domain in complex with histone H3 crotonylation at K18	1795	X
26061	NMR solution structure of MAL/TIRAP TIR domain	1185	X
26062	Solution structure of the toxin ISTX-I from Ixodes scapularis	403	X
26063	20 lowest energy ensemble of dermcidin (DCD1L) NMR structure	360	X
26064	NMR solution structure of PawS Derived Peptide 22 (PDP-22)	148	X
26065	NMR solution structure of PawS Derived Peptide 21 (PDP-21)	129	X
26066	NMR solution structure of PawS Derived Peptide 20 (PDP-20)	151	X
26068	Structure of DNA-binding HU protein from micoplasma Mycoplasma gallisepticum	508	X
26069	Toward the real-time monitoring of HPV-16 E7 phosphorylation events	205	X
26300	The structure of SeviL, a GM1b/asialo-GM1 binding R-type lectin from the mussel Mytilisepta virgata	579	X
26301	Crystal structure of higher plant heme oxygenase-1 and the mechanism of interaction with ferredoxin	358	X
26307	Sensitivity-Enhanced Solid-state NMR Detection of Structural Differences and Unique Polymorphs in Pico- to Nanomolar Amounts of Brain-derived and Synthetic 42-residue Amyloid-b Fibrils.	356	X
26308	Dual-Cex	250	X
26309	Backbone 1H, 15N, and 13C resonance assignments of the Phafin2 PH domain	671	X
26312	Ufm1	779	X
26314	Backbone 1H, 13C, 15N and Side chain CB Chemical Shift Assignments for Paip2A	525	X
26315	Backbone 1H, 15N and HA Chemical Shift Assignments for Paip2A(25-83)	140	X
26316	Backbone 1H, 13C, 15N, HA and Side chain 13C Chemical Shift Assignments for RRM2 of PABPC1	553	X
26317	Backbone 1H, 13C, 15N, HA and Side Chain 13C Chemical Shift Assignments for RRM3 of PABPC1	553	X
26318	Backbone 1H, 13C, 15N and CB Chemical Shift Assignments for RRM2/3	678	X
26319	Backbone 1H, 13C, 15N and CB Chemical Shift Assignments for RRM2/3 when in complex with 12mers of adenine	452	X		X
26320	Backbone 1H, 13C, and 15N Chemical Shift Assignments for RRM2/3 in complex with Paip2A(25-83)	318	X
26321	Backbone resonance assignment of a LysM domain of a chitinase-A from Equisetum arvense	242	X
26322	Backbone 1H, 13C, and 15N Chemical Shift Assignment for Tid1 e-JD	454	X
26323	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Paip2A(25-83) in complex with RRM2/3	194	X
26328	Backbone assignment of the N-terminal SH2 domain of PI3K	501	X
26329	Backbone assignment of the N terminal SH2 domain of PI3K bound to CD28 derived phosphopeptide	520	X
26331	Backbone 1H, 13C, and 15N Chemical Shift Assignments for tyrosine kinase A domain 5	357	X
26333	Chemical shift assignments of the fusion protein consisting of the C-terminal deleted hepatitis B virus X protein BH3-like motif peptide and Bcl-xL	2122	X
26334	NMR chemical shift assignments for melittin in methanol	196	X
26335	1H, 13C, and 15N chemical shift assignments of a minimal trimeric Rec114-Mei4 complex	1187	X
26336	Solution Structure of the Corynebacterium diphtheriae SpaB	1369	X
26509	Backbone resonance assignments and secondary structure determination for the human PHF6-ePHD1	1317	X
26512	Thermal stability of chicken brain a-spectrin repeat 17: a spectroscopic study	25	X
26517	TAM DOMAIN OF TIP5_BAZ2A	1287	X
26518	NMR solution structure of the putative transfer protein TraH from Gram-positive conjugative plasmid pIP501	1635	X
26526	UBCH10	637	X
26527	WHB	400	X
26528	UBCH10 in complex with WHB	639	X
26529	WHB in complex with UBCH10	397	X
26530	NMR assignment of intrinsically disordered self-processing module of FrpC protein of Neisseria meningitidis	1222	X
26531	Human Eosinophil-Derived Neurotoxin	487	X
26532	Assignment of the BeF3-activated PmrA response regulator from Klebsiella pneumoniae	1376	X
26534	Backbone and side chain 1H, 13C, and 15N chemical shift assignments for Extracellular Loop 1 (ECL1) of FtsX in Streptococcus pneumoniae	1448	X
26535	Assignment of the BeF3-activated PmrA response regulator from Klebsiella pneumoniae in complex with the promoter DNA	1199	X
26536	Short hydrophobic peptides with cyclic constraints are po-tent GLP-1R agonists.	20	X
26537	Short hydrophobic peptides with cyclic constraints are po-tent GLP-1R agonists.	20	X
26538	Short hydrophobic peptides with cyclic constraints are po-tent GLP-1R agonists.	21	X
26541	Backbone Chemical Shift Assignment of the FimH lectin domain from Escherichia coli	874	X
26543	Type III Secretion Protein	746	X
26544	Prostate associated gene 4 (PAGE4) Wild Type	824	X
26545	Prostate associated gene 4 (PAGE4) phosphorylated	840	X
26546	Type III Secretion Protein	734	X
26547	STIL binding to the Polo-box 3 of PLK4 regulates centriole duplication - Backbone assignment of human Polo-box 3 bound to STIL	294	X
26548	Solid-state NMR sequential assignments of the N-terminal domain of HpDnaB helicase	611	X
26549	Backbone 1H, 13C and 15N assignment of the intrinsically disordered region of HCV protein NS5A (191-447)	1357	X
26550	Sequence-specific solid-state NMR assignments of the mouse ASC PYRIN domain in its filament form	484	X
26551	Backbone resonance assignments of the human p73 DNA binding domain	923	X
26552	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Plasmodium falciparum Immune Mapped Protein 1 (PfIMP1)	1925	X
26553	Solution Structure of the Smarc Domain	1271	X
26554	Chemical shift assignments of K2 dehydrin in the presence of SDS micelles	427	X
26557	Disordered monomeric alpha-synuclein in 20 mM HEPES buffer (pH 7)	464	X
26558	Chemical shift assignments of the fibronectin III like domains 7-8 of type VII collagen	1918	X
26562	NMR assignments of the dust mite allergen Der p 23 from Dermatophagoides pteronyssinus	387	X
26564	Y-family polymerase Dbh (dinB homolog) from Sulfolobus acidocaldarius 1H, 15N, and 13C chemical shifts	2388	X
26565	Backbone 1H, 13C, and 15N Chemical Shift Assignments for human Notch1 Transmembrane Domain Segment.	229	X
26568	The structure of the SOLE element of oskar mRNA	532			X
26569	Backbone chemical shift assignments for TCR_3c8m_t55a	1024	X
26570	Backbone and sidechain 1H, 13C and 15N chemical shifts for human superoxide dismutase (hSOD1) lacking bound metal and the intrasubunit disulfide bond	1511	X
26571	1H, 13C and 15N NMR assignments of a calcium-binding protein(EhCaBP6) from Entamoeba histolytica	1063	X
26573	Tom1 negatively modulates binding of Tollip to phosphatidylinositol 3-phosphate via a coupled folding and binding mechanism	236	X
26574	Tom1 negatively modulates binding of Tollip to phosphatidylinositol 3-phosphate via a coupled folding and binding mechanism	447	X
26575	Gli3_1_90 assignment	428	X
26576	1H, 15N, resonance assignment of the aortic medial amyloid protein medin in non-denaturing conditions.	88	X
26577	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Light-adapted Cyanobacteriochrome NpR6012g4	1834	X
26578	NMR Assignment of Homo sapiens cytochrome c in its oxidized state	211	X
26579	Resonance assignment of the N-terminal domain of hLCN2-R	685	X
26580	Structure of herpesvirus nuclear egress complex subunit M50	2074	X
26582	1H, 15N, and 13C Chemical Shift Assignments of the Dark-state Cyanobacteriochrome (NpR6012g4)	1929	X
26583	Backbone 1H, 13C and 15N chemical shift assignments for the ternary L28F ecDHFR:TETRAHYDROFOLATE:NADP+ complex	531	X
26584	Backbone 1H, 13C and 15N chemical shift assignments for the ternary L28F ecDHFR:FOLATE:NADP+ complex	507	X
26585	Backbone 1H, 13C and 15N chemical shift assignments for the binary L28F ecDHFR:NADPH complex	528	X
26586	15N, 13C and 1H backbone resonance assignments of TEM-1(M68L-M69T)	953	X
26587	Backbone chemical shifts of Roquin ROQ domain in complex with Ox40 stem-hexa-loop RNA	584	X		X
26588	Backbone chemical shifts of Roquin ROQ domain in complex with a Selex-derived stem-hexa-loop RNA motif	275	X		X
26589	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the yeast ADP/ATP carrier 3	1181	X
26590	15N, 13C and 1H backbone resonance assignments of cTEM-19m	877	X
26591	NMR Characterization of the Type III Secretion System Tip Chaperone Protein PcrG of Pseudomonas aeruginosa	294	X
26592	The LcrG tip chaperone protein of the Yersinia pestis type III secretion system is partially folded	319	X
26593	Human Obscurin Ig59	1006	X
26594	Backbone 15N, 1HN, 13CA, 13CB and 13C' Chemical shift Assignments for the DNA-binding domain of Human Telomeric Repeat Binding Factor Protein (hTRF1)	237	X
26595	Backbone 1H, 13C and 15N chemical shift assignments for hTRF1 bound to ADP-DnaK	204	X
26597	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the N-terminal active domain of the gyrase B subunit of Pseudomonas aeruginosa	1065	X
26598	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the N-terminal active domain of the gyrase B subunit of Pseudomonas aeruginosa with an inhibitor	1072	X
26599	1H, 13Ca, 13Cb and 15N chemical shift assignment of coiled-coil motif from human Thanatos-associated protein 11	262	X
26600	Backbone 1H, 13C, 15N chemical shift assignments for T cell receptor N15 beta subunit	976	X
26601	Backbone 1H, 13C, 15N chemical shift assignments for T cell receptor N30 beta subunit	1020	X
26602	Backbone 1H, 13C, 15N chemical shift assignments for T cell receptor D10 beta subunit	938	X
26603	Sequence-specific 1H, 15N, and 13C resonance assignments of the autophagy-related protein LC3C	1676	X
26604	Protein resonance assignment at MAS frequencies approaching 100 kHz: a quantitative comparison of J-coupling and dipolar-coupling-based transfer methods	335	X
26605	Methyl resonances of Ubiquitin-like domain (1-76) of parkin in complex with R0RBR domain (141-465) of parkin.	120	X
26607	Neisseria meningititis Fic	868	X
26608	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the active domains of the type II topoisomerases from Pseudomonas aeruginosa	1015	X
26609	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the active domains of the type II topoisomerases from Pseudomonas aeruginosa with a bis-pyridylurea inhibitor	1020	X
26610	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the active domains of the type II topoisomerases from Streptococcus pneumoniae	1098	X
26611	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the active domains of the type II topoisomerases from Streptococcus pneumoniae with a bis-pyridylurea inhibitor	1094	X
26612	Transmembrane domain of E. coli OmpA in 8 m Urea	823	X
26613	Periplasmic chaperone Skp from E. coli in 8 m Urea	699	X
26614	Solid-state NMR assignment of MxiH (serotype 5a) T3SS needles	456	X
26615	Backbone resonance assignments for rat SUR2A NBD1	1170	X
26616	1H, 13C and 15N Chemical Shift Assignments for human CBP-ID4	972	X
26617	Backbone Assignments for non-selective ion channel NaK tetramer	355	X
26618	Resonance assignment of DVU2108 that is part of the Orange Protein complex in Desulfovibrio vulgaris Hildenborough	1219	X
26619	Amide/Methyl/Aromatic Chemical Shifts and Order Parameters of Free Barnase	641	X
26620	Amide/Methyl/Aromatic chemical shift and order parameter of Barnase-dCGAC	438	X	X
26623	Backbone 1H, 13C, and 15N chemical shift assignments for integrin beta3 transmembrane and cytoplasmic tail domains	324	X
26624	integrin beta1 transmembrane and cytoplasmic domain	324	X
26625	PH domain of the Arf GAP ASAP1	197	X
26626	Backbone 1H, 13C and 15N resonance assignments for CaM-Fas-6-35 complex	570	X
26627	Backbone 1H, 13C and 15N resonance assignments for CaM-Fas-47-83 complex	838	X
26628	assignment of HuR RRM1-2	306	X
26629	SPOP-MATH	531	X
26630	Protein G Domain Beta-1 Wild Type	277	X
26631	SPOP_MATH_PUC complex	633	X
26632	Protein G Domain Beta-1 Sequence H	281	X
26634	Backbone and sidechain 1H, 13C, and 15N resonance assignments for Methylobacterium extorquens PqqD	1139	X
26635	Backbone 1H, and 15N Chemical Shift Assignments for human K-Ras4B-GDP	342	X
26636	1H and 15N Chemical Shifts of Intrinsically Disordered Dehydrin ERD14 at Various Temperature and pH Values	1832	X
26637	Backbone assignments of dengue virus NS4B N-terminal region	1069	X
26638	Backbone and side chain chemical shift assignments of apolipophorin III from Galleria mellonella	1638	X
26639	1H, 13C and 15N Chemical Shift Assignments for human CBP-ID4	969	X
26640	1H, 15N and 13C chemical shift assignment of the alpha-crystallin domain and the C-terminal domain in human alpha-B crystallin oligomers.	441	X
26641	Backbone assignments for E. coli MurD	742	X
26642	Backbone 1H, 13C and 15N Chemical Shift Assignments for the Plakin Repeat Domain of Envoplakin	930	X
26643	Backbone 1H, 13C, and 15N chemical shift assignments for the N-WASP-GBD Nck complex	488	X
26644	Backbone assignment of the N-terminal 24-kDa fragment of Escherichia coli topoisomerase IV ParE subunit	1016	X
26645	Backbone 1H, 15N, 13C NMR assignment of the 518-627 fragment of the androgen receptor encompassing N-terminal and DNA Binding domains	517	X
26646	A Novel MHC-I Surface Targeted for Binding by the MCMV m06 Immunoevasin Revealed by Solution NMR	846	X
26647	NFkB p65 DNA-binding domain	946	X
26648	FVO Plasmodium falciparum AMA1	839	X
26649	1H, 13C, 15N chemical shift assignments of initiation factor 1 from Pseudomonas aeruginosa	799	X
26650	SIX3_HD	741	X
26651	1H, 13C, and 15N assignments of the Pleckstrin Homology Domain of Akt1.	391	X
26652	1H, 13C, and 15N assignments of the Pleckstrin Homology Domain of Akt1 bound to Calmodulin.	262	X
26653	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Nogo-A-Delta20	759	X
26654	1H, 13C and 15N resonance assignments of the intrinsically disordered region of the nuclear envelope protein emerin	494	X
26655	1H, 13C and 15N resonance assignments of the intrinsically disordered region of the nuclear envelope protein emerin	394	X
26656	Backbone 1H, 13C, 15N Chemical Shift Assignments for Full-length HIV-1 Transactivator of Transcription	646	X
26657	Resonance Assignment of MERS-CoV macro domain	1640	X
26658	Backbone 1H, 13C, and 15N Chemical Shift Assignments for SczA from Streptococcus agalactiae	775	X
26659	1H, 13C, and 15N Chemical Shift Assignments for SRC in the sugar-free state	1323	X
26660	1H, 13C, and 15N Chemical Shift Assignments for SRC in the lactose-bound state	1597	X
26661	1H, 13C, and 15N Chemical Shift Assignments for SRC in the 6'-sialyllactose-bound state	1665	X
26662	Backbone 1H, 13C and 15N Chemical Shift Assignments for c-Myc-1-88	382	X
26663	Backbone 1H, 13C and 15N Chemical Shift Assignments for c-Myc-1-88, pS62	390	X
26664	UBXD1	465	X
26672	Backbone 1H, 13C (C, CA, CB), and 15N Chemical Shift Assignments for the low complexity prion-like domain of Fused in Sarcoma (FUS 1-163)	698	X
26674	Structural basis for the inhibition of voltage-gated sodium channels with conotoxin-muOxi-GVIIJ	296	X
26675	Structural basis for the inhibition of voltage-gated sodium channels with conotoxin-muOxi-GVIIJ	183	X
26676	1H, 13C, and 15N Chemical Shift Assignments for the redox-stable inhibitor of SPSB2-iNOS interaction - CP1	91	X
26677	1H, 13C, and 15N Chemical Shift Assignments for redox-stable cyclic peptide inhibitors of SPSB2-iNOS interaction - CP2	80	X
26678	Backbone resonance assignments of Abeta(1-42) in aqueous trifluoroethanol	165	X
26679	Backbone resonance assignments of pyroglutamate Abeta(3-42) in 50 % trifluoroethanol	159	X
26680	backbone resonance assignment of pEAbeta(3-42) in 40 % trifluoroethanol	293	X
26681	Chemical shifts of ApoCaM1234 (CaM D20A, D56A, D93A, D129A)	1137	X
26682	Chemical shifts of ApoCaM12 (CaM D20A, D56A)	286	X
26683	Chemical shifts of ApoCaM34 (CaM D93A, D129A)	276	X
26684	Chica 410-478	333	X
26685	Chemical shifts of calcium saturated CaM12 (CaM D20A, D56A)	288	X
26686	Chemical shifts of calcium saturated CaM34 (CaM D93A, D129A)	270	X
26687	Chemical shifts of calcium saturated CaM34 (CaM D93A, D129A) with the iNOS CaM-binding domain peptide	1445	X
26688	Backbone 1H, 13C, and 15N Chemical Shift Assignments of Guanylyl Cyclase Activator Protein 1 (GCAP1) mutant V77E in a Ca2+-free/Mg2+-bound Activator State	584	X
26689	The chemical shifts (partial) of E. coli DnaC N-terminal domain	544	X
26690	Backbone and sidechain 1H, 13C, and 15N resonance assignments for Methylobacterium extorquens PqqD + PqqA	1154	X
26691	Chemical shift assignment of yeast Bcd1 protein zinc finger	1036	X
26692	Solid State NMR sequential assignment of Amyloid b(1-42) fibrils	213	X
26693	Backbone resonance assignments for apo S. aureus DHFR	470	X
26694	Backbone resonance assignments for S. aureus S1 DHFR complexed with NADPH and Trimethoprim	724	X
26695	Backbone resonance assignments for S. aureus S1 DHFR complexed with NADPH	669	X
26697	Denatured CSE4 Protein from Saccharomyces cerevisiae	1998	X
26698	Backbone 1H, 13C, and 15N Chemical Shift Assignments for rNedd4 WW3 Domain	411	X
26700	Backbone assignment of Sam68 STAR domain	288	X
26701	T-STAR KH domain	202	X
26702	Partial assignments of full-length (deltaAH)-NS5A protein from Hepatitis C Virus (Con1) produced in wheat germ cell-free system	763	X
26703	RDPheH25-117	293	X
26705	Backbone chemical shifts of the oligomerization inhibited mutant of the CASKIN2 SAM domain tandem	588	X
26706	Backbone 13C, and 15 N Chemical Shift Assignments for fibrillar Islet Amyloid Polypeptide (IAPP)	146	X
26708	Backbone Assignment of Human NEMO residues 258-350	298	X
26709	Backbone Assignment of Human linear diubiquitin	519	X
26715	beta-endorphin	230	X
26716	Backbone HN, 15N, 13Ca shifts for GB1 in 0%, 10%, 25%, 50% ionic liquid [C4-mim]Br, and KBr	883	X
26717	Backbone and side-chain 1H, 13C, and 15N chemical shift assignments for the lytic polysaccharide monooxygenase NcLPMO9C	2283	X
26718	Domain Swapped HIV RNase H	483	X
26719	Backbone and triple resonance 1H, 13C, and 15N Chemical Shift Assignments for residues 420-500 of Saccharomyces cerevisiae transcription factor Ash1	335	X
26720	Backbone and triple resonance 1H, 13C, and 15N Chemical Shift Assignments for residues 420-500 of Saccharomyces cerevisiae transcription factor Ash1 when 10 fold phosphorylated	353	X
26721	RXFP1-LDLa linker	396	X
26722	1H, 15N, 13C backbone shift assignments of PhyR protein from Erythrobacter litoralis	1006	X
26723	NMR chemical shift assignments for the C-terminal domain of Tetrahymena Tcb2 in the absence of calcium	1228	X
26724	NMR chemical shift assignments for the C-terminal domain of Tetrahymena Tcb2 in the presence of calcium	1242	X
26725	MtRpsA_S4	1133	X
26726	Backbone 1H, 15N, and 13C resonance assignments of the Extracellular Adherence Protein Domain 4	365	X
26727	1H, 13C and 15N assignment for the C-terminal domain of human Doublecortin	634	X
26728	An NMR chemical shift assignment strategy for prone-to-aggregate intrinsically disordered proteins: a case study of the C-terminal domain of TDP-43	680	X
26730	Structural and dynamics studies of Pax5 reveal asymmetry in stability and DNA binding by the Paired domain	705	X
26731	Structural and dynamics studies of Pax5 reveal asymmetry in stability and DNA binding by the Paired domain	694	X	X
26732	Methyl 1H, 13C Chemical Shift Assignments for MAPK p38g	464	X
26733	Backbone 1H, 13C, and 15N Chemical Shift Assignments for MAPK p38g	1317	X
26734	D53S/D55S variant of Penicillium Antifungal Protein, PAF	410	X
26735	LdcI Assocating Domain of RavA Backbone Assignment	581	X
26738	1H, 13C, and 15N Chemical Shift Assignments for Ca2+-bound human mS100A9	1201	X
26739	NMR Identification of the Binding Surfaces Involved in the Salmonella and Shigella Type III Secretion Tip-Translocon Protein-Protein Interactions	456	X
26740	1H, 13C, and 15N Chemical Shift Assignments for C-terminal intrinsically disordered cytosolic fragment of ErbB2	2694	X
26741	Backbone and Partial Side-Chain Chemical Shift Assignments and Dynamics Measurements for The Catalytic Domain of Human Prolyl Hydroxylase Domain 2 (PHD2) With Zn(II) and 2-Oxoglutarate (2OG)	930	X
26742	Backbone and Partial Side-Chain Chemical Shift Assignments and Dynamics Measurements for The Catalytic Domain of Human Prolyl Hydroxylase Domain 2 (PHD2) With Zn(II), 2-Oxoglutarate (2OG) and Hypoxia Inducible Factor-alpha (HIF-alpha) Peptide	883	X
26743	EeCentrocin 1 Heavy Chain	335	X
26744	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the m1A22 tRNA methyltransferase TrmK from Bacillus subtilis	1104	X
26745	Backbone 1H, 13C, and 15N assignments for Sortase C1 (SrtC1) from Streptococcus pneumoniae	841	X
26746	Backbone resonance assignment of an inhibitory G-alpha domain	1527	X
26748	NMR study of Met-1 Human Angiogenin - 1H, 13C, 15N backbone and side chain resonance assignment	1295	X
26750	Cytochrome P450 MycG	1135	X
26751	Backbone NMR assignments of the 2B4 T-cell receptor.	1391	X
26752	Backbone 1H, 13C and 15N resonance assignments of the OB domain of the single stranded DNA binding protein hSSB1 (NABP2/OBFC2B)	582	X
26753	NMR study of non-structural proteins - 1H, 13C, 15N resonance assignment of macro domain of Venezuelan equine encephalitis virus (VEEV) in complex with ADP-ribose	1860	X
26754	BAZ2A PHD	266	X
26755	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the intrinsically disordered NHE1 distal tail	607	X
26756	1H, 13C, 15N backbone and 1H, 13C methionine methyl chemical shifts of human wildtype Glucocorticoid receptor Ligand Binding Domain	944	X
26757	1H, 13C, 15N backbone and 1H, 13C methionine methyl chemical shifts of human F602S Glucocorticoid receptor Ligand Binding Domain	753	X
26758	Backbone 1H, 13C, and 15N Chemical Shift Assignments for p38 gamma MAPK	799	X
26759	Backbone resonance assignments for the SET domain of the human methyltransferase NSD2	962	X
26760	1H, 13C and 15N NMR assignments of an unusual Ca2+-binding protein from Entamoeba histolytica in its apo form	1231	X
26761	Backbone assignment of the Xylanase B2 from Streptomyces lividans	739	X
26762	Elk1 C-terminus aa309-429	515	X
26763	1H, 13C, and 15N backbone chemical shift assignments of StAR-related lipid transfer domain protein 6 (STARD6) bound to testosterone	1010	X
26764	Backbone 1H, 13C, and 15N Chemical Shift Assignments for hTRF1 in urea	291	X
26765	NMR backbone 1H, 13C and 15N chemical shift assignments of human S-phase kinase-associated protein 1 (Skp1)	1720	X
26766	1H, 13C and 15N backbone resonance assignment for the 40.5 kDa catalytic domain of Ubiquitin Specific Protease 7 (USP7)	1441	X
26767	Backbone 1H, 15N and 13C assignments of the catalytic domain of human NSD1	1036	X
26768	1H, 15N and 13C backbone assignments of the catalytic domain of human NSD2	1041	X
26769	1H, 13C and 15N resonance assignments for the response regulator CheY3 from Rhodobacter sphaeroides	1396	X
26770	CP12 reduced state	815	X
26771	Backbone and Side-chain chemical shift assignments of C. elegans TDP2 Ubiquitin Association domain	608	X
26772	Chemical shift assignments of PfEMP1 ATSCore - variant PFF0845c	403	X
26773	Chemical shift assignments of Spectrin repeat a17	732	X
26774	1H, 13C, and 15N Resonance Assignments for the Ribosomal Protein S1 280-438 from Mycobacterium tuberculosis	1873	X
26775	Backbone and side chain 1H, 13C, and 15N Chemical Shift assignments for Plasmodium falciparum SUMO.	1004	X
26776	1H, 13C and 15N resonance assignments for the response regulator CheY3 from Rhodobacter spheroids at pH 7.25 with BeF3-	1432	X
26777	1H, 13C and 15N resonance assignments for the response regulator CheY3 from Rhodobacter spheroids at pH 4.5 with BeF3-	1501	X
26778	1H, 13C and 15N resonance assignments for the response regulator CheY3 from Rhodobacter spheroids at pH 4.5 in the absence of BeF3-	1456	X
26779	Human Cdc25B complete catalytic domain: backbone assignments (1H, 13CA, 13CB, 13C', 15N), 15N relaxation times (T1 and T2), heteronuclear NOEs and residual dipolar couplings (NH)	753	X
26780	Chemical Shift Assignments for Interleukin-36alpha	1819	X
26782	Backbone 1H, 13C, and 15N Chemical Shift Assignments for human USP7 in complex with ICP0 from HSV-1	937	X
26783	APC11 binding Ubiquitin Variant	381	X
26784	Ubiquitin Variant in complex with APC11	370	X
26785	APC11 in complex with Ubiquitin Variant	326	X
26786	Elk1 C-terminus aa309-429 - 8 phosphorylated sites (pS337-pT354-pT364-pT369-pS384-pS390-pT418-pS423)	506	X
26787	Backbone 1H, 13C, and 15N Chemical Shift Assignments for human RIT1	674	X
26788	1H, 13C and 15N backbone resonance assignments and 15N relaxation data of the PDZ tandem of Whirlin	1080	X
26789	1H, 13C and 15N resonance assignments for the response regulator CheY3 from Rhodobacter sphaeroides at pH 7.3 in the absence of Mg2+	1199	X
26790	1H Chemical Shift Assignments for AvBD7	323	X
26791	Backbone 1H, 13C, and 15 N Chemical Shift Assignment for human Langerin CRD	860	X
26792	Backbone assignment of p23 GOLD domain	324	X
26793	Backbone assignment of p24 GOLD domain	181	X
26794	NMR Assignment of L-Dfp6,D-Trp8-SRIF	92	X
26795	NMR Assignment of L-Dfp7,D-Trp8-SRIF	92	X
26796	NMR Assignment of L-Dfp11,D-Trp8-SRIF	90	X
26797	NMR Assignment of L-Dfp6,L-Msa7,D-Trp8-SRIF	91	X
26798	NMR Assignment of L-Dfp11,L-Msa7,D-Trp8-SRIF	82	X
26799	NMR Assignment of L-Dfp6,L-Msa7,D-Trp8, L-Dfp11-SRIF	87	X
26800	Resonance assignments of a VapC family toxin from Clostridium thermocellum	1775	X
26801	1H, 13C and 15N Assignment of NFU1 Iron-Sulfur Cluster Scaffold Homolog from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR2876	2256	X
26802	Cold Shock Protein A	900	X
26803	Recombinant human carcinoembryonic antigen related cell adhesion molecule 1 (hCEACAM1) N-terminal Igv domain	413	X
26804	POTRA1-5 backbone amide chemical shift assignments	638	X
26805	13C,15N chemical shifts of human Aquaporin-1	951	X
26806	Chemical Shift Assignment of Tom1 VHS Domain	628	X
26807	The DNA-binding domain of the human Egr-1 in the free state	1027	X
26808	Egr-1 - DNA complex	1017	X	X
26809	Xenopus laevis Nucleoplasmin Tail domain assigned chemical shifts	414	X
26810	Backbone Chemical Shift Assignment of LIN54 residues 586 to 646.	303	X
26811	13C Chemical shifts of free backbone carbonyls in bovine rhodopsin and Meta II	11	X
26812	13C Chemical Shifts rhodopsion	24	X
26813	13C Chemical Shifts - Metarhodopsin II	24	X
26814	Backbone 1H, 13C, and 15N chemical shift assignments for Protein Tyrosine Phosphatase 1B residues 1-284	889	X
26815	Backbone and Methyl chemical shift assignments for Hsc70-1-386	2356	X
26816	The intrinsically disordered domain of TDP-43 in the presence of 8 M urea	681	X
26818	1H, 13C and 15N backbone and side chain chemical shift assignments of CHIP-TPR	1330	X
26819	1H, 13C and 15N backbone and side chain chemical shift assignments of CHIP-TPR	604	X
26820	Lunasin assignment (truncated form 16-43)	559	X
26821	apoTrpR	725	X
26822	Backbone 1H, 13C, and 15N Chemical Shift Assignments of Human integrin alpha1 I domain mutant E317A	807	X
26823	Backbone 1H, 13C, and 15N Chemical Shift Assignments, HNHA scalar coupling, and 15N backbone relaxation data for TDP-43 C-terminal domain wild type	1238	X
26824	Lunasin assignment (reduced form)	920	X
26825	Lunasin assignment (oxidized form)	916	X
26826	Backbone 1H, 13C, and 15N Chemical Shift Assignments for TDP-43 C-terminal domain ALS-associated variant A321G	527	X
26827	Backbone 1H, 13C, and 15N Chemical Shift Assignments for TDP-43 C-terminal domain ALS-associated variant A321V	528	X
26828	Backbone 1H, 13C, and 15N Chemical Shift Assignments for TDP-43 C-terminal domain engineered variant A326P	526	X
26829	Backbone 1H, 13C, and 15N Chemical Shift Assignments for TDP-43 C-terminal domain ALS-associated variant Q331K	528	X
26830	Backbone 1H, 13C, and 15N Chemical Shift Assignments for TDP-43 C-terminal domain ALS-associated variant M337V	528	X
26831	Backbone 1H, 13C, and 15N Chemical Shift Assignments for TDP-43 C-terminal domain engineered variant M337P	526	X
26832	Backbone 1H, 13C, and 15N Chemical shift assignments for Protein Tyrosine Phosphatase 1B YAYA (Y152A, Y153A) variant.	986	X
26833	Backbone 1H, 13C, and 15N Chemical Shift Assignments for alpha-N Catenin C-terminal domain	1175	X
26834	N-terminal domain of chicken (gallus gallus) PARP-3	839	X
26835	Backbone 1H, 13C, 15N Chemical shift assignments for Protein Phosphatase 1B T178A variant	960	X
26836	Backbone 1H, 13C, and 15N chemical shift assignments for Protein Tyrosine Phosphatase 1B L192A variant	943	X
26837	Backbone 1H, 13C, and 15N chemical shift assignments for Protein Tyrosine Phosphatase 1B N193A variant.	933	X
26838	Backbone 1H, 13C, and 15N chemical shift assignments for Protein Tyrosine Phosphatase 1B (1-301) in complex with TCS401	878	X
26839	Resonance assignments of the charge assembly helix from the murine leukemia virus	508	X
26840	'1H, 13C, and 15N Chemical Shift Assignments for the periplasmic domain of GacS histidine-kinase'	1684	X
26841	Chemical shift assignment of CBP-ID3	2835	X
26842	NMR resonance assignments for the tetramethylrhodamine binding RNA aptamer 3 in complex with the ligand 5-carboxy-tetramethylrhodamine	957			X
26843	Backbone 1H, 13C, and 15N Chemical Shift Assignments for NCP15 nucleocapsid	683	X
26844	NMR assignments for the insertion domain of bacteriophage Sf6 coat protein	1335	X
26846	Backbone assignments of the full length Dengue Virus NS4B protein in micelles	1159	X
26847	Backbone 1H, 13C, and 15N chemical shift assignments for Protein Tyrosine Phosphatase 1B N193A variant in complex with TCS401	819	X
26848	1H, 15N, 13C backbone resonance assignments of human soluble catechol O-methyltransferase in complex with 3,5-dinitrocatechol and S-adenosyl-L-methionine	1051	X
26849	Spy (29-124)	434	X
26850	Im7_6-45	365	X
26851	1H, 15N, 13C backbone resonance assignments of human soluble catechol O-methyltransferase in complex with 3,5-dinitrocatechol and Sinefungin	1047	X
26852	Partial Backbone 1H, 13C, and 15N Chemical Shift Assignments for VirB8 from Brucella suis	708	X
26853	Identification and structural characterization of LytU	1536	X
26854	AsLOV2 (Avena sativa phototropin 1, LOV2 domain)	1776	X
26855	phosducin chemical shift	754	X
26857	Backbone 1H, 15N assignments of lipoprotein signal peptidase in complex with globomycin	841	X
26858	Backbone chemical shift assignments for the U1 protein from the Bas-Congo virus. Seattle Structural Genomic Center for Infectious Disease target RhbaA.18619.a.D16.	822	X
26860	Tunicate_EDTA_noCa2+	385	X
26861	Tunicate_crystallin_Ca2+form	383	X
26862	Stress Response Peptide-2; Manduca Sexta	148	X
26863	ScribPDZ4apo	340	X
26864	ScribPDZ4withp22phoxC10	164	X
26866	SNX27 PDZ domain	468	X
26867	HADDOCK model of the complex between the KIX domain of CBP and the transactivation domain of p65	1230	X
26870	NMR chemical shifts of the N-terminal SH3 domain from CT10-Regulator of Kinase (Crk)-II	1060	X
26871	Backbone 1H, 13C, and 15N chemical shift assignment for Dpo4 binary complex with DNA	1627	X
26873	Backbone assignment of NS2B-NS3 Protease from Zika Virus	1069	X
26874	Roseltide rT1	160	X
26875	Backbone chemical shift assignments of H24N mutant of Vibrio cholerae peptidyl-tRNA hydrolase	914	X
26876	Backbone chemical shift assignments of N14D mutant of Vibrio cholerae peptidyl-tRNA hydrolase	912	X
26877	Backbone chemical shift assignments of N72D mutant of Vibrio cholerae peptidyl-tRNA hydrolase	926	X
26878	Backbone chemical shift assignments of N118D mutant of Vibrio cholerae peptidyl-tRNA hydrolase	916	X
26879	Solid-state NMR 13C and 15N chemical shift assignments for AL-09 VL immunoglobulin light chain fibrils	242	X
26880	1H, 13C and 15N backbone assignments of the R3 domain of talin (residues 781-911) carrying four mutations T809I, T833V, T867V and T901I (R3-IVVI)	681	X
26881	Backbone 1H, 15N assignment for LC3B	202	X
26882	Dual-targeting anti-angiogenic cyclic peptides as potential drug leads for cancer therapy	218	X
26883	HIV-1 Capsid-SP1 in immature virus-like particles	419	X
26884	Backbone assignment of Rhea (talin) F0.	412	X
26885	Backbone chemical shift assignments for ferric THB1	642	X
26886	Backbone chemical shift assignments of ferrous THB1	647	X
26887	Complete 1H 13C 15N chemical shift assignments of Mycobacterial Heparin-Binding Hemagglutinin	1061	X
26888	Complete 1H 13C 15N chemical shift assignments of Mycobacterial Heparin-Binding Hemagglutinin in association with heparin analogs	1061	X
26889	1H, 13C assignments for bovine insulin	538	X
26890	Resonance assignments of an alpha-synuclein fibril prepared in Tris buffer at moderate ionic strength	275	X
26892	In solution NMR characterization of an engineered membrane active peptide, A-Cage-C	163	X
26893	Backbone resonance assignments of monomeric SOD1 in dilute environment	520	X
26894	Backbone resonance assignments of monomeric SOD1 in crowded environment	524	X
26896	Conformational dynamics as a key factor of activation of the receiver domain of sensor histidine kinase CKI1 from Arabidopsis thaliana	296	X
26897	Conformational dynamics as a key factor of activation of the receiver domain of sensor histidine kinase CKI1 from Arabidopsis thaliana	312	X
26898	Conformational dynamics as a key factor of activation of the receiver domain of sensor histidine kinase CKI1 from Arabidopsis thaliana	282	X
26900	Beta-endorphin salt-free amyloid fibrils	150	X
26901	1H, 13C and 15N backbone and side-chain resonance assignments of the ZnF UBP domain of USP20/VDU2	1073	X
26902	Backbone chemical shift assignment of the N-terminal domain of the phosphoprotein of Respiratory Syncytial Virus	664	X
26903	Backbone chemical shift assignment of a deletion mutant of Respiratory Syncytial Virus phosphoprotein without oligomerization domain	1430	X
26904	Backbone chemical shift assignment of a tetrameric N-terminal fragment of Respiratory Syncytial Virus phosphoprotein (residues M1-R163)	760	X
26905	backbone chemical shift assignment of S23C mutant of the Respiratory Syncytail Virus phosphoprotein	1114	X
26906	Backbone chemical shift assignment of the C-terminal domain of Respiratory Syncytial Virus phosphoprotein	478	X
26907	Chemical shift assignments of a hydrophobin from Phanerochaete carnosa	865	X
26908	Backbone 1H, 13C, 15N chemical shift assignments of portions of Thermotoga maritima flagellar motor proteins FliG (N-terminal domain; FliGN) and FliF (C-terminal domain; FliFC) in complex	529	X
26909	N-terminal domain of the E. coli DNA polymerase III delta subunit	1688	X
26910	13C and 15N chemical shift assignment of the Y21M mutation of fd filamentous phage	273	X
26912	Chemical shift assignments of the first and second RRMs of Nrd1, a fission yeast MAPK target RNA binding protein	1673	X
26913	Partially-Deuterated Samples of HET-s(218-289) Fibrils: Assignment and Deuterium Isotope Effect	475	X
26914	Chemical shifts of 20-mer from UBAP1	120	X
26915	Backbone Chemical Shift of Spy (Spheroplast protein Y)	618	X
26916	Recombinant Human Granulocyte-Colony Stimulating Factor variant C3 (G-CSFC3) backbone assignments	1557	X
26919	1H, 15N and 13C resonance assignments and secondary structure of PulG, the major pseudopilin from Klebsiella oxytoca Type 2 Secretion System	1154	X
26920	1H, 13C and 15N backbone resonance assignment of the TPR2B domain of mouse STI1	491	X
26921	Chemical Shift Assignments of the Connexin37 Carboxyl Terminal Domain	1117	X
26922	First RRM domain of MEC-8	494	X
26923	Backbone and Ile, Leu, Val Methyl Chemical Shift Assignments for Rhizopus microsporus var. chinensis lipase	1259	X
26924	13C and 15N Chemical Shift Assignments for Mouse Y145Stop Prion Protein Amyloid Fibrils	113	X
26925	13C and 15N Chemical Shift Assignments for human Y145Stop Prion Protein Amyloid Fibrils	120	X
26926	13C and 15N Chemical Shift Assignments for Syrian Hamster Y145Stop Prion Protein Amyloid Fibrils	104	X
26927	Backbone assignment of unlinked NS2B-NS3 Protease of Zika Virus in complex with acetyl-lysine-arginine	1105	X
26928	Backbone assignment of unlinked NS2B-NS3 Protease of Zika Virus	901	X
26929	1H and 15N resonance assignment of the first fibronectin type III module of the neural cell adhesion molecule (NCAM FN1)	504	X
26931	Backbone chemical shifts of the MBD2/3 methyl-cytosine binding domain from Ephydatia muelleri	304	X	X
26932	Backbone 1H, 13C, and 15N Chemical Shift Assignments for MTTTm	728	X
26933	Backbone assignment of unlinked NS2B-NS3 Protease of Zika Virus in complex with acetyl-lysine-arginine aldehyde	974	X
26934	Solution Structure of first stem-loop of Escherichia coli DsrA RNA	370			X
26935	Backbone 1H, 13C, and 15N Chemical Shift Assignments for KISS-1	652	X
26936	1H, 13C, and 15N Backbone Chemical Shift Assignments of camelid single-domain antibodies against active state of mu-opioid receptor.	781	X
26937	1H, 13C, 15N Backbone chemical Shift Assignment of camelid single-domain antibodies against active state of mu-opioid receptor	766	X
26938	Iminoproton chemical shifts of ASH1 E3 28mer RNA stem-loop	10			X
26939	Iminoproton chemical shifts of ASH1 E3 42mer RNA stem-loop	16			X
26940	Backbone 1H, 15N and 13C assignments for LITAF	833	X
26942	Backbone and Side-Chain (1)H, (13)C, and (15)N Chemical Shift Assignments for the homodimeric Histone-like DNA binding protein (Hup) of Helicobacter pylori	1161	X
26943	mini monomeric TGF-b2	444	X
26944	mini monomeric TGF-b2-7m	443	X
26945	Human SMAD4 MH1 domain	452	X
26946	Backbone and Side Chain Chemical Shift Assignments for C-terminal truncated S100A4	605	X
26947	NMR resonance assignments of AIPL1 FKBP in complex with a farnesyl ligand	1355	X
26948	Backbone chemical shift assignment of RNA recognition domain 2 of SART3	378	X
26949	Early Response to Dehydration 10 (ERD10) from Arabidopsis thaliana	1734	X
26950	Backbone 1H, 13C, and 15N Chemical Shift Assignments for New Delhi beta lactamase 1 (in presence of Zn ions).	1050	X
26951	Backbone 1H, 13C, and 15N Chemical Shift Assignments for USP7 catalytic domain	1440	X
26952	92% Backbone 1H, 13C, and 15N Chemical Shift Assignments for New Delhi beta lactamase 1 (without Zinc)	1057	X
26953	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Kruppel-like Factor 4 (KLF4) Residues 1-130	612	X
26954	Fyn SH3 V39V/N53P/V55L delta56	285	X
26955	Fyn SH3 WT delta57	300	X
26956	Backbone assignment of S100A4 and C-ERMAD fragment of ezrin	178	X
26957	ICP4 DNA binding domain	107	X
26958	Backbone assignment of mouse prion (23-231) at pH 4 and 37C	898	X
26959	side-chain methyl order parameters, stereospecific resonance assignments, and relaxation rates for apo CzrA	232	X
26960	Quantitative mapping of MAP2c phosphorylation and 14-3-3 binding sites reveals key differences between MAP2c and Tau	5015	X
26961	Backbone 1H, 13C, and 15N Chemical Shift Assignments for SUSP4(201-300)	1116	X
26962	Backbone resonance assignment of insect arylalkylamine N-acetyltransferase from bombyx mori reveals conformational heterogeneity	995	X
26963	PSEUDOMONAS AERUGINOSA ICP	1246	X
26964	Backbone 1H, 13C, and 15N Chemical Shift Assignments for an Exon-1 Fragment of Huntingtin at pH = 1.7 and T = 25 C.	160	X
26965	Backbone 1H, 13C, and 15N Chemical Shift Assignments for an Exon-1 Fragment of Huntingtin at pH = 7.1 and T = 4 C	160	X
26966	Backbone 1H, 13C, 15N backbone assignment of the human Heat Labile Enterotoxin (hLTB)	442	X
26967	Assignments of Dictyostelium GlcNAc-Skp1	885	X
26968	Assignments of Dictyostelium Skp1	892	X
26969	Backbone resonance assignments of the Pseudomonas aeruginosa major pilin PilA from strain PA14	712	X
26970	Chemical shifts of Lc-LTP2 in complex with DMPG	1075	X
26971	Chemical shifts of Lc-LTP2 in complex with DHPC	1074	X
26972	Backbone resonance assignments for the SET domain of human methyltransferase NSD3	1139	X
26973	Near-complete backbone resonance assignments of acid-denatured human cytochrome c in DMSO: a prelude to studying interactions with phospholipids	443	X
26974	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Hsp31	1243	X
26975	AILV Methyl Resonance Assignments for G protein alpha i3 subunit in the GDP-bound state	384	X
26976	AILV Methyl Resonance Assignments for G protein alpha i3 subunit in the GoLoco14-bound state	372	X
26977	An allosteric site in the T cell receptor constant domain plays a critical role in T cell signaling	1365	X
26978	MeCP2 bound to methylated DNA	643	X	X
26979	Wild type fused Npu DnaE from Nostoc punctiforme with Phe +2 Extein	704	X
26980	Wild type fused Npu DnaE from Nostoc punctiforme with Gly +2 Extein	710	X
26981	Fused Npu DnaE GEP loop mutant from Nostoc punctiforme with Phe +2 Extein	708	X
26982	Chemical shift assignments of the RYBP NZF domain	376	X
26983	HBP(D24R)-Histamine-Seratonin methyl and amide order parameters	582	X
26984	Fused Npu DnaE GEP loop mutant from Nostoc punctiforme with Phe +2 Extein	701	X
26985	1H, 13C and 15N resonance assignments of SmpB from Mycobacterium tuberculosis	1486	X
26986	1H, 13C and 15N Chemical shift assignments of yeast thioredoxin Saccharomyces cerevisiae in the oxidized state by solution NMR spectroscopy.	1268	X
26987	HIV1 protease folded and cold-denatured	575	X
26989	Backbone 1H, 13C, and 15N Chemical Shift Assignments for fluoroacetate dehalogenase from Rhodopseudomonas palustris	1006	X
26990	1H, 15N and 13C Chemical Shift Assignments of the Regulatory Domain of Human Calcineurin	756	X
26991	Full atom 1H, 13C, and 15N Chemical Shift Assignments for Mouse CCL5	773	X
26992	Isolated voltage-sensing domain from second subunit of human sodium channel Nav1.4 in the LPPG micelles, N-formilated form	1539	X
26993	Isolated voltage-sensing domain from second subunit of human sodium channel Nav1.4 in the LPPG micelles	1447	X
26994	Backbone 1H, 13C, and 15N Chemical Shift Assignments for HSP27	164	X
26995	A consensus homeodomain	679	X
26996	Backbone assignments for NS2b, NS3 complex	718	X
26997	Backbone assignment of human 4E-BP1 (fragment 44 to 87) bound to mouse eIF4E	144	X
26998	Rabbit Prp 90-231 NH assignments	170	X
26999	Adenylate kinase in Apo form	380	X
27000	Adenylate kinase R119A mutant Apo form	324	X
27001	Adenylate kinase variant R119K Apo form	370	X
27002	Assignment of HuR RRM1-RRM2 tandem domain	970	X
27003	Backbone assignment of human 4E-BP1 (fragment 44 to 87)	182	X
27004	Adenylate kinase bound to Ap5A ligand	348	X
27005	Adenylate kinase bound to ATP ligand	266	X
27007	Adenylate kinase R119A mutant bound to Ap5A	266	X
27008	Adenylate kinase R119A mutant bound to ATP	254	X
27010	Adenylate kinase variant R119K bound to Ap5A ligand	296	X
27012	Chemical shift assignments (HN,N,CA,CB) of oxidised n-NmDsbD	517	X
27013	Chemical shift assignments (HN,N,CA,CB) of reduced n-NmDsbD	517	X
27014	Chemical shift assignments (HN,N,CA,CB) of oxidised c-NmDsbD	503	X
27015	Chemical shift assignments (HN,N,CA,CB) of reduced c-NmDsbD	503	X
27016	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the DHDD Region of GbnD4 KS14 from the Gladiolin Polyketide Synthase	368	X
27017	Backbone and sidechain chemical shift assignments of the complex of calmodulin bound to a beta calcineurin A peptide	2228	X
27019	RXFP2-LDLa-linker-GB1	1109	X
27020	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Human BetaB2-crystallin	646	X
27021	1H, 15N, 13C resonance assignment of the aortic medial amyloid protein medin in non-denaturing conditions.	238	X
27022	1H, 15N, 13C backbone resonance assignments of human phosphoglycerate kinase in a transition state analogue complex with ADP, 3-phosphoglycerate and magnesium trifluoride	1956	X
27023	Ascl1_fragment_A	346	X
27024	Ascl1 fragment B	509	X
27025	Ascl1 fragment C	342	X
27026	Ascl1 fragment D	403	X
27027	N-terminally acetylated beta-Synuclein	766	X
27028	side-chain methyl order parameters, stereospecific resonance assignments, and relaxation rates for Zn(II) CzrA	232	X
27029	Backbone 1H, 13C, and 15N Chemical Shift Assignment for Human TRPV1 Sensing Domain	563	X
27030	Chemical shift assignments of DANCER-0, a dynamic pentamutant of the B1 domain of streptococcal protein G (GB1)	555	X
27031	Chemical shift assignment of DANCER-1, a natively folded and dynamic hexamutant of the B1 domain of streptococcal protein G (GB1)	471	X
27032	Chemical shift assignment of DANCER-3, a natively folded and dynamic pentamutant of the B1 domain of streptococcal protein G (GB1)	579	X
27033	1H, 13C and 15N Chemical Shift Assignments of cyclophilin 2 from Trichomonas vaginalis	2040	X
27034	1H, 13C and 15N chemical shift assignments of A. thaliana RCD1(468-569)	1434	X
27035	Backbone assignment of human Ube2T	651	X
27036	PR-R7 from staphylocoagulase of S. aureus Newman D2 Tager 104 strain	739	X
27037	Alanine chemical shifts of the N-terminal domain (residues 1-215) of HtpG, the Hsp90 from Escherichia coli. Northeast Structural Genomics Consortium Target ER697A.	117	X
27038	Alanine chemical shifts of the C-terminal dimerization domain (residues 511-624) of HtpG, the Hsp90 from Escherichia coli. Northeast Structural Genomics Consortium Target ER697C.	108	X
27039	Chemical shifts of amorphous-looking aggregates of the P23T mutant of human gamma-D-crystallin formed at pH 7.	196	X
27040	NMR resonance assignments of a hypoallergenic isoform of the major birch pollen allergen Bet v 1	1757	X
27041	Backbone 1H, 13C, and 15N and partial sidechain 1H and 13C Chemical Shift	785	X
27042	FHA-Chk2	447	X
27043	NMR resonance assignment of New Delhi Metallo-beta-lactamase	747	X
27044	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Sgt2_TPR	677	X
27045	Solid-state NMR chemical shifts of amyloid-like fibrils formed by huntingtin exon 1 with a 44-residue polyQ domain.	138	X
27046	Backbone chemical shift assignments for the oxidized alpha-crystallin domain of HSP27 (HSPB1)	408	X
27047	Hamster PrP 90-231	180	X
27048	DERA K58EY96W monomer mutant	2986	X
27049	Trypanosoma brucei brucei Tryparedoxin reduced	677	X
27050	Trypanosoma brucei brucei Tryparedoxin oxidized	665	X
27051	1H, 15N and 13C resonance assignments of the Ixolaris, a tissue factor pathway inhibitor from the tick salivary gland	1477	X
27052	Backbone 1H, 13C, and 15N and ALV methyl Chemical Shift Assignments of the yeast TIM9/10 complex	868	X
27053	NMR chemical shift assignments of a 22mer G-quadruplex formed within the KRAS proto-oncogene promoter region	218		X
27055	NMR structure of the RNA recognition motif 2 (RRM2) of the splicing factor RBM10	988	X
27056	C. elegans SAS-5 N-term backbone assignments	893	X
27057	Chemical Shift Assignment of the PP1 and Microtubule binding domain of human KNL-1	388	X
27058	Resonance assignment of MOAG-4 at pH 6.0	806	X
27059	15N, 13C assignments of Leptosphaeria Rhodopsin	713	X
27060	1H assignments for DecP-11 in solution	122	X
27061	Backbone assignments of Escherichia coli. holo-Acyl Carrier protein	382	X
27062	1H, 13C and 15N NMR Assignments of a Bacterial Immunoglobulin- like Domain (group 2) of a Protein from a Bacterium Paenarthrobacter aurescens TC1	1146	X
27063	Degenerate heptads 27-52 of human RNA polymerase II C-terminal domain (DNA-directed RNA polymerase II subunit RPB1): assignments and backbone relaxation	641	X
27064	Solution structure of the IgI domain of CD147	1241	X
27065	13C, 15N chemical shift assignments of MAK33 VL S20N amyloid fibrils	145	X
27066	Chemical Shift Assignment of the PP1 and Microtubule binding domain of phosphorylated human KNL-1	389	X
27067	BlaC	1265	X
27069	Backbone and side-chain 1H, 15N, and 13C resonance assignments of a novel Staphylococcal inhibitor of Myeloperoxidase	338	X
27070	human FKBP25	1046	X
27071	BTHB domain from human FKBP25	380	X
27072	TDP-43 NTD	140	X
27073	Ile- 1 Methyl resonance assignment of the Hepatitis C Virus RNA-dependent RNA-polymerase NS5B (strain JFH-1).	80	X
27074	1H and 15N Chemical Shift Assignments for wild-type alpha-synuclein	250	X
27075	1H and 15N Chemical Shift Assignments for phosphorylated S129 alpha-synuclein	252	X
27076	1H and 15N Chemical Shift Assignments for Y133F/Y136F mutant alpha-synuclein	246	X
27077	1H and 15N Chemical Shift Assignments for phosphorylated Y125, Y133F/Y136F mutant alpha-synuclein	248	X
27078	Chemical shift assignments for the apo-form of the catalytic domain, the linker region, and the carbohydrate binding domain of the cellulose-active lytic polysaccharide monooxygenase ScLPMO10C	3449	X
27079	Backbone Resonance Assignment of the BCL6-BTB/POZ Domain	660	X
27080	Backbone resonance assignment of the Human Uracil DNA Glycosylase-2	1154	X
27081	1H, 13C, and 15N backbone and side chain resonance assignments for a structured domain in atg32	1783	X
27082	NMR backbone assignments of the Tyrosine kinase domain of human fibroblast growth receptor 3 in apo state and in complex with inhibitor PD173074	835	X
27083	NMR backbone assignment of the Tyrosine Kinase domain of human fibroblast receptor 3 in apo state and in complex with inhibitor PD173074	747	X
27084	beta-Ginkgotides: Hyperdisulfide-constrained peptides from Ginkgo biloba	103	X
27085	1H, 13C, 15N backbone NMR assignment of N-terminal domain of SaHPF	1038	X
27086	Heteronuclear chemical shifts of native cytotoxin-1 from N. oxiana	717	X
27087	1H, 15N, and 13C resonance assignments of Staphylococcus aureus extracellular adherence protein domain 3 from triple resonance NMR experiments	387	X
27088	ISCU(M108I)	428	X
27089	ISCU(D39V)	417	X
27090	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Elongation factor P	872	X
27091	Backbone 1H, 13C, and 15N Chemical Shift Assignments for EarP	661	X
27092	Chemical Shifts of Transmembrane Segment XI of the Na+/H+ Antiporter of S. pombe in DPC	263	X
27093	Chemical shift assignment of human MOZART1 protein (mitotic-spindle organizing protein associated with a ring of gamma-tubulin 1)	846	X
27094	Backbone chemical shift assignments of the apo calmodulin C-domain bound to the NaV1.2 IQ motif peptide	482	X
27095	Backbone and side chain chemical shift assignments of apo calmodulin bound to the NaV1.2 IQ motif peptide	2115	X
27096	apo-AFABP chemical shift assignments	513	X
27097	1H, 15N and 13C resonance assignments of Mvo10b	1231	X
27098	1H, 15N and 13C resonance assignments of Mth10bTQQA	1186	X
27099	Chemical shift assignment of gp17.1 by proton-detected solid-state NMR	762	X
27102	Backbone assignments for the Val66 prodomain of BDNF	507	X
27103	Backbone assignment for Met66 prodomain of BDNF	517	X
27104	Steroid receptor coactivator-2 (SRC-2/NCoA-2/GRIP1/TIF2) receptor interaction domain (RID) backbone NMR chemical shift assignments	862	X
27106	Human BRM AT-hook and Bromodomain	452	X
27107	Backbone and beta carbon 1H, 13C, and 15N chemical shift assignments for the worm complexin-1 CTD in the presence of dodecylphosphocholine micelles	244	X
27108	Backbone 1H, 13C, and 15N Chemical Shift Assignments for SH3 domain of Noxa1	228	X
27109	Solution-state NMR assignment of the flexible C-terminal domain of the human eye lens molecular chaperone alphaA-crystallin	214	X
27110	1H, 13C and 15N chemical shifts of HIV-1 gp41 cytoplasmic tail residues 707-751	511	X
27111	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Musashi2 RRM1	414	X
27112	1H, 15N and 13C assignments of Drosophila brain-type fatty acid-binding protein ligated with oleic acid	815	X
27113	1H, 15N and 13C assignments of apo-form dFABP	528	X
27119	SH2B1 SH2 Domain	291	X
27120	Backbone chemical shifts of a circularized type III antifreeze protein from Macrozoarces americanus	354	X
27121	Sequence Specific Backbone Assignment of the catalytic domain of HePTP (residues 44-339) at pH 7.8	878	X
27122	Sequence Specific Backbone Assignment of the catalytic domain of HePTP (residues 44-339) in presence of vanadate (inhibitor) at pH 7.8	673	X
27123	hnRNPA2 low complexity domain 190-341 backbone and Cbeta chemical shifts	647	X
27124	hnRNPA2 D290V low complexity domain 190-341 backbone and Cbeta chemical shifts	647	X
27125	FUS low complexity domain with 12 phosphomimetic S/T to E mutations	725	X
27126	SH2B1/JAK2-pep complex	306	X
27127	1H, 13C, 15N Chemical Shift Assignments for vaccinia topoisomerase 1B N terminal domain (1-80)	469	X
27128	Voltage-dependent anion channel - VDAC E73V mutant	988	X
27129	Backbone 1H, 13C, and 15N Chemical Shift Assignments for T94T variant of human liver FABP	491	X
27130	1H, 13C, and 15N chemical shift assignments of the FnIII-2 domain from Vibrio cholerae RbmA	474	X
27131	Backbone 1H, 13C, and 15N Chemical Shift Assignments for 98-243	689	X
27133	Backbone 1H, 13C and 15N chemical shift assignments for the full length of human uracil DNA glycosylase UNG2	3174	X
27134	C-terminal domain of merozoite surface protein 2	396	X
27135	Backbone 1H, 15N and 13C assignments of the Sec63 unit of human Brr2	898	X
27136	Backbone 1H, 13C, and 15N Chemical Shift Assignments for T94T variant of human liver FABP in complex with glycocholic acid	485	X
27137	HypF-N backbone assignment in toxic oligomer solution condition	461	X
27138	HypF-N backbone assignment in non-toxic oligomer solution conditions	468	X
27139	HypF-N native backbone assignment	486	X
27141	1H, 13C, and 15N Chemical Shift Assignments for the N-terminal Signaling Domain of the Pseudomonas capeferrum TonB-dependent Transducer PupB	884	X
27143	Backbone and side chain chemical shift assignments of human PACT-D3 L273R	930	X
27144	DNA with compounds	207		X
27145	Backbone 1H, 13C, 15N assignments for the chromoshadow domain of S. pombe Swi6	216	X
27146	Est3 Hansenula polymorpha telomerase subunit	1997	X
27147	1H, 13C and 15N chemical shift assignments for the repetitive domain of E. australis major ampullate spidroin 1	430	X
27148	Backbone and side chain chemical shift assignments of wild-type PACT-D3.	1632	X
27151	Human Guanylate Kinase	2379	X
27158	NMR study of non-structural proteins part III: 1H, 13C, 15N resonance assignment of macro domain from Chikungunya virus (CHIKV)	1670	X
27159	LRT2 Cyclophilin of rice	1785	X
27160	1H, 15N, 13C backbone resonance assignments of the nuclease core residues 2-336 of wild type human flap endonuclease-1	1291	X
27161	Httex1 25Q	230	X
27162	NMR resonance assignments of the EVH1-domain of Neurofibromin's recruitment factor Spred1	1301	X
27165	Chemical Shift Assignments of the partially deuterated Fyn SH2-SH3 domain	2089	X
27166	1H, 13C, and 15N Chemical Shift Assignments for LisH Domain of GID8	493	X
27167	1H, 15N, and 13C chemical shift assignments of the micelle immersed C-terminal FATC domain of the human protein kinase ataxia-telangiectasia mutated (ATM) fused to the B1 domain of streptococcal protein G (GB1)	1106	X
27168	1H, 15N, and 13C chemical shift assignments of the micelle immersed C-terminal FATC domain of the human DNA-dependent protein kinase catalytic subunit (DNA-PKcs) fused to the B1 domain of streptococcal protein G (GB1)	962	X
27169	1H, 13C, and 15N Chemical Shift Assignments for truncated forms of the coronavirus nsp1 protein and its solubility domain GB1	543	X
27170	Sequence specific 1H, 13C and 15N resonance assignments of a cataract-related variant G57W of human Gamma S-Crystallin	1946	X
27172	Ubiquitin V26A Mutant at pH 5.0	366	X
27173	1H, 13C, and 15N resonance assignments of a 22mer G-quadruplex forming within KRAS oncogene promoter region at physiological temperature	351		X
27174	1H, 15N, 13C backbone resonance assignments of the D10N variant of beta-phosphoglucomutase in a MgII-bound complex with beta-glucose 1,6-bisphosphate	1057	X
27175	1H, 15N, 13C backbone resonance assignments of the D10N variant of beta-phosphoglucomutase in a MgII-free complex with beta-glucose 1,6-bisphosphate	1058	X
27176	1H, 13C, and 15N Chemical Shift Assignments for truncated forms of the coronavirus nsp1 protein and its solubility domain GB1	534	X
27177	1H, 13C, and 15N Chemical Shift Assignments for truncated forms of the coronavirus nsp1 protein and its solubility domain GB1	760	X
27179	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Hepatitis B Virus X protein (HBx)	1194	X
27180	Coheson Domain 5 from Clostridium themocellum	816	X
27183	1H, 15N, 13C backbone resonance assignment of the C-terminal domain of Enzyme I from Thermoanaerobacter Tengcongensis	1349	X
27184	Backbone 1H, 13C and 15N resonance assignments of the OB domain of the single stranded DNA-binding protein hSSB2 (NABP1/OBFC1B) and chemical shift mapping of the DNA-binding interface	597	X
27185	ProXp-ala free form	494	X
27186	Backbone 1H, 13C, and 15N Chemical Shift Assignments for APLF acidic domain	369	X
27187	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Drosophila melanogaster H2B	566	X
27188	N, H, CA, CB chemical shifts of E.coli CheA	724	X
27189	N,H,Ca,Cb chemical shifts and methionine sidechain chemical shifts of the isolated P1 domain of CheA from Escherichia Coli	550	X
27190	Backbone chemical shift assignments of apo calmodulin bound to human NaV1.1 IQ motif peptide	831	X
27191	ProXp-ala bound to microhelixPro	755	X
27192	NMR assignment of Rab5a (double deletion mutant) from Leishmania donovani	1821	X
27193	Backbone 1H, 15N chemical shift for Y39E EVH1	257	X
27195	NMR Chemical Shift Assignments of Frataxin protein from Chaetomium thermophilum	500	X
27196	Solution-NMR assignment of the Ig-like domain of bacteriophage T5 tail tube protein pb6	466	X
27197	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Dm. Par3 PDZ1 domain	1056	X
27198	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Dm. Par3 PDZ3 domain	446	X
27199	1H and 15N chemical shift assignments of human S100B	218	X
27201	Partial solid-state NMR assignment of bacteriophage tail protein pb6 (C-ter domain assigned)	364	X
27202	Extrinsic methylthiocysteine labels of cytosolic domain of NADPH cytochrome P450 oxidoreductase	11	X
27203	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Dm. Par3 PDZ2 domain	251	X
27204	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Hs. Par3 PDZ2 domain	178	X
27205	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Hs. Par3 PDZ3 domain	376	X
27206	Centrosomin aa1090-1148	347	X
27207	Gcn4 tAD 1-134	614	X
27208	Fc fragment of mouse immunoglobulin G	819	X
27209	1HN, 13C, and 15N Resonance Assignments of the human DNA Ligase 3 DNA-Binding Domain (residues 257-477)	961	X
27210	PhoBN F20D assignment	532	X
27211	Solid-state NMR assignment of P. horikoshii TET2	1518	X
27212	Backbone 13C and 15N Chemical Shift Assignments for fibrillar Amyloid Beta (1-42)	231	X
27213	RSK1 C-terminal peptide (696-735)	70	X
27214	RSK1 phosphorylated C-terminal peptide (696-735)	70	X
27215	Chemical shift assignments of free prothymosin alpha	553	X
27216	Chemical shift assignments of prothymosin alpha in complex with Histone H1	371	X
27217	Backbone Chemical Shift Assignments for the S99T/C115S Mutant of Human Cyclophilin A	937	X
27218	Backbone Chemical Shift Assignments for the S99T/C115S/I97V Mutant of Human Cyclophilin A	936	X
27219	ssNMR assignment of membrane embedded NaK channel (ion-free conformer)	286	X
27220	ssNMR assignment of membrane embedded NaK channel (ion-favored conformer)	286	X
27221	Backbone 1H, 13C and 15N Chemical Shift Assignments for residues 421-470 of human PABPC1	196	X
27224	1H, 15N, 13C backbone resonance assignments of pentaerythritol tetranitrate reductase from Enterobacter cloacae PB2 in complex with oxidised flavin mononucleotide	1694	X
27225	hsa-miR-34a-5p	124			X
27226	hsa-miR-34a-mSIRT1_bulge	215			X
27227	Backbone 1H and 15N Chemical Shift Assignments for mSin3B	93	X
27228	Backbone 1H, 13C, and 15N Chemical Shift Assignments for SLP-65	1170	X
27229	hsa-miR-34a-mSIRT1 bulge U5C9mut	202			X
27230	Elastin-like Protein 40 (ELP40)	3070	X
27231	Backbone assignments of the full length Dengue Virus NS4A protein in micelles	555	X
27232	13C chemical shifts of solid-state NMR signals of subunit c-ring of TFoF1 ATP synthase	294	X
27233	Backbone 1H, 13C, and 15N Chemical Shift Assignments for MazF from M. tuberculosis	370	X
27234	Solution chemical shifts CAMSAP3 CKK domain	1394	X
27235	Solution NMR assignment of the C-terminal domain of chTOG	1738	X
27236	Resonance assignment of the central conserved region (domains 8 to 14) of human tropoelastin	816	X
27237	Backbone 1H, 13C, and 15N Chemical Shift Assignments for mouse galectin-2	486	X
27238	Backbone 1H, 13C, and 15N Chemical Shift Assignments for S-nitrosylated mouse galectin-2	488	X
27239	Trigger factor	3069	X
27240	NMR backbone and side chain assignments of the Kringle domain of ROR1	927	X
27241	E.coli GcvH backbone chemical shift assignments	609	X
27242	Trigger Factor	564	X
27243	RPT1 region of INI1/SNF5/SMARCB1_HUMAN - SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1	1100	X
27244	Chemical shifts assignments of Escherichia coli aquaporin (AqpZ) by solid-state NMR	1060	X
27246	Backbone assignments of engineered hairpin loop3 mutant of single chain monellin.	441	X
27247	Backbone assignments of domain swapped dimer of engineered hairpin loop3 mutant of single chain Monellin	436	X
27248	Backbone amide and AILV methyl chemical shift assignments for Beta2-microglobulin, a human class I major histocompatibility molecule light chain	504	X
27249	Backbone amide and AILV methyl chemical shift assignments for H2-Dd, a murine class I major histocompatibility molecule heavy chain	1564	X
27250	CW domain of ASHH2 methyltransferase	292	X
27251	Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments for CW domain of Histone-lysine N-methyltransferase ASHH2 bound to H3K4me1	808	X
27254	Molten globule of L94G mutant of horse cytochrome-c	1233	X
27259	1H, 15N, 13C resonance assignments for Human prion protein (91-231): mutant V127M129 (scilicet HuPrPG127V)	1579	X
27260	Backbone chemical shift assignments of apo calmodulin bound to the NaV1.7 IQ motif peptide	860	X
27261	Isoleucine d1 methyl assignments for human adenosine receptor A2A with antagonist ZM241385	20	X
27262	'1H, 13C and 15N Chemical shift assignment for double stranded RNA Binding Domain 1 of Trans Activation Response element (TAR) RNA Binding protein 2'	612	X
27263	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the actin-binding domain of the TARP protein from Chlamydia.	392	X
27264	1H, 15N, 13C resonance assignments for Human prion protein (91-231): wild type (scilicet HuPrPM129)	1517	X
27265	Backbone and sidechain assignments of human Cyclophilin A	1883	X
27266	Backbone 1H, 13C, and 15N Chemical Shift Assignments for TNF alpha	594	X
27267	Backbone 1H, 13C and 15N Chemical Shift Assignments for c-Jun	853	X
27268	Backbone chemical shifts for the complex between WASp interacting protein (WIP) and the EVH1 domain of WASp	1256	X
27269	Backbone 1H, 13C, and 15N Chemical Shift Assignments for gHEEE_02 in presence of 10 mM TCEP	485	X
27270	Backbone assignments of NS5A-D2 from Hepatitis C virus (JFH-1) phosphorylated by Casein Kinase II	438	X
27271	Solution NMR structure of BCoR in complex with AF9 (BCoR-AF9)	1243	X
27272	Backbone assignment of SGTA C-terminal domain	294	X
27273	Backbone 1H, 13C, and 15N Chemical Shift Assignments of phosphorylated (T183 and Y185) p38 alpha	1086	X
27274	Backbone 1H, 13C, and 15N Chemical Shift Assignments of phosphorylated (T183 and Y185) p38 alpha in complex with an MKK3bKIM peptide	1062	X
27275	Backbone assignment of SGTA TPR_C-terminal(deltaQ) domains	766	X
27276	Backbone assignment of SGTA N-terminal domain including linker residues	427	X
27277	1H, 13C and 15N chemical shift assignments for carbohydrate binding module 14 (CBM14)	554	X
27278	Backbone 1H, 13C, 15N chemical shift assignments for T cell receptor N15 beta subunit C domain mutant c1	992	X
27279	Backbone 1H, 13C, 15N chemical shift assignments for T cell receptor N30 beta subunit C domain mutant c1	1036	X
27280	Backbone 1H, 13C, 15N chemical shift assignments for T cell receptor N15 beta subunit C domain mutant m22	1005	X
27281	Backbone 1H, 13C, 15N chemical shift assignments for T cell receptor N15 beta subunit C domain mutant m23	1016	X
27282	Backbone assignment of Zika Virus NS2B-NS3 Protease in complex with a covalent inhibitor	941	X
27284	Backbone and side chain resonance assignment of the H-NOX domain from Shewanella woodyi in the Fe(II)CO ligation state	1997	X
27285	Backbone 1H, 13C, and 15N Chemical Shift Assignments for VSV8 peptide bound to MHC H-2Kb (VSV8/Kb)	688	X
27286	Backbone 1H, 13C, and 15N Chemical Shift Assignments for VSV8 peptide bound to a truncated MHC H-2Kb (VSV8/Kb-t)	665	X
27287	Catalytic Domain of Human Aprataxin	610	X
27288	RAP74-CTD	310	X
27289	Structure of the 30 kDa HIV-1 RNA Dimerization Signal by a Hybrid Cryo-EM, NMR and Molecular Dynamics Approach	214			X
27290	(1)H, (13)C, (15)N resonance assignment of human YAP 50-171 fragment	477	X
27292	Methyl-methionine resonance assignments for Turkey beta-1 adrenergic receptor, Delta5 mutant, Apo form	56	X
27293	Methyl-methionine resonance assignments for Turkey beta-1 adrenergic receptor, Delta5 mutant, Isoprenaline-bound form	48	X
27294	Methyl-methionine resonance assignments for Turkey beta-1 adrenergic receptor, Delta5-L190M mutant, Apo form	56	X
27295	Methyl-methionine resonance assignments for Turkey beta-1 adrenergic receptor, Delta5-L190M mutant, Isoprenaline-bound form	56	X
27296	Methyl-methionine resonance assignments for Turkey beta-1 adrenergic receptor, Delta5-L190M mutant, bound to nanobody Nb6B9, without orthosteric ligand.	56	X
27297	Methyl-methionine resonance assignments for Turkey beta-1 adrenergic receptor, Delta5-L190M mutant, bound to nanobody Nb6B9 and full agonist isoprenaline	56	X
27298	C8 bound E.coli GcvH backbone chemical shift assignments	596	X
27299	hnRNPA2 P298L low complexity domain 190-341 backbone and Cbeta chemical shifts	648	X
27300	Backbone HN, N, CA, and CB assignment of human UBC9_P123L	553	X
27301	Backbone and side chain assignments of Scm3 from Saccharomyces cerevisiae	2204	X
27302	1H, 13C and 15N backbone chemical shift assignments of A. thaliana RCD1(499-572)	327	X
27303	1H, 13C and 15N backbone chemical shift assignments of A. thaliana DREB2A(255-272)	96	X
27304	Backbone 1H and 15N Chemical Shift Assignments for HOLO-BAMB5917	186	X
27305	Chemical Shift Assignments of Retinal Degeneration 3 Protein (RD3)	1572	X
27306	Backbone 1H, 13C, and 15N Chemical Shift Assignments for FASP peptide of mPER2	162	X
27307	NMR resonance assignments of RNase P protein from Thermotoga maritima	1533	X
27312	Partial solid-state NMR 1H, 13C, 15N resonance assignments of a perdeuterated back-exchanged seven-transmembrane helical protein Anabaena Sensory Rhodopsin	376	X
27313	HusA from porphyromonas gingivalis	2156	X
27314	Acidothermus cellulolyticus endoglucanase 1 catalytic domain Y245G (E1)	1297	X
27315	Outer Membrane Protein X in PC14:1 MSPdH5 Nanodisc	429	X
27316	NMR assignment of the transmembrane helix of BclxL in phospholipid nanodiscs	114	X
27317	Solid-state NMR assignment of HBV core protein	771	X
27320	Hierarchical regulation of FOXO1 by AMPK and AKT through interactions with 14-3-3 proteins	158	X
27321	1H, 13C and 15N Chemical Shift Assignments and 15N backbone relaxation data for intracellular loop 2 of the human ZIP4 protein	891	X
27322	C-terminal domain of Cdc37 cochaperone. Y298E phosphomimetic mutant.	378	X
27323	C-terminal domain of Cdc37 cochaperone	402	X
27324	C-terminal domain of Cdc37 co-chaperone, unfolded in the presence of 8M Urea.	313	X
27325	SH2 domain of Yes1 kinase	411	X
27326	Yes1 SH2 domain in complex with Cdc37-derived phosphopeptide	418	X
27327	Yes1 kinase SH3 domain	237	X
27328	Chemical shifts of the human GPCR A2AAR in complex with the antagonist ZM241385 at pH 7	28	X
27330	1H, 13C and 15N resonance assignment of SpyCatcher	446	X
27331	1H, 13C and 15N resonance assignment of SpyCatcher part of complex	530	X
27332	Backbone chemical shift assignments of apo calmodulin bound to the NaV1.4 IQ motif peptide	851	X
27333	Ataxin7N10Q (Residues:1-62)	190	X
27334	Ataxin7N10QT3N9 (Residues:1-62)	380	X
27336	N-terminal domain of FOXO1	174	X
27337	Hierarchical regulation of FOXO1 by AMPK and AKT through interactions with 14-3-3 proteins	159	X
27338	CALPDZ	242	X
27339	Chemical shifts of UBQLN2 residues 450-624	714	X
27341	Backbone assignment of HSV-1 ICP27 103-155	245	X
27342	Backbone assignments for the N-terminal domain of VirB10	537	X
27343	Backbone 1H, 13C, 15N Chemical Shift Assignments of GB1 Seq2	393	X
27344	Backbone 1H, 13C, 15N Chemical Shift Assignments of GA Seq5	371	X
27345	Backbone 1H, 13C, 15N Chemical Shift Assignments of SH3 Seq3	376	X
27346	Backbone 1H, 13C, and 15N Chemical Shift Assignments for H2A in mono-nucleosome	366	X
27347	Babckbone 1HN, 13C, and 15N Chemical Shift Assignments of the ATAD2B Bromodomain	461	X
27348	1H, 13C and 15N assignment of C', CA, N and HN of intrinsically disordered alpha-synuclein near-phsysiological conditions	505	X
27349	1H, 13C, 15N chemical shift assignments of initiation factor 1 from Clostridium difficile	857	X
27351	Chemical shift assignments of the N-terminal peptide segment of human cystathionine-beta-synthase	387	X
27352	Backbone 1H, 13C, and 15N assignments of the extracellular region of human Fc receptor IIIb	835	X
27353	Chemical Shift Assignments of RHE-RS02845,a NTF2 domain-containing protein	852	X
27354	1H, 13C, and 15N Chemical Shift Assignments for the Thermus thermophilus HB8 TTHA1718 protein in sf9 cells by in-cell NMR spectroscopy	432	X
27355	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the C-terminal P4 domain of AHNAK	768	X
27356	1H, 13C, and 15N Chemical Shift Assignments for ubiquitin in sf9 cells by in-cell NMR spectroscopy	572	X
27357	AC12 peptide from Hypsiboas raniceps	85	X
27358	DNA binding protein inhibitor ID2 in 8M urea pH2.3	635	X
27359	Backbone (HN, N, HA) Resonance Assignment and 15N T1, T2 Relaxation Parameters for Abl1 SH3	155	X
27360	Stromal Interaction Molecule 1, Homo Sapiens, WT	59	X
27361	Stromal Interaction Molecule 1 CC1 R304W mutant	26	X
27362	Backbone (HN, N) Resonance Assignment and 15N T1, T2 Relaxation Parameters for doubly phosphorylated Abl1 SH3 pY89/pY134	98	X
27363	Biochemical and functional insights on the triheme cytochrome PpcA from Geobacter metallireducens	699	X
27364	Backbone 1H, 15N chemical shift assignments of Kaiso zinc finger DNA binding domain in complex with its double CpG-methylated DNA consensus binding site (MeCG2)	222	X	X
27365	CSP1_DPC	179	X
27366	Backbone 1H, 15N chemical shift assignments of Kaiso E535Q zinc finger DNA binding domain in complex with its double CpG-methylated DNA consensus binding site (MeCG2)	222	X	X
27367	Backbone 1H, 15N chemical shift assignments of Kaiso E535A zinc finger DNA binding domain in complex with its double CpG-methylated DNA consensus binding site	222	X	X
27368	Backbone 1H, 15N chemical shift assignments of Kaiso zinc finger DNA binding domain in complex with a double CpG-methylated DNA resembling the specific Kaiso binding site (KBS)	228	X	X
27369	Backbone 1H, 15N chemical shift assignments of Kaiso E535Q zinc finger DNA binding domain in complex with a double CpG-methylated DNA resembling the specific Kaiso binding site (KBS)	228	X	X
27370	Backbone 1H, 15N chemical shift assignments of Kaiso E535A zinc finger DNA binding domain in complex with a double CpG-methylated DNA resembling the specific Kaiso binding site (KBS)	228	X	X
27371	Backbone 1H, 15N chemical shift assignments of Kaiso zinc finger DNA binding domain in complex with a semi-CpG-methylated DNA resembling the specific Kaiso binding site (KBS)	228	X	X
27372	Backbone 1H, 15N chemical shift assignments of Kaiso zinc finger DNA binding domain in complex with a hemi-CpG-methylated DNA resembling the specific Kaiso binding site (KBS)	228	X	X
27373	Backbone assignment of activation loop autophosphorylated Src Kinase domain in complex with dasatinib	1197	X
27374	1H, 13C and 15N backbone resonance assignment of the lamin C-terminal region of progerin	218	X
27375	1H, 13C and 15N backbone resonance assignment of progerin C-terminal region without Cysteines	215	X
27376	1H, 13C and 15N backbone resonance assignment of the prelamin A C-terminal region	346	X
27377	Backbone 1H, 13C, and 15N Chemical Shift Assignments of HIV-1 Protease (Flap + mutant) bound to Darunavir	504	X
27378	Backbone 1H, 13C, and 15N Chemical Shift Assignments of WT HIV-1 Protease bound to Darunavir	495	X
27379	mu-PIIIA-3	166	X
27380	Assignment of the 1H, 13C, and 15N resonances of ataxin-3	948	X
27381	Backbone assignment of human TRIM25 PRYSPRY domain	685	X
27382	mu-PIIIA-4	123	X
27383	mu-PIIIA-5	156	X
27384	mu-PIIIA-6	124	X
27385	mu-PIIIA-9	154	X
27386	mu-PIIIA-11	127	X
27387	NMR 1H,13C,15N resonance assignment of the G12C mutant of human K-Ras bound to GDP	974	X
27388	mu-PIIIA-8	128	X
27389	mu-PIIIA-10	155	X
27390	mu-PIIIA-15	135	X
27391	mu-PIIIA-14	154	X
27392	E.Coli DnaK Nucleotide Binding Domain	1561	X
27393	1H, 13C and 15N resonance assignments for a chemokine receptor-binding domain of FROUNT, a cytoplasmic regulator of chemotaxis	1506	X
27394	Backbone 1H, 13C, and 15N Chemical Shift Assignments for FHA-1 domain of Rv1747 from Mycobacterium tuberculosis	686	X
27395	Backbone and methyl assignments for human Hsc70 substrate binding domain	944	X
27396	NMR assignments of Rous sarcoma virus matrix protein (M domain)	1101	X
27397	1H, 13C, 15N Chemical shift assignment for the TolAIII-TolB-peptide complex.	1554	X
27398	A low-complexity region in the YTH domain protein Mmi1 enhances RNA binding	639	X
27399	A low-complexity region in the YTH domain protein Mmi1 enhances RNA binding	716	X		X
27400	Assignment of 1H, 13C and 15N resonances of the extrecclular domain of human Death Receptor DR5	1214	X
27401	Backbone assignment of Dynein Light Intermediate Chain 1 C-terminal domain (LIC1 Cterminal)	483	X
27402	chemical shifts for human Axin DIX domain	340	X
27403	1H, 15N, 13C backbone resonance assignments of the nuclease core residues 2-336 of P188A human flap endonuclease-1	1280	X
27404	1H, 15N, 13C backbone resonance assignments of the nuclease core residues 2-336 of K93A human flap endonuclease-1 in complex with dual-hairpin DNA substrate	544	X	X
27405	The 15N, 13C and 1H Chemical Shift Assignment of Sis1 J domain from S. cerevisiae	863	X
27406	Backbone and side chain NMR assignments for heterologously expressed Er-23	417	X
27407	Ile and Met methyl 1H and 13C chemical shifts of DNA polymerase beta	116	X
27408	Axin RGS domain	432	X
27409	Ile and Met methyl 1H and 13C chemical shifts of DNA polymerase beta and 1-nucleotide gapped double hairpin DNA binary complex	116	X	X
27410	Ile and Met methyl 1H and 13C chemical shifts of DNA polymerase beta, 1-nucleotide gapped double hairpin DNA and dAMPCPP ternary complex	116	X	X
27411	1H, 13C and 15N chemical shift assignments for a family AA9 LPMO from Thermoascus aurantiacus (TaLPMO9A)	1986	X
27412	dASCIZ LC8 binding domain (residues 241-388)	963	X
27413	1H, 15N, 13C backbone resonance assignment of human alkbh5	999	X
27414	Backbone 1H, 15N, 13C assignment of Human Myc N353 to A399	184	X
27415	Chemical shift assignments for TRAP, a MMP20 proteolysis product of murine amelogenin.	354	X
27416	Backbone 1H, 15N, 13C assignment of Human Myc S373D/T400D, N353 to A399.	184	X
27417	Putative methyltransferase WBSCR27 in complex with S-adenosyl-L-methionine	2166	X
27418	Backbone 1H, 15N, 13C assignment of Human Myc S373D, N353 to A399.	178	X
27419	Backbone 1H, 15N, 13C assignment of Human Myc S373E/T400E, N353 to A399.	170	X
27420	Chemical shifts for the de novo mini protein gHH_44 in the reduced state.	263	X
27421	Backbone 1H, 15N, 13C assignment of Human Myc T400D, N353 to A399.	192	X
27422	Backbone 1H, 15N, 13C assignment of Human Myc, N353 to A399, phosphorylated by PAK2	180	X
27424	Chemical shifts of PrgK (19-92)	774	X
27425	1/loop partially truncated Phosphomimetic Bcl-2 mutant	239	X
27426	Chemical shift assignments for mutant Hs MBD2 intrinsically disordered region	845	X
27427	Methyl assignment of human eukaryotic translation initiation factor 4E (eIF4E) in its apo form	789	X
27428	Methyl assignment of cap-bound form of human eukaryotic translation initiation factor 4E (eIF4E)	959	X
27429	Distinctive phosphoinositide and Ca2+ binding properties of normal and cognitive performance-linked variant forms of KIBRA C2 domain	597	X
27430	Distinctive phosphoinositide and Ca2+ binding properties of normal and cognitive performance-linked variant forms of KIBRA C2 domain	594	X
27431	Backbone 1H, 13C, and 15N Chemical Shift Assignments for BamA barrel of E.coli	675	X
27432	Solution structure of the cross-linked dimer of the SLy1 SAM domain S320C mutant	892	X
27433	Double knot toxin (DkTx)	941	X
27434	1H chemical shift assignment of the Interfacial contact of phycocyanobilin chromophore in the plant phytochrome A in its Pfr state.	106	X
27435	NMR assignments of Decorator, a phage-cementing 15 KDa monomer	1340	X
27436	Backbone and side-chain resonance assignments of the methyl-CpG-binding domain of MBD6 from Arabidopsis thaliana	823	X
27437	1H, 13CA, 13CB and 15N chemical shift assignments of b2-microglobulin and a-chain of the neonatal Fc receptor	351	X
27438	Competitive Regulation of the Cold Sensing Ion Channel TRPM8 by PIP2 and PIRT	324	X
27439	Sph15	1096	X
27440	Long-range effects induced by peptide-MHC binding to a human T cell receptor: Implications for the initiation of T cell signaling	630	X
27441	Long-range effects induced by peptide-MHC binding to a human T cell receptor: Implications for the initiation of T cell signaling	860	X
27442	Backbone 1H, 13C, and 15N Chemical Shift Assignments for residues 1-136 of yeast Rpn5.	1567	X
27443	13C and 15N assignment of C', CA, CB and N of quail Osteopontin at 310K	896	X
27445	Backbone Assignment of GII.4 Saga Norovirus Protruding Domain	1265	X
27446	Assignment of the apo-form of the human C-terminal domain of UDP-Glucuronsyltransferase A1 (UGT1A)	783	X
27447	Backbone and side-chain methyl relaxation rates, methyl order parameters, and stereospecific resonance assignments for Zn(II) AdcR	1059	X
27448	Backbone and side-chain methyl relaxation rates, methyl order parameters, and stereospecific resonance assignments for apo-AdcR	1029	X
27449	Backbone 1H, 13, 15N Chemical Shifts for Repressor of Primer (Rop) Variant C38A C52V (Ala-Val)	249	X
27450	Backbone 1H, 15N, 13C assignments for Wild-Type Repressor of Primer (Rop)	306	X
27451	Backbone 1H, 15N, 13C chemical shifts for Repressor of Primer (Rop) variant IVVA	307	X
27452	NMR resonance assignment for the SAM/SAH binding riboswitch RNA bound to S-Adenosylhomocysteine	733			X
27453	NMR resonance assignments for an Legionella pneumophila ProQ-homolog	1471	X
27455	side-chain methyl order parameters for apo CzrA L34A mutant at 25C-40C	757	X
27457	13C, 15N solid-state NMR assignments of human histone H4 in nucleosome core particle	372	X
27458	Backbone and Side-chain Chemical Shift Assignments for MarH	1391	X
27459	side-chain methyl order parameters for Zn(II)-bound CzrA L34A mutant at 25C-40C	738	X
27460	chemical shift assignnment of recombinant repetitive domain of spider dragline silk	2335	X
27461	Human TGIF1 c-term domain	305	X
27462	Backbone chemical shift assignments for Apo form of Biliverdin reductase B	1345	X
27463	Backbone chemical shift assignments for Holo form of Biliverdin reductase B	734	X
27464	C-terminal tail of Protein Phosphatase 1, alpha isoform.	107	X
27466	Chemical shift assignments of the C-terminal domain of human FAT10	12	X
27467	Solution structure of FAT10	913	X
27468	Isoleucine-, leucine-, valine-, alanine-, methionine-, threonine-methyl and backbone chemical shift assignment of gp17.1	963	X
27469	1H, 15N, 13C backbone resonance assignments of pentaerythritol tetranitrate reductase from Enterobacter cloacae PB2 in complex with 1,4,5,6-tetrahydro-NADP	1703	X
27470	1H, 15N, 13C backbone resonance assignments of pentaerythritol tetranitrate reductase from Enterobacter cloacae PB2 in complex with 1,4,5,6-tetrahydro-NAD	1697	X
27471	peptide AapA1 toxin of Helicobacter pylori	253	X
27472	NMR 1H,13C,15N resonance assignment of the G12C mutant of human K-Ras bound to GppNHp	1163	X
27473	NMR Parameters for the Short Isoform of Hypogastrura harveyi "snow flea" Antifreeze Protein	454	X
27475	NMR assignments of the mammalian proteasome subunit DSS1.	406	X
27476	Cardiac troponin I_135-209 chemical shift	748	X
27477	The complete 1H, 13C, 15N chemical shift assignment of the Itch HECT C-lobe	1570	X
27478	Structural studies suggest aggregation as one of the modes of action for teixobactin	134	X
27479	Structural studies suggest aggregation as one of the modes of action for teixobactin	117	X
27480	Structural studies suggest aggregation as one of the modes of action for teixobactin	146	X
27481	Partial 1H, 13C, and 15N assignments of DFsc	1196	X
27482	Amide backbone chemical shift assignments for SET nuclear proto-oncogene.	289	X
27483	Backbone assignment of ICP27 1-138	649	X
27484	Backbone assignment of KSHV ORF57 68-178	186	X
27485	Chemical shift data of [P13A]PeIA	104	X
27488	ASK1-TBD	962	X
27489	1H, 15N, 13C Assignment of rS1-D5	402	X
27490	1H, 15N Assignment of rS1-D345	714	X
27491	1H Chemical Shift Assignments for SG4 variant of Schistocerca gregaria protease inhibitor 2	170	X
27492	1H Chemical Shift Assignments for SG5 variant of Schistocerca gregaria protease inhibitor 2	191	X
27493	1H, and 15N Chemical Shift Titration Study of Copper Binding Lipoprotein (bsCopL)	260	X
27494	Backbone 1H, 13C, 15N chemical shifts of deubiquitinase A	587	X
27495	Backbone 1H, 13C, 15N chemical shifts of deubiquitinase A phosphorylated at Ser177	597	X
27496	PLCg1 constructs	2482	X
27497	Human titin ZIg10	1016	X
27498	1H, 15N and 13C resonance assignments of the C-terminal domain of the P protein of the Nishigahara strain of rabies virus	1358	X
27499	SFRS1-RRM1	225	X
27500	1H, 13C, and 15N Chemical Shift Assignments for SP5 variant of SPINK1	339	X
27501	1H and 15N Chemical Shift Assignments for SP6 variant of SPINK1	240	X
27502	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Histidine Kinase NsaS from S. aureus	491	X
27503	Backbone and side chain NMR assignments for the ribosome Elongation Factor P (EfP) from Staphylococcus aureus	1382	X
27506	Chemical shift assignment of the viral protein genome-linked (VPg) from Potato virus Y	1307	X
27508	Backbone resonance assignemnts of a Smurf2 HECT domain C-lobe mutant	460	X
27509	Backbone 1H, 13C, and 15N Chemical Shift Assignments for hFABP1 triple-mutant (K57A,E77A,K96A)	487	X
27510	Backbone 1H, 13C, and 15N Chemical Shift Assignments for hFABP1 triple-mutant (K57A,E77A,K96A)in complex with GW7647	485	X
27511	Backbone resonance assignment of a Huwe1 HECT domain C-lobe mutant	471	X
27512	Backbone resonance ssignment of the human ubiquitin G76C mutant	282	X
27513	NMR measurements reveal the structural basis of transthyretin destabilization by pathogenic mutations	349	X
27514	NMR measurements reveal the structural basis of transthyretin destabilization by pathogenic mutations	473	X
27515	NMR measurements reveal the structural basis of transthyretin destabilization by pathogenic mutations	460	X
27516	NMR measurements reveal the structural basis of transthyretin destabilization by pathogenic mutations	352	X
27517	Backbone 1H, 13C, and 15N Chemical Shift Assignments for HTLV-1 HBZ 3-56	208	X
27518	chemical shifts assignments of Nb26 against aflatoxin B1	1338	X
27519	Solution NMR chemical shift assignments of nanobody Nb11 specific for aflatoxin B1	1281	X
27520	Backbone 1H, 13C, and 15N Chemical Shift Assignments for SHP2 (1-529)	1400	X
27521	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the phosphatase domain of SHP2 (216-529)	981	X
27522	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the tandem-SH2 domain of SHP2 (1-217) with a point mutation E76K	773	X
27523	1H, 13C, and 15N Chemical Shift Assignments for the pRN1 helix bundle domain	1165	X
27524	Sequence specific 1H, 13C and 15N resonance assignments of the C-terminal domain of human Gamma S-Crystallin	1007	X
27525	Human T-cell immunoglobulin and mucin domain containing protein- 3	370	X
27526	Backbone 1H, 13C, and 15N Chemical Shift Assignments for alpha-N catenin actin-binding domain H1 mutant	934	X
27527	Backbone resonance assignments of the N-terminal domain of FAT10	307	X
27528	Backbone Assignments for human WDR5	1350	X
27529	backbone resonance assignment of USP7 UBL45 domains (residues 884-1102)	808	X
27530	apoCaM bound to Cav1.2 IQ	230	X
27531	Backbone chemical shift assignment of Macrophage infectivity potentiator virulence factor of Trypanosoma cruzi	717	X
27532	Backbone and side chain NMR assignments for the ribosome Binding Factor A (RbfA) from Staphylococcus aureus	831	X
27533	NBPF-15 HLS2-domain	383	X
27536	1H, 13C and 15N chemical shift assignments for carbohydrate binding module x (CBMx)	1545	X
27537	Chemical Shift Assignments for the C-terminal domain of histone H1.0	434	X
27538	Chemical Shift Assignments for the triphosphorylated C-terminal domain of histone H1.0	442	X
27539	Influenza A virus non-structural protein 1 (NS1) effector domain	383	X
27540	1H, 15N, and 13C triple resonance assignments of innate immune evasion protein EapH2 from the S. aureus	541	X
27541	Influenza A virus (2013 H7N9 strain) non-structural protein 1 effector domain	445	X
27542	Macaca fascicularis Eosinophil Cationic Protein backbone assignment	529	X
27543	Backbone assignment of mouse MARCH9 transmembrane domains in LMPG micelles	313	X
27544	Pongo pygmaeus Eosinophil Cationic Protein backbone assignment	503	X
27545	Pongo abelii ribonuclease 3 backbone assignment	486	X
27546	Aotus trivirgatus Eosinophil-Derived Neurotoxin backbone assignment	492	X
27547	Backbone chemical shift assignments of H2A in H2A-H2B dimer	572	X
27548	Ressonance assignments for the human Smad5 MH1 domain	364	X
27549	Backbone 1H, 13C, and 15N Chemical Shift Assignments for TDP-43 RRM2 at 6M urea	237	X
27550	Shr Hemoglobin Interacting Domain 2	921	X
27552	Chemical Shift Assignments for m62A-h45	111			X
27553	1H, 15N, and 13C resonance assignments of the intrinsically disordered SH4 and Unique domains of p59Hck	415	X
27554	1H, 15N, and 13C resonance assignments of the intrinsically disordered SH4 and Unique domains of p61Hck	582	X
27555	Backbone assignment of Rip2Card	311	X
27556	NMR chemical shifts of horse heart cytochrome c bound to 1:1 (molar) TOCL/DOPC vesicles.	202	X
27557	NMR Assignment of Backbone (1H, 15N, and 13C) resonances of Histone Like DNA binding protein of Helicobacter pylori (Hup) at low pH	819	X
27558	Amide chemical shifts of PCNA bound to p15 peptide and DNA	302	X
27559	Apo DNA Polymerase beta ILV Methyl Assignments	305	X
27560	protein-gapped DNA complex (Polymerase beta) ILV Methyl Assignments	304	X	X
27561	protein-gapped DNA-nucelotide complex (Polymerase beta) ILV Methyl Assignments	304	X	X
27562	GB1 crystalline protein U-13C,15N	251	X
27563	14-3-3 Sigma Backbone Assignment	917	X
27564	1H, 13C, 15N NMR Backbone assignments of B. cereus 5/B/6 metallo-beta-lactamase	964	X
27565	Transmembrane protein 106B (TEM106B)	574	X
27566	Backbone assignments of the N domain of bacterial tRNA-(N1G37) methyltransferase (TrmD)	734	X
27569	Human Lineage Specific 1 domain, NBPF15	362	X
27570	Chemical shift assignment of wild-type E.coli diacylglycerol kinase (DGK) by solid-state NMR	535	X
27571	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the bHLHZip c-MYC:MAX complex.	764	X
27572	High-resolution NMR studies of antibiotics in cellular membranes	224	X
27573	Backbone and side chain chemical shifts assignments of uniformly labeled 13C, 15N SUMO1-F64L	755	X
27574	human TGF-b2	974	X
27575	Backbone 1H, 13C, and 15N Chemical Shift Assignments for transthyetin in 5% DMSO	357	X
27576	Backbone 1H, 13C, and 15N Chemical Shift Assignments for A97S TTR in 5% DMSO	360	X
27577	Resonance assignments for Ras-related C3 botulinum toxin substrate 1 bound to GDP and Mg2+	1083	X
27578	Putative methyltransferase WBSCR27 in apo-form.	1262	X
27579	Full Length Apo Pin1	1801	X
27580	Backbone 1H, 15N and 13C Chemical shifts of N-terminal domain of antitoxin VapB46 from Mycobacterium tuberculosis	240	X
27581	1H, 13C, and 15N chemical shift assignments of the Sushi 1 domain of GABAbR1a	914	X
27582	Backbone 1H,15N Chemical Shift Assignments human Pdx1 (146-233)	144	X
27583	The structure of the Pro-domain of mouse proNGF in contact with the NGF domain	429	X
27584	Backbone 1H, 15N, 13C chemical shift assignments for the MAK33 CH2 antibody domain	284	X
27585	Backbone 1H, 15N, 13C chemical shift assignments for MAK33 EV-CH2-SK antibody domain extended variant	288	X
27586	5 and 7 dimensional spectra of alpha-synuclein	683	X
27587	Backbone 1H, 13C and 15N Chemical Shift Assignments for UBE2E1 core domain	614	X
27588	Assignment of E.coli asparaginase (ANSII) by solution NMR	1087	X
27589	Assignment of crystalline E.coli asparaginase II (ANSII) by solid-state NMR	1069	X
27590	Assignment of pegylated E.coli asparaginase II (ANSII) by solid-state NMR	1405	X
27591	Backbone 1H, 13C, and 15N Chemical Shift Assignments for BM11596 strain of P[6] VP8* rotavirus	749	X
27592	Backbone 1H, 13C, and 15N Chemical Shift Assignments for BM13851 strain of P[8] VP8* rotavirus	749	X
27593	1H, 13C, and 15N resonance assignments of N-acetylmuramyl-L-alanine amidase (AmiC) N-terminal domain (NTD) from Neisseria gonorrhoeae	1212	X
27594	Backbone resonance assignments for the CsuC-CsuA/B complex.	1358	X
27595	Sequential backbone resonance assignment of AT-rich interaction domain of BAF200	1151	X
27596	1H, 13C, 15N resonance assignment of the C-terminal domain of the bifunctional enzyme TraI of plasmid R1	1253	X
27597	Backbone 1H, 13C, and 15N Chemical Shift Assignments for p53TAD in complex with S100A4	392	X
27598	XRCC1-BRCT1	450	X
27599	Backbone chemical shifts for super-stable p53 DNA-Binding Domain C5xS	727	X
27600	Ghrelin Binding at its G Protein-Coupled Receptor	32	X
27601	RXDP2ext(1-73)	499	X
27602	13C-15N solid-state chemical shifts of three polymorphs of 6aJL2-R24G amyloid fibrils	715	X
27603	Partial backbone assignments of Cse4 protein in 5M urea	134	X
27605	Dynamics of the leucine zipper of Nek2 kinase	844	X
27606	Backbone and side chain resonance assignment of the NZF domain of HOIL-1L	774	X
27607	Sequence specific chemical shift assignments of the Caenorhabditis elegans SAS-6 N-terminal domain	626	X
27608	MapZ is a multi-functional regulator of FtsZ that controls both the precise positioning of Z-ring and proper timing of Z-ring formation	1819	X
27609	Sequence-specific 1H, 13C, and 15N backbone assignment of Fibronectin type III 13	395	X
27610	Sequence-specific 1H, 13C, and 15N backbone assignment of Fibronectin type III 14	1093	X
27611	Novel antimicrobial peptides from the Arctic polychaeta Nicomache minor share structural similarities with amphibian host-defense peptides	288	X
27612	NMR study of non-structural proteins - 1H, 13C, 15N resonance assignment of macro domain from Mayaro virus (MAYV) in complex with ADP-ribose	1538	X
27613	1H, 15N and 13C backbone assignment of apoTDP-43 RNA Recognition Motifs	719	X
27614	NMR resonance assignments of the TPR domain of human AIPL1	790	X
27615	Backbone and aliphatic side-chain NMR resonance assignments of fragment of human LSD1 (residues 100-151)	600	X
27616	Backbone 1H, 13C, and 15N Chemical Shift Assignments for CBX8 chromodomain	199	X
27617	1H, 13C, and 15N backbone chemical shift assignments of KPC-2	1257	X
27618	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Dss1	336	X
27619	Backbone assignments of the bacterial tRNA-(N1G37) methyltransferase (TrmD)	1030	X
27620	human CYPA/PPIA	787	X
27621	Backbone 1H, 15N, 13C assignment of DfdT337-K426.	493	X
27622	Backbone assignment of HOX protein SCR	525	X
27623	Klebsiella pneumoniae sigma4 of sigma70 fused to the beta-flap-tip helix	945	X
27624	Klebsiella pneumoniae sigma4 of sigmaS fused to the beta-flap-tip helix	1292	X
27625	1H, 13C, 15N assignment of the CD44 cytoplasmatic tail (669-742)	364	X
27626	1H, 13C, and 15N Chemical Shift Assignments for the SAH domain from mouse myosin 7a	1026	X
27627	Backbone Assignment Ubl45 domain of USP7	943	X
27628	Backbone 1H, 13C, and 15N Chemical Shift Assignments for SIRT1 183-233	199	X
27629	1HN,15N,13CO,13CA and 13CB Chemical Shift Assignments for the FBP21(326-276) Fragment	232	X
27630	1HN,15N,13CO,13CA and 13CB Chemical Shift Assignments for the FBP21(326-276) Fragment in Complex with the Brr2-CSec63 domain	231	X
27631	Backbone amide and AILV methyl chemical shift assignments for HLA-A*02:01, a human class I major histocompatibility molecule heavy chain.	1521	X
27632	Backbone amide and AILV methyl chemical shift assignments for HLA-A*01:01, a human class I major histocompatibility molecule heavy chain	1590	X
27633	Chemical shift assignments of the C-terminal domain of chicken H1.11L	142	X
27634	1H, 13C, and 15N Chemical Shift Assignments of the C-terminal region of the Menangle virus Phosphoprotein	1495	X
27636	Thioredoxin-huntingtin exon 1(Q7) fusion	596	X
27637	Backbone NMR assignment of the apo form of Jug r 3, the non-specific lipid transfer protein from walnut.	380	X
27638	Backbone NMR assignment of the oleate bound form of Jug r 3, the non-specific lipid transfer protein from walnut.	272	X
27639	C55 13C Chemical Shifts	21	X
27640	Chemical Shifts of KCNE1TVG in LMPG micelles	529	X
27641	Backbone 1H, 13C, and 15N Chemical Shift Assignments for MPS1	1037	X
27642	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Mps1 TPR domain	805	X
27643	Chemical shifts of the WH domain of human ORC2	1263	X
27645	Backbone 1H, 13C and 15N chemical shift assignment of the PDZ domain of the protein tyrosine phosphatase non-receptor type 3 complexed with the HPV16 E6 oncoprotein C-terminal peptide	426	X
27646	Full assignment of 13C,15N-labeled oncogenic mutant human KRas4B-G12C(1-169) bound to GDP at physiological pH	1131	X
27647	Backbone 1H, 13C, and 15N Chemical Shift Assignments for phosphorylated KID domain (C90A, V118D) of CREB	458	X
27648	Backbone 1H, 13C, and 15N Chemical Shift Assignments for KID domain (C90A, V118D) of CREB	370	X
27649	hnRNPA2 low complexity domain 266-341 backbone and Cbeta chemical shifts	340	X
27651	Conformational Changes in the Cytoplasmic Region of KIR3DL1 upon Interaction with SHP-2	491	X
27652	NZ118	111		X
27653	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the N-terminal Domain of ING5	440	X
27654	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Plant Homeodomain (PHD) of ING5	345	X
27655	Backbone assignments and relaxation rates for Zn(II) L57M AdcR	284	X
27656	Backbone assignments and relaxation rates for apo L57M AdcR	274	X
27659	Backbone assignment of human ribonuclease 6	540	X
27661	Amide chemical shifts of human PCNA bound to p12 peptide	404	X
27662	amide chemical shifts of human PCNA bound to RecQ5 peptide	436	X
27663	HKU4 NSP3 C Domain	944	X
27664	UbcH7-Ub isopeptide conjugate	404	X
27666	Resonance assignment of human LARP4A La module	1736	X
27667	Backbone resonance assignment of the catalytic and ATP-binding domain of HK853 from Thermotoga maritime	958	X
27668	Backbone 1H and 15N Chemical Shift Assignments for bovine BLG A at pH 2.65, 3.2, and 4.0	838	X
27669	Amide chemical shifts of full-length human HuR	424	X
27670	HuR GGS	440	X
27671	Amide chemical shifts of human HuR RRM3	139	X
27672	NMR backbone and methyl assignment of G-protein alpha i,1 subunit bound to GDP	1255	X
27673	backbone chemical shift assignments of full length rat adrenodoxin	261	X
27674	Chemical shifts for C-tail of the apelin receptor in LPPG micelles.	236	X
27676	1H/13C/15N Assignments for the TM domains of the KcsA potassium channel	159	X
27677	Resonance Assignments for the PWWP-ARID domain of human RBBP1	2612	X
27678	1H/13C/15N Assignments for the TM domains of the KcsA potassium channel	167	X
27679	1H/13C/15N Assignments for the TM domains of the KcsA potassium channel	147	X
27680	1H/13C/15N Assignments for the TM domains of the KcsA potassium channel	138	X
27681	Chemical shift assignments for HSPB1 containing residues 1-176	494	X
27682	Backbone amide and AILV methyl chemical shift assignments for H2-Ld, a mouse class I major histocompatibility molecule heavy chain	1464	X
27683	Euprosthenops australis major ampullate spidroin 1 N-terminal domain (NTD) mutant at pH7	1466	X
27684	CXCL3	264	X
27687	NMR resonance assignments of the peach allergen Pru p 1	1714	X
27688	Chemical Shift Assignments for Interleukin-36beta isoform-2	1787	X
27689	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Vibrio cholerae DciA 1-111	796	X
27690	MtFKBP	1463	X
27691	Backbone assignment of the periplasmic glycoside hydrolase BoMan26A	1584	X
27692	Backbone Chemical Shift Assignments for Ca+-Bound Calmodulin Mutant (D21A/D23A/D25A/E32A D57A/D59A/N61A/E68A) Bound to CaV1.2 IQ Motif	1104	X
27693	Backbone and Sidechian 1H, 13C, and 15N Chemical Shift Assignments for Escherichia Coli Periplasmic Chaperone HdeA at pH 1.5	959	X
27694	aromatic 1H, 13C chemical shift assignments for apo FKBP12 C22A	84	X
27695	aromatic 1H, 13C chemical shift assignment for FK506 bound FKBP12 C22A	44	X
27696	NMR assignment of doubly monoubiquitinated p15	626	X
27697	1H, 15N, 13C backbone resonance assignments of the D10N variant of beta-phosphoglucomutase in a transition state analogue complex with glucose 6-phosphate and AlF4-	1064	X
27698	p15CCSS	406	X
27699	Human linker histone NGH1x in high ionic strength conditions	494	X
27700	Human linker histone NGH1x in low ionic strength conditions	521	X
27701	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Myc bHLH-LZ domain in presence of 3.2 M GdmCl	423	X
27702	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Myc bHLH-LZ domain in presence of 2.4 M GdmCl	336	X
27703	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Myc bHLH-LZ domain in presence of 1.6 M GdmCl	336	X
27704	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Myc bHLH-LZ domain	213	X
27705	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Guanylate Cyclase Activating Protein-5 (GCAP5) in Zebrafish Photoreceptors	1551	X
27706	EZH2 SANT1	420	X
27707	Domain 4 of Suilysin	408	X
27708	Backbone 1H, 13C and 15N chemical shift assignment of myristoylated SH4-Unique-SH3 domains or myrUSH3 AAA (2-150; L63A, F64A, G65A) of human SRC	887	X
27709	Backbone assignment of mouse MARCH9 transmembrane domains in TDPC:SDS micelles	247	X
27711	Chemical shifts of calmodulin C-terminal lobe in complex with KN-93	281	X
27712	15N chemical shifts of calmodulin N-terminal lobe in complex with KN-93	173	X
27713	Androgen Receptor (AR) polyQ-derived peptide L4Q4	44	X
27714	Androgen Receptor (AR) polyQ-derived peptide L4Q8	74	X
27715	Androgen Receptor (AR) polyQ-derived peptide L4Q12	155	X
27716	Androgen Receptor (AR) polyQ-derived peptide L4Q16	103	X
27717	Androgen Receptor (AR) polyQ-derived peptide L4Q20	135	X
27718	Backbone 1H, 15N assignment of 15N-labeled oncogenic mutant human KRas4B-G12V(1-169) bound to GDP at physiological pH	328	X
27719	Backbone 1H, 15N assignment of 15N-labeled oncogenic mutant human KRas4B-G12D(1-169) bound to GDP at physiological pH	326	X
27720	Backbone 1H, 15N assignment of 15N-labeled wildtype human KRas4B(1-169) bound to GDP at physiological pH	328	X
27721	Backbone, methyl and Arg Ne chemical shift assignments, relaxation data and order parameters of Galectin-3 bound to S	422	X
27722	Backbone, methyl and Arg Ne chemical shift assignments, relaxation data and order parameters of Galectin-3 bound to R	504	X
27724	NMR Assignments of the apo-form of Aedes aegypti odorant binding protein 22	507	X
27725	1H, 13C and 15N resonance assignments of the second peptidyl-prolyl isomerase domain of chaperone SurA from Escherichia coli	1387	X
27726	Arf1_L8K_GTPgS	793	X
27727	Inhibitor-interaction, dimerization and activity change of HIV-1 protease mutants evolved under drug-pressure	506	X
27728	Structure determination of N-terminal fragment of UL49.5 protein from bovine herpesvirus 1 by NMR spectroscopy and molecular dynamics	218	X
27729	IL37 53-206 dimer	838	X
27730	Structure determination of transmembrane- C-terminal fragment of UL49.5 protein from bovine herpesvirus 1 by NMR spectroscopy and molecular dynamics	256	X
27731	Inhibitor-interaction, dimerization and activity change of HIV-1 protease mutants evolved under drug-pressure	513	X
27732	15N, 13C and 1H backbone resonance assignments of the apo FKBP12 protein from Aspergillus fumigatus	1179	X
27733	15N, 13C and 1H backbone resonance assignments of the FKBP12 protein from Aspergillus fumigatus bound to FK506	634	X
27734	15N, 13C and 1H backbone resonance assignments of FKBP12 from the pathogenic fungi Mucor circinelloides	829	X
27737	15N, 13C and 1H backbone resonance assignments of FKBP12 protein from the pathogenic fungi Mucor circinelloides bound to FK506	891	X
27738	15N, 13C and 1H backbone resonance assignments of Human FKBP12 protein	609	X
27739	15N, 13C and 1H backbone resonance assignments of Human FKBP12 protein bound to FK506	602	X
27740	Backbone chemical shift assignments of the calcium-saturated human calmodulin C-domain bound to the human NaV1.2 IQ motif peptide	485	X
27741	Backbone Assignments of Bacillus subtilis Holo-Copper Binding Lipoprotein (bsCopL) with Cu(I).	222	X
27742	hSmad2 MH1 domain	532	X
27743	hSmad2-beta MH1 domain	490	X
27744	Backbone chemical shift assignments of translation initiation factor 3 from Pseudomonas aeruginosa	1993	X
27745	Backbone chemical shift assignments of the calcium-saturated human calmodulin bound to the human NaV1.2 IQ motif peptide	764	X
27746	The conduction pathway of potassium channels is water-free under physiological conditions	132	X
27747	Assignment of the ARC4 domain of human Tankyrase	360	X
27750	G335A TDP-43_267-414	541	X
27751	G335N TDP-43_267-414	541	X
27752	1H and 13C assignment of cyclosporine B in CDCl3	170	X
27753	The cytoplasm-entry domain of antibacterial CdiA is a dynamic alpha-helical bundle with disulfide-dependent structural features	1404	X
27754	The cytoplasm-entry domain of antibacterial CdiA is a dynamic alpha-helical bundle with disulfide-dependent structural features	1384	X
27755	The cytoplasm-entry domain of antibacterial CdiA is a dynamic alpha-helical bundle with disulfide-dependent structural features	1403	X
27756	Assigned 1H NMR Chemical Shifts for endomorphin-1 in 10 mM phosphate pH 7.0	84	X
27757	Backbone assignment of SQT-1N	476	X
27759	1H and 15N Chemical assignment for NSL2-pep of BRMS1	79	X
27761	Backbone 1H, 13C, and 15N Chemical Shift Assignments for ARNO Sec7	783	X
27762	Resonance Assignment of the 128 kDa Enzyme I dimer from Thermoanaerobacter tengcongenesis	1302	X
27763	FoxM1 Transactivation Domain	284	X
27764	FoxM1 Transactivation Domain, Phosphorylated form	262	X
27767	Backbone 1H, 13C, and 15N Chemical Shift Assignments for bacteriophage protein Gp46	989	X
27768	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the ShkA kinase Rec1 domain from Caulobacter crescentus	472	X
27769	GA-branchsite-containing RNA duplex with unmodified U2 snRNA site	237			X
27770	GA-branchsite-containing RNA duplex with pseudouridine-modified U2 snRNA site	240			X
27771	1H,15N and 13C NMR assignments of the Solanum tuberosum Plant Specific Insert at pH 7.0	485	X
27772	1H, 15N,13C assignments of the Solanum tuberosum Plant Specific Insert at pH 2.0	419	X
27774	Backbone 1H, 13C, and 15N Chemical Shift Assignments for PhDim1	1193	X
27775	HLS3_Olduvai	316	X
27776	ssNMR assignment of membrane embedded Rhomboid protease GlpG	459	X
27777	1H-15N HSQC assignment for Insulin-like growth factor 2 mRNA-binding protein 1 domain KH1-2	284	X
27778	Backbone chemical shift assignments of human kappa-casein fragment 24 134 at pH 3.9	651	X
27779	1H and 13C assignment of cyclosporine D in CDCl3	176	X
27780	1H, 13C and 15N resonance assignments for the N-terminal extended region and first CUE domain from chromatin remodeler SMARCAD1	1173	X
27781	NMR assignment of free 1H, 15N and 13C-Grb2-SH2 domain	1128	X
27782	1HN, 13C, and 15N Resonance Assignments of human Calmodulin bound to CaMBP2 peptide	480	X
27783	Backbone 1H, 15N, 13C Chemical Shift Assignment of the Pr state of monomeric PAS-GAF-PHY from Deinococcus radiodurans	1293	X
27784	Backbone 1H, 15N, 13C Chemical Shift Assignment of the Pfr state of monomeric PAS-GAF-PHY from Deinococcus radiodurans	1188	X
27785	1H, 13C and 15N resonance assignments for the first and second CUE domains from chromatin remodeler SMARCAD1	1520	X
27786	Structural basis of specific H2A K13/K15 ubiquitination by RNF168	1640	X
27787	Backbone (1H, 15N, 13C) chemical shift assignments for the CALX-CBD1 domain in the Ca2+-bound state	517	X
27788	G335N TDP-43_267-414	541	X
27789	G335S TDP-43_267-414	541	X
27790	G338A TDP-43_267-414	541	X
27791	Structural basis of specific H2A K13/K15 ubiquitination by RNF168	800	X
27792	Structural basis of specific H2A K13/K15 ubiquitination by RNF168	320	X
27793	NMR resonance assignments of the T102R mutant of the EVH1 domain of neurofibromin's recruitment factor Spred1	588	X
27794	1H, 13C, and 15N chemical shift assignments of the GTP 9-12 RNA aptamer in complex with GTP	800			X
27795	FLNa4-6	1106	X
27796	Chemical Shift Assignments for native alpha-synuclein	810	X
27797	Chemical Shift Assignments for alpha-synuclein homogeneously modified with CEL	816	X
27798	1H, 13C and 15N backbone chemical shift assignments of a mutated variant of UBE2S C95S/C118M/K100C	697	X
27799	1H, 13C and 15N backbone chemical shift assignments of an Ube2S (C95S/C118M/K100C) - ubiquitin (G76C) -conjugate	449	X
27800	1H and 13C assignment of cyclosporin C in CDCl3	172	X
27801	Backbone 1H, 13C, and 15N chemical shift assignments for RCAN1 residues 128-164	133	X
27802	Backbone 1H and 15N Chemical Shift Assignments for K11C mutant of ubiquitin including propargyl acrylate linker	140	X
27803	Backbone 1H and 15N Chemical Shift Assignments for K11C mutant of ubiquitin	140	X
27804	Backbone 1H and 15N Chemical Shift Assignments for K11-linked ubiquitin dimer artificially conjugated via propargyl acrylate	140	X
27805	Backbone 1H and 15N Chemical Shift Assignments for K27C mutant of ubiquitin including propargyl acrylate linker	142	X
27806	Backbone 1H and 15N Chemical Shift Assignments for K27C mutant of ubiquitin	142	X
27807	Backbone 1H and 15N Chemical Shift Assignments for K27-linked ubiquitin dimer artificially conjugated via propargyl acrylate	144	X
27808	Backbone 1H and 15N Chemical Shift Assignments for K63C mutant of ubiquitin including propargyl acrylate linker	140	X
27809	Backbone 1H and 15N Chemical Shift Assignments for K63C mutant of ubiquitin	140	X
27810	Backbone 1H and 15N Chemical Shift Assignments for K63-linked ubiquitin dimer artificially conjugated via propargyl acrylate	140	X
27811	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Elongation factor P from E.coli	635	X
27812	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the intrinsically disordered NHE1 distal tail phosphorylated at six sites by ERK2	614	X
27813	Amide chemical shifts of human IMP3 RRM1-2 (1-156)	290	X
27814	Backbone 1H, 13C, and 15N Chemical Shift Assignments of both isoforms of ITSN1 SH3A	225	X
27815	Human IMP3 KH1-2 amide chemical shifts	318	X
27816	Human IMP3 KH1-2 delta2 amide chemical shifts	312	X
27817	Backbone 1H, 13C, and 15N Chemical Shift Assignments of ITSN1 SH3D20	175	X
27818	Backbone 1H, 13C, and 15N Chemical Shift Assignments of ITSN1 L_SH3A	170	X
27819	Backbone 1H, 13C, and 15N Chemical Shift Assignments of ITSN1 SH3A_L	162	X
27820	Backbone 1H, 13C, and 15N Chemical Shift Assignments of ITSN1 L_SH3D20	218	X
27821	Backbone 1H, 13C, and 15N Chemical Shift Assignments of ITSN1 SH3D20_L	167	X
27825	Backbone chemical shift assignments of RNase H domain bound to ZW566	400	X
27826	Backbone chemical shift assignments of RNase H domain bound to YLC2-155	393	X
27827	Human IMP3 KH1-2 delta 1 amide chemical shifts	290	X
27828	Chemical shifts for d(CGATATCG)2; free form	50		X
27829	Chemical shifts for intercalation complex between d(CGATATCG)2 and C-1305	100		X
27830	Backbone 1H, 13C and 15N Chemical Shift Assignment of complex of MarH with L-Trp	978	X
27831	Backbone chemical shiftsof human Mtr4 KOW	525	X
27832	Methyl Chemical shift Assignment of EIC from the thermophile thermoanaerobacter tengcongenesis	376	X
27833	tEIN backbone and I/L/V methyl resonance assignment	1589	X
27834	Sequence Specific Assignment of OSR1 C-terminal Domain.	407	X
27835	HRdup moPrP 118-231	633	X
27836	Backbone 1H, 15N, and 13C Chemical Shifts of Myosin VI Medial Tail Domain	252	X
27837	Backbone 1H, 13C, and 15N Chemical Shift Assignments for RepA	642	X
27838	Backbone 1H, 13C and 15N chemical shift assignment of the cyclase IdmH from the indanomycin NRPS/PKS from Streptomyces antibioticus	658	X
27839	Iga1 Protease G5 domain	868	X
27840	Backbone 1H, 13C, and 15N chemical shift assignments for the ligand-binding domain of human ionotropic glutamate receptor 2 complexed with glutamate	1232	X
27841	Backbone 1H, 13C, and 15N chemical shift assignments for the T686A variant of the ligand-binding domain of human ionotropic glutamate receptor 2 complexed with glutamate	1236	X
27842	Backbone 1H, 13C, and 15N chemical shift assignments for the T686S variant of the ligand-binding domain of human ionotropic glutamate receptor 2 complexed with glutamate	982	X
27843	Backbone 1H, 13C, and 15N chemical shift assignments for the ligand-binding domain of human ionotropic glutamate receptor 2 complexed with kainate	992	X
27844	Backbone 1H and 15N Chemical Shift Assignments for Proteasome Assembling Chaperone 3	212	X
27845	Solid-state NMR backbone assignment of HBV core protein at 100 kHz	541	X
27847	Backbone resonance assignments and secondary structures of Ebola Nucleoprotein 600-739 construct.	663	X
27848	Backbone 1H, 13C, and 15N Chemical Shift Assignments of co-repressor nuclear receptor interacting domain N-CoR NID	983	X
27850	ENDD G5 domain	351	X
27851	Backbone resonance assignments of the PRY-SPRY domain of RNF135	1067	X
27852	NMR resonance assignments for the GSPII-B domain of the traffic ATPase PilF from Thermus thermophilus in the apo and c-di-GMP-bound states	1823	X
27853	NMR resonance assignments for the GSPII-B domain of the traffic ATPase PilF from Thermus thermophilus in the apo and c-di-GMP-bound states	1876	X
27854	Human DC-SIGN Carbohydrate Recognition Domain	798	X
27856	Resonance assignments of N terminal Receiver domain of Sigma factor S regulator RssB from Escherichia coli	1530	X
27857	Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments of RbfA	1471	X
27858	Assignment of R32A mutant of yeast Hsp90 N-terminal domain	901	X
27859	hCA II S50C C206S labelled with Lu-DOTA-M8	1122	X
27860	Calcium sensing via EF-hand 4 enables thioredoxin activity in the sensor-responder protein calredoxin	60	X
27861	Characterization of H/D Exchange in Type 1 Pili by Proton-Detected Solid-State NMR and Molecular Dynamics Simulations	806	X
27862	NMR 1H chemical shift assignment heptapeptide EVNPAVP	47	X
27863	NMR 1H chemical shifts assignment heptapeptide EVNPPAP	74	X
27864	New insights into the mechanism and specificity of Pro-Pro endopeptidase-1	49	X
27865	Calcium sensing via EF-hand 4 enables thioredoxin activity in the sensor-responder protein calredoxin	60	X
27866	A ubiquitin-like dimerization domain controls protein kinase D activation by trans-autophosphorylation	345	X
27867	chemical shifts assignments of TGIF1-RD2a	1273	X
27868	Backbone 1H, 13C and 15N chemical shift assignment for CHIKV HVD	1209	X
27869	Backbone assignment of cytochrome PccH, a crucial protein for microbial electrosynthesis in Geobacter sulfurreducens	1260	X
27870	Backbone 1H, 13C, and 15N Chemical Shift Assignments for I-domain of Human Integrin alpha M (CD11b)	810	X
27872	Backbone 1H and 15N chemical shifts for wt AcpP, titrated with 0.00, 0.50, 1.00, 1.50, and 2.00 equivalents of FabB	720	X
27873	Solution structure of an alpha sheet hairpin peptide	228				X
27874	Backbone 1H and 15N chemical shifts for D38A AcpP, titrated with 0.00, 0.50, 1.00, 1.50, and 2.00 equivalents of FabB	720	X
27875	Solution Structure of the RAZUL domain from 26S proteasome subunit hRpn10/S5a complexed with the AZUL domain from E3 ligase E6AP/UBE3A	1618	X
27876	NMR resonance assignment for the GSPII-C domain of PilF from Thermus thermophilus in complex with c-di-GMP	2382	X
27877	Inseparable mixture of cytotoxins 2 and 3 Naja kaouthia in major and minor forms	1847	X
27878	K1-K9 fragments of beta2-microglobulin	160	X
27879	Resonance assignemnt of HpDnaB:ADP:AlF4-:DNA	1201	X
27880	1H, 13C, 15N Backbone chemical Shift Assignment of the RYMV-encoded viral supressor of RNA silencing P1 protein	891	X
27881	Iron is a physiological ligand of SecA-like Metal Binding Domains	90	X
27882	Backbone 1H, 13C, 15N chemical shift assignments for the ShkA kinase Rec2 domain from Caulobacter crescentus	381	X
27883	Backbone assignment of HMGA1a S64C mutant	379	X
27884	Backbone assignment of HMGA1a S64C mutant phosphorylated by Casein Kinase 2	350	X
27885	Backbone 1H, 13C, and 15N chemical shift assignments for the N-terminal domain of Sfr1	829	X
27886	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Shaker-VSD	865	X
27887	Backbone (1H and 15N) Chemical Shift Assignments and Relaxation Parameters for the low complexity domain of FUS in the condensed phase	145	X
27888	BlaC in free form	752	X
27890	BlaC in bound to clavulanic acid	677	X
27893	Constutively active Mutant D99N LicT-CAT-PRD1	1643	X
27894	Backbone assignment of human FOXO1	410	X
27895	Backbone 1H, 13C, and 15N Chemical Shift Assignments for dimerization domain of NF-kappaB p50 subunit	596	X
27900	Identification of a short peptide motif in the N-terminal region of alpha-synuclein that plays a critical role in aggregation and function	1314	X
27901	Identification of a short peptide motif in the N-terminal region of alpha-synuclein that plays a critical role in aggregation and function	572	X
27902	S64V-EmrE assignments	1040	X
27903	Clr4 1-191	346	X
27904	Backbone 1H, 13C, and 15N Chemical Shift Assignments for human Fis1 residues 1-125	702	X
27905	Clr4 1-191 NCP	346	X
27911	1H, 13C and 15N NMR chemical shift assignments of cAMP-regulated phosphoprotein-19 and -16 (ARPP19 and ARPP16)	560	X
27912	1H, 13C and 15N NMR chemical shift assignments of cAMP-regulated phosphoprotein-19 and -16 (ARPP19 and ARPP16)	652	X
27913	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the C-terminal Fragment of a Kinesin KIF4A Variant	154	X
27914	Backbone 1H, 13C, and 15N Chemical Shift Assignments for AIMP2 121-320 double-mutant (C205S,C291S)	918	X
27915	NFkappaB p50DD homodimer	441	X
27916	p50 heterodimer	428	X
27917	1H, 13C, and 15N chemical shift assignments of COG4197, a monomeric Cro family member related to HigA	1199	X
27920	1H, 15N, 13C backbone resonance assignments of the P146A variant of beta-phosphoglucomutase	1000	X
27922	scAtg3(del 1-18, 86-159, 248-278)	519	X
27923	scAtg3FR(86-159)	347	X
27924	scAtg8(K26P,C33V,G116C)	392	X
27925	NMR assignments of capsid protrusion domain of dragon grouper nervous necrosis virus	1522	X
27926	RTNLB13_APH_16	88	X
27927	RTNLB13_APH_18	89	X
27928	RTNLB13_APH_22	111	X
27929	BlaC bound to avibactam	701	X
27930	Human Kibra WW domain chemical shift	295	X
27931	Unfolded ZnF in FUS (371-526) prion-like domain	603	X
27932	Folded ZnF in FUS (371-526)	596	X
27934	Backbone 1H, 13C and 15N resonance assignments for IMP2 KH34	640	X
27935	Backbone 13C, and 15N Chemical Shift Assignments for C3 domain of Adhesin P1.	578	X
27936	NMR backbone assignment of full-length human 4E-BP1	367	X
27937	NMR backbone assignment of full-length human 4E-BP1 I15A F114A mutant	371	X
27938	NMR backbone assignment of full-length human phosphorylated 4E-BP1 S65A T70A S83A mutant	377	X
27939	NMR backbone assignment of full-length human phosphorylated 4E-BP1 T70E mutant	409	X
27943	Backbone 1H, 13C, and 15N Chemical Shift Assignments of reduced human DJ-1	890	X
27944	Backbone 1H, 13C, and 15N Chemical Shift Assignments for ribosomal protein bL12 S89C	587	X
27945	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Free Cellular Retinoic Acid Binding Protein 2	570	X
27946	Backbone 1H, 13C, and 15N Chemical Shift Assignments for RA-bound Cellular Retinoic Acid Binding Protein 2	595	X
27947	Backbone 1H, 13C, and 15N Chemical Shift Assignments of oxidized (cysteine sulfinic acid 106) human DJ-1	892	X
27948	Backbone 1H, 13C, and 15N Chemical Shift Assignments for ribosomal protein bL12 S89C and with LBT tag	94	X
27949	1H, 13C, 15N Backbone and Sidechain Assignments of HNH from SpyCas9	1056	X
27950	Backbone assignments of apo Vaccinia H1-Related (VHR) protein tyrosine phosphatase (PTP)	805	X
27951	1H, 13C, and 15N Chemical shift assignments of gypsy moth Lymantria dispar pheromone-binding protein 1 (LdisPBP1)	1747	X
27952	Sequence-specific assignments of the P. falciparum PFE0660w J-domain	241	X
27953	Sequence-specific assignments of Plasmodium falciparum PFE0055c J-domain	262	X
27954	Adenylate kinase mutant R119K bound to ATP	316	X
27955	ILVM methyl assignments for Pyrococcus furiosus Rad50 NBD (wild type) with unlabeled Mre11	549	X
27956	ILVM methyl chemical shifts for Pyrococcus furiosus Rad50 NBD (L828F) with unlabeled Mre11	549	X
27957	ILVM methyl chemical shifts for Pyrococcus furiosus Rad50 NBD (D829N) with unlabeled Mre11	549	X
27958	Spin-labeled DNA duplex	618		X
27959	Including protons in solid-state NMR resonance assignment and secondary structure analysis: The example of RNA polymerase II subunits Rpo4/7	1004	X
27960	NMR backbone and sidechain assignments of apo-pyoverdine PvdI, a siderophore from Pseudomonas aeruginosa	122	X
27961	NMR resonance assignments of the hazelnut allergen isoform Cor a 1.0402	1819	X
27962	1H, 15N, and 13C chemical shifts of red abalone FITZAP-8D	224	X
27964	Delta subunit of RNA polymerase from Bacillus subtilis with mutated lisine strecht to glutamic acid	513	X
27965	NMR resonance assignments of the hazelnut allergen isoform Cor a 1.0401	1854	X
27967	NMR resonance assignments of the hazelnut allergen isoform Cor a 1.0403	1832	X
27968	Solution NMR Backbone Resonance Assignments for p150Glued(1-191) of Dynactin	543	X
27969	Backbone amide and MILV methyl chemical shift assignments of mouse Interleukin-2	682	X
27970	ILV(proS) methyl assignment of mIL-2 in complex with JES6-1 scFV antibody	100	X
27971	ILV(proS) methyl assignment of mIL-2 in complex with IL-2Ra (CD25) receptor	124	X
27972	VSV Phosphoprotein 35-106	234	X
27973	Solid-state NMR Chemical Shift Assignments for p150Glued(1-191) of Dynactin	296	X
27974	MILV methyl chemical shift assignments of the R52A mutant of mouse Interleukin-2	240	X
27975	Mouse Lemur Biliverdin B reductase	687	X
27976	Mouse Lemur Biliverdin B bound to NADP	687	X
27977	Solution structure of the PUB domain of human UBXD1 protein	1463	X
27978	Complete 1H, 13C, 15N resonance assignments of the Vpr binding region of hHR23A (residues 223-363)	1810	X
27979	Chemical shifts of Bordetella pertussis effector BteA	485	X
27980	13C-chemical-shifts-for_SPA_amyloid-beta42_oligomer	74	X
27981	Backbone 1H, 13C, and 15N chemical shift assignments for C. elegans STIM EF-SAM in the presence of calcium.	759	X
27982	Backbone 1H, 13C, and 15N chemical shift assignments for C. elegans STIM EF-SAM (form 1) in the absence of calcium.	526	X
27983	Backbone 1H, 13C, and 15N chemical shift assignments for C. elegans STIM EF-SAM (form 2) in the absence of calcium.	548	X
27984	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Cezanne UBA domain (residues 2-55)	206	X
27985	Canine CXCL8	401	X
27986	Mouse CCL2	346	X
27987	Backbone, side chain and heme resonance assignment of the triheme cytochrome PpcA from Geobacter metallireducens in the oxidized state	698	X
27988	Backbone 1H, 13C, and 15N Chemical Shift Assignments for C-terminal tail of human CRY1	443	X
27989	Backbone and side-chain chemical shift assignments of the ribosome-inactivating protein trichobakin (TBK) in solution	2820	X
27990	1H, 13C and 15N assignments of apo ARR_CleD. ARR_CleD is an arginine rich peptide that binds the second messenger c-di-GMP	261	X
27991	Assignment of 1H, 13C and 15N resonances of Influenza A virus (H1N1) Non structural protein 2 (NS2)	970	X
27992	MYB28 116-197 chemical shifts	314	X
27993	MYB29 residues 118-178 chemical shifts	241	X
27994	chemical shift assignments for RCAN1 residues 89-197	350	X
27995	chemical shift assignments for phosphorylated RCAN1 residues 89-197	344	X
27996	Chemical shift assignments of calcineurin catalytic subunit A residues 27-348 in complex with RCAN1 128-164	428	X
27997	Chemical shift assignments for RCAN1 residues 128-164 in complex with calcineurin catalytic subunit A residues 27-348	201	X
27998	Structural basis for client recognition and activity of Hsp40 chaperones	296	X
27999	Structural basis for client recognition and activity of Hsp40 chaperones	276	X
28000	Structural basis for client recognition and activity of Hsp40 chaperones	434	X
28001	Structural basis for client recognition and activity of hsp40 chaperones	254	X
28002	FDX1	410	X
28003	FDX2	437	X
28005	Backbone 1H, 13C, and 15N Chemical Shift Assignments for phosphomimetic mutant of cytoplasmic domain of MapZ protein	618	X
28006	Backbone and Aliphatic Side-chain 1H, 13C, and 15N Chemical Shift Assignments for cytoplasmic domain of MapZ protein	1806	X
28008	HRASG12VGDP	801	X
28009	HRASG12VGMPPNP	652	X
28011	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Mdm2 (residues 284 to 434)	705	X
28012	Backbone resonance assignments for Human Focal Adhesion Targeting domain (892-1052)	1105	X
28014	Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments of RimP from E. coli	1755	X
28015	Full assignment of 13C,15N-labeled oncogenic mutant human KRas4B-G12C(1-169) bound to GTP at physiological pH	736	X
28016	NMR resonance assignments of the hazelnut allergen isoform Cor a 1.0404	1742	X
28017	QBP1+TDP-43 POLYPEPTIDE	277	X
28019	Backbone 1H, 13C, and 15N Chemical Shift Assignments for mouse Mdm2 (residues 282 to 432)	666	X
28020	Backbone 1H, 13C, and 15N Chemical Shift Assignments for human Mdm2 (residues 284 to 434) phosphorylated by DNA-PK	681	X
28021	1H and 15N assignment of 15N-labeled wildtype human KRas4B(1-169) bound to GTP at physiological pH	401	X
28022	1H and 15N assignment of 15N-labeled oncogenic mutant human KRas4B-G12D(1-169) bound to GTP at physiological pH	393	X
28025	human_CIRBP_138-172	70	X
28026	TNPO1_328-381	91	X
28027	human_CIRBP_68-137	162	X
28028	1H, 13C, 15N backbone and side-chain assignment of the native form of UbcH7 (UBE2L3)	1957	X
28029	The short fibrillation segment in FUS-LC domain	68	X
28030	Complete assignment of Ala, Ile, Leu (proS), Met and Val (proS) methyl groups of human Norovirus protruding domain from the GII.4 Saga4/2006 strain	308	X
28031	Chemical Shifts (ppm) of HVEM(14-39) peptide in phosphate buffer (pH 7.4) at 25 C	186	X
28032	Chemical shifts of mouse BTNL2 IgV1 domain	1228	X
28033	Backbone assignments for the Asciz QT2-4/LC8 complex	255	X
28034	Backbone resonance assignments for the HSP27 (HSPB1) alpha-crystallin domain monomer	327	X
28035	Solid-state NMR assignments of the human H3 in the Widom '601' nucleosome core particle	481	X
28036	Shaker-VSD(S2bot_mutant)	820	X
28037	1H, 13C, 15N chemical shift assignments of FKBP12 protein from the pathogenic fungi Candida glabrata	1378	X
28038	1H, 13C, 15N chemical shift assignments of FKBP12 protein from the pathogenic fungi Candida auris	1354	X
28039	Backbone and CB Chemical Shift Assignments for the hSpt5-KOW5 Domain	268	X
28040	Backbone and CB Chemical Shift Assignments of the Methanocaldococcus jannaschii Spt5-KOW domain	313	X
28041	Backbone and CB Chemical Shift Assignments of Vibrio cholerae RfaH	781	X
28042	ubiquitin receptor protein complex	3302	X
28043	Backbone 13C and 15N assignment of lambdaQ	642	X
28045	A short motif in the N-terminal region of a-synuclein plays a critical role in aggregation and function	610	X
28046	RalA.GMPPNP	1944	X
28047	RalA.GDP	877	X
28048	Chemical Shift Assignments for BRG1 ATBD	637	X
28049	ILVM methyl assignments for Pyrococcus furiosus Rad50 NBD (L828A and D829A mutants) with unlabeled Mre11	549	X
28050	1H 15N 13C Resonance Assignments of Receptor Binding Domain 1 of CDTb	675	X
28051	ILVM methyl assignments for Pyrococcus furiosus Rad50 NBD (L828A and D829A mutants) with unlabeled Mre11	549	X
28052	1H, 13C, and 15N chemical shift assignments of the C. diphtheriae methionine sulfoxide reductase B	1355	X
28053	VDAC_E73V assignment in MSP1D1 nanodiscs	498	X
28054	ILVM methyl assignments for Pyrococcus furiosus Mre11 nuclease and capping domain	536	X
28055	Backbone resonance assignments of N-terminal domain of p50 NF-kappaB subunit	743	X
28056	Backbone resonance assignments of the apo form of the solute binding protein PiuA from Streptococcus pneumoniae	1379	X
28057	Backbone resonance assignments of a holo form of the solute binding protein PiuA from Streptococcus pneumoniae	1384	X
28058	NMR assignment of self-processing module of FrpC protein of Neisseria meningitidis loaded with calcium ions	1744	X
28060	HP1	309	X
28061	Backbone and side-chain chemical shift assignments of a cellular FLICE-inhibitory protein (c-FLIPs)	2104	X
28062	Backbone 1H, 13C, and 15N Chemical Shift Assignments for RPT1 of hSNF5 and SWIRM of BAF155	307	X
28063	Backbone 1H, 13C, and 15N Chemical shift Assignments for SWIRM domain of BAF155 and RPT1 of hSNF5	322	X
28064	Solution structure of hSNF5 RPT1 domain	326	X
28065	Backbone N, HN, CO and CA Chemical Shift Assignments for Tau (1-239)	847	X
28066	1H, 13C assignment for cyclosporin D in complex with DPC micelles	155				X
28069	Backbone resonances of the nSH2 domain of SHP2	375	X
28070	Backbone resonances of the cSH2 domain of SHP2	442	X
28071	Backbone resonances of the tandem SH2 domain of SHP2	996	X
28072	Backbone resonances of the cSH2 domain of SHP2 in complex with the ITIM of PD-1	436	X
28073	Backbone resonances of the nSH2 domain of SHP2 in complex with the ITSM of PD-1	396	X
28074	Backbone and sidechain resonances of the nSH2 domain of SHP2 in complex with the ITIM of PD-1	1418	X
28075	Backbone resonances of the tSH2 domain in complex with the bidentate ITIM-ITSM peptide of PD-1. ITIM-bound state.	955	X
28076	Backbone resonances of the tSH2 domain in complex with the bidentate ITIM-ITSM peptide of PD-1. ITSM-bound state.	967	X
28077	Backbone 1H, 13C, 15N chemical shift assignments for BRCT_S3R_V63A	364	X
28079	teEIC backbone and I/L/V methyl resonance assignment	1767	X
28080	etEIC backbone and I/L/V methyl resonance assignment	1805	X
28081	Trimolecular G-quadruplex	203		X
28082	Solution structure of anti-CRISPR protein AcrIF7 from Pseudomonas aeruginosa Phage	770	X
28084	1H, 13C, and 15N backbone assignments of the Brain And Acute Leukemia Cytoplasmic (BAALC) protein	1057	X
28085	1H, 13C, and 15N backbone assignments of the C-terminal region of the human retinoic acid induced protein 2	871	X
28086	Unr CSD789	836	X
28087	dUnr Cterminal Qrich	244	X
28088	dUnr CSD456	695	X
28089	dUnr CSD6	315	X
28090	1H, 13C, and 15N chemical shifts for T4 Gene 60 mRNA 5' Stem-Loop	252			X
28091	Retinoblastoma-like protein 1 / p107	277	X
28092	Art v 3 allergen from Artemisia vulgaris	1408	X
28094	Solution NMR structure of 5'UTR of Stem loop B in DENV4	610			X
28095	1H, 15N and 13C backbone resonance assignments of wild-type substrate-free beta-phosphoglucomutase from Lactococcus lactis with a cis K145-P146 peptide bond (conformer A)	992	X
28096	1H, 15N and 13C backbone resonance assignments of wild-type substrate-free beta-phosphoglucomutase from Lactococcus lactis with a trans K145-P146 peptide bond (conformer B)	958	X
28097	1H, 15N, 13C backbone resonance assignments of the P146A variant of beta-phosphoglucomutase in a transition state analogue complex with glucose 6-phosphate and trifluoromagnesate (MgF3-)	1063	X
28098	Spindly C-terminal region of C.elegans (362-479)	347	X
28099	NMR Assignments of the Programmed Cell Death 5 (PDCD5) Protein from Toxoplasma gondii	1517	X
28100	Chemical shift assignment for human EDC3 residues 104-197	409	X
28101	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Scc4 in Chlamydia Trachomatis	1450	X
28102	Resonance assignments of oxidized BpsDsbA	1951	X
28103	Backbone assignments of reduced BpsDsbA	945	X
28104	Backbone and ILV methyl assignments of human Interleukin-2	747	X
28105	Backbone and ILV methyl chemical shift assignments of REC2 domain from SpyCas9	860	X
28106	Backbone and ILV methyl assignments for HNH domain of SpCas9	672	X
28107	ILVproS methyl chemical shift assignments of HLA-A*02:01, a human class I major histocompatibility complex heavy chain, bound to TAX9 and human beta-2 microglobulin	148	X
28108	ILVproS methyl chemical shift assignments of HLA-A*02:01, a human major histocompatibility complex heavy chain, peptide-deficient and bound to human beta-2 microglobulin and the molecular chaperone TAPBPR	120	X
28109	Backbone 1H, 13C, and 15N Chemical Shift Assignments for human P[4] rotavirus strain BM5265	735	X
28110	Backbone and ILV methyl assignments for REC3 domain of SpCas9	731	X
28111	Backbone 1H, 13C and 15N chemical shift assignments of the N-terminal portion of ALIX-PRD	471	X
28112	1H, 13C, and 15N chemical shift assignments of the Gp4 from the Pseudomonas phage LUZ24	642	X
28113	revmodN_ACC	334	X		X
28114	AILVproS stereospecific methyl chemical shift assignments of HLA-A*01:01, a human class I major histocompatibility complex heavy chain, bound to NRASQ61K neoepitope and human beta-2 microglobulin	356	X
28115	Sequence-specific Backbone Resonance Assignments of Human PrP(23-144) at pH 4.5	596	X
28116	Sequence-specific Backbone Resonance Assignments of Human PrP(23-144) at pH 7.0	590	X
28117	Heterogeneous ribonucleoprotein A18 RNA Recognition Motif	993	X
28118	1H, 13C, 15N backbone and side-chain resonance assignment of Nostoc sp. C139A variant of the heme nitric oxide/oxygen binding (H-NOX) domain in complex with cinaciguat	1874	X
28121	Assignment of first 249 residues of yeast eIF4G1	1704	X
28122	1H-13C-15N solid-state NMR assignment of a second conformation of HBV capsid	770	X
28123	Methionine sulfoxide-containing peptide for random coil chemical shifts at pH 2.3 and 7.4 (with Gly as succeeding residue)	54	X
28124	5-Hydroxytryptophan-containing peptide for random coil chemical shifts at pH 2.3 and 7.4	68	X
28125	Kynurenine-containing peptide for random coil chemical shifts at pH 2.3 and 7.4	64	X
28126	Methionine sulfoxide-containing peptide for random coil chemical shifts at pH 2.3 and 7.4 (with Ala as succeeding residue)	62	X
28127	Methionine sulfoxide-containing peptide for random coil chemical shifts at pH 2.3 and 7.4 (with Pro as succeeding residue)	72	X
28128	Methionine sulfone-containing peptide for random coil chemical shifts at pH 2.3 and 7.4	50	X
28129	N-formylkynurenine-containing peptide for random coil chemical shifts at pH 2.3 and 7.4	110	X
28130	Oxindolylalanine-containing peptide for random coil chemical shifts at pH 2.3 and 7.4	90	X
28131	1H 15N 13C Resonance Assignments of Receptor Binding Domain 2 of CDTb (757-876)	1121	X
28132	Backbone and side chain 1H, 15N, 13C chemical shift assignments and kinetic datas of polyketide cyclase [Mycobacterium tuberculosis]	1295	X
28133	Backbone 1H, 13C, 15N, and CB chemical shift assignments for the PDE6 inhibitory gamma-subunit (1-58)	240	X
28134	Backbone 1H, 13C, 15N chemical shift assignment for the intrinsically disordered domain of chicken ANP32A	256	X
28135	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Intrinsically Disordered Domain of human ANP32A	304	X
28136	Resonance Assignments for the Rabies Phosphoprotein RavP	498	X
28137	Triple Resonance Assignments for the Rabies Phosphoprotein RavP (1-152)	436	X
28138	Resonance Assignments for the Rabies Phosphoprotein RavP C terminus (140-297)	1110	X
28139	Backbone resonance assignment of dopamine N-acetyltransferase (Dat) in complex with Ac-CoA	970	X
30000	Solution NMR structure of De novo designed PLOOP2X3_50 fold protein, Northeast Structural Genomics Consortium (NESG) target OR258	1718	X
30002	Solution Structure of p53TAD-TAZ1	1841	X
30003	Solution Structure of TAZ2-p53AD2	1329	X
30004	Solution Structure of TAZ2-p53TAD	1735	X
30005	Solution structure of coiled coil domain of myosin binding subunit of myosin light chain phosphatase	602	X
30006	Solution structure of an octanoyl- loaded acyl carrier protein domain from module MLSA2 of the mycolactone polyketide synthase	1043	X
30007	Solution structure of the apo state of the acyl carrier protein from the MLSA2 subunit of the mycolactone polyketide synthase	983	X
30008	Quantitative characterization of configurational space sampled by HIV-1 nucleocapsid using solution NMR and X-ray scattering	209	X
30009	Resonance assignments and NMR structure determination of tarantula toxin, F8A mutant of beta-TRTX-Pre1a	441	X
30010	Amphiphysin SH3 in complex with Chikungunya virus nsP3 peptide	1143	X
30011	Resonance assignments and NMR structure determination of tarantula toxin- W7A mutant of mu-TRTX-Pre1a	430	X
30012	NMR structure of a new G-quadruplex forming sequence within the KRAS proto-oncogene promoter region	218		X
30013	Solution structure of porcinelactoferricin in TFE	183	X
30015	DNA duplex containing a ribonolactone lesion	190		X
30016	DNA duplex containing a ribonolactone lesion	187		X
30017	Solution Structure of human calcium-binding S100A9 (C3S) protein	1201	X
30019	NMR structure of UHRF1 Tandem Tudor Domains in a complex with Spacer peptide	1524	X
30020	The C-terminal domain of rice beta-galactosidase 1	1333	X
30021	Solution structure of the pore-forming region of C. elegans Mitochondrial Calcium Uniporter (MCU)	657	X
30022	Solution structure of porcine lactoferricin	183	X
30023	Solution structure of SdrG from Sphingomonas melonis Fr1	1485	X
30024	Structural basis for therapeutic inhibition of complement C5	670	X
30025	Solution structure of the BeF3-activated conformation of SdrG from Pseudomonas melonis Fr1	1475	X
30026	NMR structure of the 5'-terminal hairpin of the 7SK snRNA	347			X
30027	GCN4p pH 6.6	403	X
30028	GCN4p pH 4.4	408	X
30029	GCN4p pH 1.5	354	X
30030	Solution structure of AN1-type zinc finger domain from Cuz1 (Cdc48 associated ubiquitin-like/zinc-finger protein-1)	618	X
30031	Solution Structure of the Microtubule-Targeting COS Domain of MID1	662	X
30032	Solution Structure of Miz-1 Zinc Finger 13	265	X
30033	Solution Structure of Hge36: Scorpine-like Peptide from Hadrurus Gertschi	520	X
30034	Solution structure of Rv1466 from Mycobacterium tuberculosis, a protein associated with [Fe-S] complex assembly and repair - Seattle Structural Genomics Center for Infectious Disease target MytuD.17486.a	1257	X
30035	Dimerization interface of the noncrystalline HIV-1 capsid protein lattice from solid state NMR spectroscopy of tubular assemblies	791	X
30037	NMR Structure of NS5A-D2 (JFH1) peptide (304-323)	224	X
30038	Solution Structure of DNA Dodecamer with 8-oxoguanine at 4th Position	200		X
30039	NMR structure of antibacterial factor-2	660	X
30040	Cell surface anchoring domain	889	X
30042	Murin CXCL13 solution structure featuring a folded N-terminal domain	1047	X
30043	NMR solution structure of Mayaro virus macro domain	1494	X
30044	Solution Structure of DNA Dodecamer with 8-oxoguanine at 10th Position	200		X
30045	DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium	210		X
30046	Ground state sampled during RDC restrained Replica-averaged Metadynamics (RAM) simulations of the HIV-1 TAR complexed with cyclic peptide mimetic of Tat	551	X		X
30047	Solution structure of Ras Binding Domain (RBD) of B-Raf	1029	X
30048	Solution structure of Ras Binding Domain (RBD) of B-Raf complexed with Rigosertib (Complex I)	1029	X
30049	Excited state (Bound-like) sampled during RDC restrained Replica-averaged Metadynamics (RAM) simulations of the HIV-1 TAR complexed with cyclic peptide mimetic of Tat	551	X		X
30050	Solution structure of Ras Binding Domain (RBD) of B-Raf	1029	X
30051	Intermediate state lying on the pathway of release of Tat from HIV-1 TAR.	551	X		X
30052	NMR solution structure of [Rp, Rp]-PT dsDNA	162		X
30053	Solution NMR structure of PT-free dsDNA from Streptomyces lividans	172		X
30054	NMR solution structure of [Sp, Sp]-PT dsDNA	130		X
30055	DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTTGG) in sodium	193		X
30056	DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTGG) in sodium	161		X
30057	NMR structures of hylin-a1 analogs: Hylin-Ac	129	X
30058	DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium	256		X
30059	NMR structures of hylin-a1 analogs: Hylin-D	130	X
30060	NMR structures of hylin-a1 analogs: Hylin-K	142	X
30061	Structure of anastellin bound to beta-strands A and B from the third type III domain of fibronectin	1160	X
30062	NMR Derived Structure of Ca2+ Calmodulin bound to Phosphorylated PSD-95	1164	X
30063	Structure of calmodulin in a complex with a peptide derived from a calmodulin-dependent kinase	2045	X
30064	NMR structure of Excalibur domain of CbpL	501	X
30065	E73V mutant of the human voltage-dependent anion channel	971	X
30066	PigG holo	1095	X
30067	Solution structure of the de novo miniprotein EHE_06	335	X
30068	M. Oryzae effector AVR-Pia mutant H3	749	X
30069	Solution structure of the de novo miniprotein EEHE_02	343	X
30070	The NMR Solution Structure of RPA3313	736	X
30071	Calcium-loaded EF-hand domain of L-plastin	473	X
30072	Calcium-free EF-hand domain of L-plastin	398	X
30073	LP2006, a handcuff-topology lasso peptide antibiotic	125	X
30074	Molecular basis for protein recognition specificity of the DYNLT1/Tctex1 canonical binding groove. Characterization of the interaction with activin receptor IIB	2748	X
30075	Solution structure of the TRIM21 B-box2 (B2)	495	X
30076	Domain 4 Segment 6 of voltage-gated sodium channel Nav1.4	111	X
30077	Structural model of a apo G-protein alpha subunit determined with NMR residual dipolar couplings and SAXS	488	X
30078	Structural Model of a Protein alpha subunit in complex with GDP obtained with SAXS and NMR residual couplings	486	X
30079	NMR structure of Uncharacterized protein from Pseudomonas aeruginosa PAO1	1126	X
30080	The structure of chaperone SecB in complex with unstructured proPhoA	6416	X
30081	The structure of chaperone SecB in complex with unstructured PhoA binding site a	5090	X
30082	The structure of chaperone SecB in complex with unstructured proPhoA binding site c	4940	X
30083	The structure of chaperone SecB in complex with unstructured proPhoA binding site d	5078	X
30084	The structure of chaperone SecB in complex with unstructured proPhoA binding site e	5054	X
30085	The structure of chaperone SecB in complex with unstructured MBP binding site d	4726	X
30086	The structure of chaperone SecB in complex with unstructured MBP binding site e	5202	X
30087	NMR solution structure of a thermophilic lysine methyl transferase from Sulfolobus islandicus	1786	X
30088	Solid-state MAS NMR structure of beta 1 domain of protein G (GB1)	649	X
30089	Solution Structure of Hge36: Scorpine-like Peptide from Hadrurus Gertschi	292	X
30090	Structure of the transmembrane domain of HIV-1 gp41 in bicelle	149	X
30091	NMR structure of foldswitch-stablized KaiB from Thermosynechococcus elongatus	1324	X
30092	NMR structure of pseudo receiver domain of CikA from Thermosynechococcus elongatus	1397	X
30093	NMR structure of foldswitch-stablized KaiB in complex with pseudo receiver domain of CikA from Thermosynechococcus elongatus	2637	X
30094	Solid-state MAS NMR structure of Acinetobacter phage 205 (AP205) coat protein in assembled capsid particles	1017	X
30097	HDD domain from human Ddi2	1190	X
30098	NMR structure of the HLTF HIRAN domain	1424	X
30099	Structure of human islet amyloid polypeptide in complex with an engineered binding protein	1074	X
30100	The NMR structure of the m domain tri-helix bundle and C2 of human cardiac Myosin Binding Protein C	1701	X
30101	Structural characterization of melanoregulin (mreg): the protein involved in regulation of cell pigmentation	1360	X
30102	Solution structure of the yeast Ddi1 HDD domain	1490	X
30105	Structural impact of single ribonucleotides in DNA	144		X		X
30106	Phenol-soluble modulin Alpha 3	119	X
30107	Phenol-soluble modulin Beta2	267	X
30108	Solution structures of the apo state fluoride riboswitch	549			X
30109	Structure of Phenol-soluble modulin Alpha1	143	X
30110	NMR structure of human antimicrobial peptide KAMP-19	171	X
30111	Structural impact of single ribonucleotides in DNA	145		X
30112	Structural impact of single ribonucleotides in DNA	145		X
30113	Structural impact of single ribonucleotides in DNA	144		X		X
30114	Structural impact of single ribonucleotides in DNA	144		X		X
30115	Structural impact of single ribonucleotides in DNA	144		X		X
30116	Structural impact of single ribonucleotides in DNA	144		X		X
30117	Structural impact of single ribonucleotides in DNA	144		X		X
30118	Solution Structure of a repacked version of HIF-2 alpha PAS-B (CASP target)	1444	X
30119	Connexin 26 WT peptide NMR Structure	173	X
30120	Connexin 26 G12R mutant NMR structure	185	X
30121	Atomic Resolution Structure of Monomorphic AB42 Amyloid Fibrils	152	X
30123	Connexin 32 G12R N-Terminal Mutant	183	X
30124	Con-Vc11-22	245	X
30126	Solution NMR structure of human LARP7 xRRM2	1510	X
30127	Recognition and targeting mechanisms by chaperones in flagella assembly and operation	1119	X
30128	Solution NMR Structure of Denovo Beta Sheet Design Protein, Northeast Structural Genomics Consortium (NESG) Target OR664	1309	X
30129	Solution NMR Structure of Denovo Beta Sheet Design Protein, Northeast Structural Genomics Consortium (NESG) Target OR485	990	X
30130	Identification and structural characterization of LytU	1593	X
30131	Identification and structural characterization of LytU	1571	X
30132	Solution structure of P2a-J2a/b-P2b of medaka telomerase RNA	515			X
30133	Solution Structure of Antibiotic-Resistance Factor ANT(2'')-Ia Reveals Substrate-Regulated Conformation Dynamics	2015	X
30134	Recognition and targeting mechanisms by chaperones in flagella assembly and operation	1433	X
30135	Structure of the C-terminal Helical Repeat Domain of Elongation Factor 2 Kinase	1138	X
30136	Recognition and targeting mechanisms by chaperones in flagella assembly and operation	629	X
30137	Structure of the C-terminal transmembrane domain of scavenger receptor BI (SR-BI)	848	X
30138	NMR Solution Structure of Designed Peptide NC_HEE_D1	290	X
30139	Solution structure of the catalytic domain of zoocin A	1631	X
30140	NMR Solution Structure of Designed Peptide NC_EHE_D1	292	X
30141	NMR Solution Structure of Designed Peptide NC_EEH_D2	275	X
30142	NMR Solution Structure of Designed Peptide NC_EEH_D1	260	X
30143	NMR Solution Structure of Designed Peptide NC_cHH_D1	276	X
30144	NMR Solution Structure of Designed Peptide NC_cHh_DL_D1	246	X
30145	NMR Solution Structure of Designed Peptide NC_cHHH_D1	224	X
30146	NMR Solution Structure of Designed Peptide NC_cEE_D1	214	X
30147	Notch1 transmembrane and associated juxtamembrane segment	228	X
30148	Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 3rd Position	192		X
30149	Heteronuclear Solution Structure of Chlorotoxin	395	X
30150	Solution structure of a Bcl-xL S62E mutant	2137	X
30151	Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 9th Position	190		X
30152	Calculated solution structure of [D-Trp3]-Contryphan-Vc2	81	X
30153	The solution NMR structure for the PqqD truncation of Methylobacterium extorquens PqqCD representing a functional and stand-alone ribosomally synthesized and post-translational modified (RiPP) recognition element (RRE)	1139	X
30154	Solution structure of Aquifex aeolicus Aq1974	1049	X
30155	NMR solution structure of the RRM1 domain of the post-transcriptional regulator HuR	1184	X
30156	Solution NMR-derived structure of calmodulin bound with ER alpha peptides	1182	X
30157	NMR structure of the E. coli protein NPr, residues 1-85	817	X
30158	Solution-state NMR structural ensemble of NPr (1-85) refined with RDCs and PCS	300	X
30159	Solution-state NMR and SAXS structural ensemble of NPr (1-85) in complex with EIN-Ntr (170-424)	1391	X
30160	Solution structure of a triple mutant of HwTx-IV - a potent blocker of Nav1.7	439	X
30161	Solution structure of response regulator protein from Burkholderia multivorans	1315	X
30162	Structure of the Ebola virus envelope protein MPER/TM domain and its interaction with the fusion loop explains their fusion activity	520	X
30163	NMR Structure of Apo-form Human Tear Lipocalin	264	X
30164	NMR solution structure of the Nav1.7 selective spider venom-derived peptide Pn3a	316	X
30165	[3]catenane from MccJ25 G12R/I13C/G21C lasso peptide	238	X
30170	TIRAP phosphoinositide-binding motif	99	X
30171	HIV-1 reverse transcriptase thumb subdomain	939	X
30172	Recombinant cytotoxin-I from the venom of cobra N. oxiana	801	X
30176	The Solution Structure of the Magnesium-bound Conantokin-R1B Mutant	194	X
30177	Solution NMR structure of PHF20 PHD domain in complex with a histone H3K4me2 peptide	805	X
30178	The Solution Structure of the Magnesium-bound Conantokin-R1B Mutant	201	X
30179	The Solution Structure of the Magnesium-bound Conantokin-R1B Mutant	189	X
30180	N-terminal microdomain of 34-mers from HsDHODH - N-t(DH)	319	X
30181	NMR solution structure of engineered Protoxin-II analog	182	X
30184	Solution structure of parallel stranded adenosine duplex r(AAAA)-dA-r(AAA)	96				X
30185	NMR structure of apo-PS1	1251	X
30186	NMR structure of holo-PS1	1318	X
30188	Benenodin-1-dC5, state 1	139	X
30189	Model structure of oxidized PaDsbA1 and 3-((2-methylbenzyl)thio)-4H-1,2,4-triazol-4-amine complex	424	X
30190	Solution NMR structure of gHwTx-IV	349	X
30191	Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 3rd Position and 9th position	190		X
30192	Solution Structure of SinI, antagonist to the master biofilm-regulator SinR in Bacillus subtilis	693	X
30193	Solution Structure of the N-terminal DNA-binding domain of the master biofilm-regulator SinR from Bacillus subtilis	841	X
30194	Solution Structure of the C-terminal multimerization domain of the master biofilm-regulator SinR from Bacillus subtilis	576	X
30195	Solution structure of the calcium deficient mutant calmodulin CaM1234	1140	X
30196	Solution structure of the CaM34 with the iNOS CaM binding domain peptide	1610	X
30197	Solution structure of Serine 65 phosphorylated UBL domain from parkin	917	X
30198	Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 3rd Position and 9th position	170		X
30199	Solution structure of apo ArCP from yersiniabactin synthetase	940	X
30200	Sparse-restraint solution NMR structure of micelle-solubilized cytosolic amino terminal domain of C. elegans mechanosensory ion channel MEC-4 refined by restrained Rosetta	469	X
30201	solution structure of nysgrc-2016	1337	X
30202	Alpha Helix Nucleation by a Simple Cyclic Tetrapeptide	8	X
30203	Alpha Helix Nucleation by a Simple Cyclic Tetrapeptide	26	X
30204	Solution structure of the de novo mini protein gHH_44	310	X
30205	Solution structure of apo PCP1 from yersiniabactin synthetase	1304	X
30206	Solution structures of Brd2 second bromodomain in complex with stat3 peptide	1382	X
30207	Solution structure of the zinc fingers 1 and 2 of MBNL1	850	X
30208	Solution structure of the zinc fingers 3 and 4 of MBNL1	755	X
30209	NMR structure of the precursor protein PawS1 comprising SFTI-1 and a seed storage albumin	1356	X
30210	Solution structure of the zinc fingers 1 and 2 of MBNL1 in complex with human cardiac troponin T pre-mRNA	939	X		X
30211	Ocellatin-LB1	233	X
30212	Ocellatin-LB2, solution structure in TFE by NMR spectroscopy	245	X
30213	Ocellatin-F1, solution structure in TFE by NMR spectroscopy	274	X
30214	Ocellatin-LB1, solution structure in DPC micelle by NMR spectroscopy	232	X
30215	Ocellatin-LB2	232	X
30216	Ocellatin-F1	267	X
30217	Ocellatin-LB1, solution structure in SDS micelle by NMR spectroscopy	217	X
30218	Ocellatin-LB2, solution structure in SDS micelle by NMR spectroscopy	209	X
30219	Ocellatin-F1, solution structure in SDS micelle by NMR spectroscopy	264	X
30220	Solution NMR Structure of NERD-C, a natively folded tetramutant of the B1 domain of streptococcal protein G (GB1)	1083	X
30221	Solution NMR Structure of NERD-S, a natively folded pentamutant of the B1 domain of streptococcal protein G (GB1) with a solvent-exposed Trp43	643	X
30222	Solution NMR structure of the major species of DANCER-2, a dynamic and natively folded pentamutant of the B1 domain of streptococcal protein G (GB1)	620	X
30223	Solution NMR-derived model of the minor species of DANCER-2, a dynamic and natively folded pentamutant of the B1 domain of streptococcal protein G (GB1)	620	X
30224	Structure Effects of the Four-Adenine Loop of the Coliphage GA Replicase RNA Operator	424			X
30225	NMR SOLUTION STRUCTURE OF ALPHA-CONOTOXIN GID MUTANT A10V	150	X
30226	NMR SOLUTION STRUCTURE OF THE ALPHA-CONOTOXIN GID MUTANT V13Y	144	X
30227	Zinc-Binding Structure of a Catalytic Amyloid from Solid-State NMR Spectroscopy	87	X
30229	Solution NMR Structure of Lasso Peptide Acinetodin	114	X
30230	Solution NMR Structure of Lasso Peptide Klebsidin	103	X
30231	Solution structure of the oxidized iron-sulfur protein adrenodoxin from Encephalitozoon cuniculi. Seattle Structural Genomics Center for Infectious Disease target EncuA.00705.a	1141	X
30232	ovGRN12-35_3s	159	X
30233	ov-GRN12-34	204	X
30234	Representative 1-conformer ensembles of K27-linked Ub2 from RDC data	280	X
30235	NMR Solution Structure of the Two-component Bacteriocin CbnXY	319	X
30236	NMR Solution Structure of the Two-component Bacteriocin CbnXY	381	X
30237	NMR structure of monomeric human IRAK-M Death Domain R56D, Y61E mutant	1356	X
30238	Solution structure of chemically synthesized antilisterial Pediocin PA-1 analog.	222	X
30239	NMR structure of the RED subdomain of the Sleeping Beauty transposase	630	X
30240	Solution structure of the de novo mini protein HHH_rd1_0142	488	X
30241	Solution structure of the de novo mini protein EEHEE_rd3_1049	572	X
30242	Solution structure of the de novo mini protein EHEE_rd1_0284	355	X
30243	NMR structure of the complex between the PH domain of the Tfb1 subunit from TFIIH and the transactivation domain 1 of p65	1812	X
30244	Heterogeneous-backbone Foldamer Mimic of the Sp1-3 Zinc Finger	213	X
30245	Solution structure of the IreB homodimer	2106	X
30246	Red abalone lysin F104A	1235	X
30247	SARS-unique fold in the Rousettus Bat Coronavirus HKU9	952	X
30248	peptide 38146 derived from fragment 41-60 of Plasmodium falciparum Thrombospondin-Related Sporozoite Protein (TRSP)	139	X
30249	Solution NMR structure of the de novo mini protein HEEH_rd4_0097	506	X
30250	Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 3rd position and 8-oxoguanine at the 10th position	170		X
30251	Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 3rd and 9th position and 8-oxoguanine at the 10th position	176		X
30252	Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 9th position and 8-oxoguanine at the 10th position	172		X
30253	Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A2-DNA structure	300		X
30254	Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A6-DNA structure	308		X
30255	Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A6-DNAm1A16 structure	305		X
30256	Brassica napus DGAT1 exosite	265	X
30257	Structure of wild type pre-miR21 apical loop	309			X
30258	Structure of wild type pre-miR21 apical loop	257	X		X
30259	Solution structure of arenicin-3.	222	X
30260	Solution structure of arenicin-3 synthetic analog.	221	X
30261	HnRNP A1 Alters the Conformation of a Conserved Enterovirus IRES Domain to Stimulate Viral Translation	131			X
30262	HnRNP A1 Alters the Conformation of a Conserved Enterovirus IRES Domain to Stimulate Viral Translation	110			X
30263	Suboptimization of a glycine rich peptide allows the combinatorial space exploration for designing novel antimicrobial peptides	128	X
30265	Peptide 38148 modified from fragment 41-60 of Plasmodium falciparum Thrombospondin-Related Sporozoite Protein (TRSP)	126	X
30267	De Novo Design of Novel Covalent Constrained Meso-size Peptide Scaffolds with Unique Tertiary Structures	503	X
30268	Structure of a GA Rich 8x8 Nucleotide RNA Internal Loop	165			X
30270	Peptide 38136 modified from fragment 21-37 of Plasmodium falciparum Cell-Traversal Protein for Ookinetes and Sporozoites (CelTOS)	96	X
30271	Solution structure of VKK38 bound to plasminogen kringle 2	340	X
30273	SSNMR Structure of the Human RIP1/RIP3 Necrosome	153	X
30274	Design of a novel cyclic peptide that alleviates symptoms in a murine model of inflammatory bowel disease	134	X
30275	Solution NMR structure of histone H2A-H2B mono-ubiquitylated at H2A Lys15 in complex with RNF169 (653-708)	3731	X
30276	Solution NMR structure of human RAD18 (198-240) in complex with ubiquitin	1335	X
30281	An engineered cyclic peptide alleviates symptoms of inflammation in a murine model of inflammatory bowel disease	180	X
30282	Structure and dynamics of RNA repeat expansions that cause Huntington's Disease and myotonic dystrophy type 1	108			X
30283	Structure and dynamics of RNA repeat expansions that cause Huntington's Disease and myotonic dystrophy type 1	94			X
30284	Backbone structure of the Yersinia pestis outer membrane protein Ail in phospholipid bilayer nanodisc	276	X
30285	Solution-state NMR structural ensemble of human Tsg101 UEV in complex with tenatoprazole	1742	X
30286	Solution NMR structure of the membrane electron transporter CcdA	880	X
30287	Peptide 38138 modified from fragment 21-37 of Plasmodium falciparum Cell-Traversal Protein for Ookinetes and Sporozoite (Pf-CelTOS)	95	X
30288	NMR structure of the N-domain of troponin C bound to switch region of troponin I	1411	X
30289	Solution NMR Structure of the C-terminal Headpiece Domain of Villin 4 from A.thaliana, the First Non-Vertebrate Headpiece Structure	639	X
30290	NMR Assignment and Structure of Thioredoxin (Rv1471 ortholog) from Mycobacterium smegmatis ATCC 700084 / mc(2)155	1214	X
30291	Structure of a Turripeptide from Unedogemmula bisaya venom	121	X
30292	Peptide 38142 modified from fragment 41-60 of Plasmodium falciparum Thrombospondin-Related Sporozoite Protein (TRSP)	144	X
30293	NMR structure of Ydj1 J-domain, a cytosolic Hsp40 from Saccharomyces cerevisiae	935	X
30295	Solution Structure of BlsM	1686	X
30296	Solution NMR structure of the HMG domain of human FACT complex subunit SSRP1	790	X
30297	1H, 13C, 15N chemical shift assignments of the HIV-1 gp41 cytoplasmic tail, residues 752-856	1249	X
30298	Solution NMR structure of the BRCT domain of S. cerevisiae Rev1	1078	X
30300	Solution NMR structure of human Rev1 (932-1039) in complex with ubiquitin	2264	X
30301	Solution NMR Structure of a Class I Hydrophobin from Serpula lacrymans	937	X
30303	Solution Structure of ETS Transcription Factor PU.1	1242	X
30304	Molecular structure of FUS low sequence complexity domain protein fibrils	218	X
30305	Solution structure of C2 domain from protein kinase C alpha in ternary complex with calcium and V5-pHM peptide	59	X
30306	Cytokine-like Stress Response Peptide-2 in Manduca Sexta	148	X
30307	Impact of IR active probes on PDZ3 and its ligand binding studied by NMR and X-ray crystallography	1019	X
30308	NMR structure of the N-domain of troponin C bound to switch region of troponin I and 3-methyldiphenylamine	1420	X
30309	Solution Structure of XPH1, a Hybrid Sequence of Xfaso 1 and Pfl 6, Two Cro Proteins With Different Folds	805	X
30310	Solution Structure of XPH2, a Hybrid Sequence of Xfaso 1 and Pfl 6, Two Cro Proteins With Different Folds	707	X
30311	Solution structure of phage displayed derived peptide inhibitor of frizzled 7 receptor	178	X
30312	Solution structure of the de novo mini protein gHEEE_02	511	X
30313	SOLUTION NMR STRUCTURE OF SIGLEC-5 BINDING DOMAIN FROM STREPTOCOCCAL BETA PROTEIN	1281	X
30314	Solution Structure and Dynamics of an Ultra-Stable Single-Chain Insulin Analog STUDIES OF AN ENGINEERED MONOMER AND IMPLICATIONS FOR RECEPTOR BINDING	552	X
30315	AsK132958: A minimal homologue of ShK identified in the transcriptome of Anemonia sulcata	220	X
30316	Structure of monomeric Interleukin-8 (1-66)	711	X
30317	Solution NMR structure of PaurTx-3	379	X
30318	Solution structure of kappa-theraphotoxin-Aa1a	394	X
30319	De Novo Design of Covalently Constrained Meso-size Protein Scaffolds with Unique Tertiary Structures	337	X
30320	De Novo Design of Covalently Constrained Meso-size Protein Scaffolds with Unique Tertiary Structures	248	X
30321	Solution structure of the sorting nexin 25 phox-homology domain	1552	X
30322	NMR solution structure of a-lytic protease using two 4D-spectra	1963	X
30323	Solution NMR structure of cyclotide MCoTI-I	324	X
30324	Solution NMR structure of cyclotide MCoTI-I	381	X
30325	NMR solution structure of KanY protein (ms6282) using two 4D-spectra	1556	X
30326	NMR solution structure of Enzyme I (nEIt) protein using two 4D-spectra	2739	X
30327	NMR solution structure of Rtt103 (RTT) protein using two 4D-spectra	1581	X
30328	Solution structure of a DNA dodecamer with 5-methylcytosine at the 3rd and 9th position and 8-oxoguanine at the 4th position	176		X
30329	Solution structure of a DNA dodecamer with 5-methylcytosine at the 3rd and 8-oxoguanine at the 4th position	174		X
30330	Solution structure of yeast Med15 ABD2 residues 277-368	930	X
30331	Abl 1b Regulatory Module 'inhibiting state'	1885	X
30332	Abl1b Regulatory Module 'Activating' conformation	2271	X
30333	Capped-strapped peptide	118	X
30334	H, 13C, and 15N Chemical Shift Assignments and structure of Thioredoxin from Mycobacterium thermoresistibile ATCC 19527 and NCTC 10409	1226	X
30335	NMR and Restrained Molecular Dynamics Determination of the Structure of an Aza-Benzimidazole Derivative Complex with the DNA Minor Groove of an -AAGATA- Sequence	131		X
30336	NMR and Restrained Molecular Dynamics Determination of the Structure of an Aza-Benzimidazole Derivative Complex with the DNA Minor Groove of an -AAGATA Sequence	132		X
30337	PawL-Derived Peptide PLP-12	60	X
30338	PawL-Derived Peptide PLP-4	59	X
30339	Solution structure of Magi3 a specific insect toxin from the spider Macrothele gigas	254	X
30340	Structures of REV1 UBM2 domain complex with ubiquitin and with the first small-molecule that inhibits the REV1 UBM2-ubiquitin interaction	212	X
30341	PawL-Derived Peptide PLP-2	81	X
30342	NMR structure of sea anemone toxin Kappa-actitoxin-Ate1a	177	X
30343	PawL-Derived Peptide PLP-10 (trans conformer)	37	X
30344	PawL-Derived Peptide PLP-10 (cis conformer)	45	X
30345	Solution structure of TDP-43 N-terminal domain dimer.	1895	X
30346	NMR ensemble of Tyrocidine A analogue AC3.27	65	X
30347	NMR ensemble of Tyrocidine A analogue AC3.27	68	X
30348	Solution structure of the N-terminal domain of the effector NleG5-1 from Escherichia coli O157:H7 str. Sakai	1252	X
30349	Solution Structure of HIV-1 GP41 Transmembrane Domain in Bicelles	153	X
30350	Solution NMR Structure of Unbound P18-I10	73	X
30351	NMR solution structure of Defensin1 from Centruroides limpidus limpidus	186	X
30352	NMR structure of U21-hexatoxin-Hi1a toxin from Australian Funnel-web spider Hadronyche infensa	798	X
30353	Solution structure of Rap1b/talin complex	4178	X
30354	NMR solution structure of Defensin1 from Centruroides limpidus limpidus	201	X
30355	Solution structure of de novo macrocycle Design8.1	82	X
30356	Solution structure of de novo macrocycle design7.1	51	X
30357	Solution structure of de novo macrocycle design8.2	65	X
30358	Solution structure of de novo macrocycle design9.1	63	X
30359	Solution structure of de novo macrocycle design10.1	61	X
30360	Solution structure of de novo macrocycle design10.2	53	X
30361	Solution structure of de novo macrocycle design11_ss	57	X
30362	Solution structure of de novo macrocycle design12_ss	83	X
30363	Solution structure of de novo macrocycle design14_ss	95	X
30364	Solution structure of de novo macrocycle design7.2	43	X
30365	Solution structure of de novo macrocycle design7.3a	43	X
30366	Solution structure of de novo macrocycle design7.3a	35	X
30367	Solution NMR structures of the BRD3 ET domain in complex with a CHD4 peptide	1039	X
30368	Solution NMR structure of Brd3 ET domain bound to Brg1 peptide	1100	X
30370	Solution NMR structure of uncharacterized protein YejG representing the first structure from PF13989	1234	X
30371	NMR Structural and biophysical functional analysis of intracellular loop 5 of the NHE1 isoform of the Na+/H+ exchanger.	97	X
30372	NMR Solution structure of U-SLPTX15-Sm2a	504	X
30373	Solution NMR structures of BRD4 ET domain with JMJD6 peptide	1086	X
30374	HSPB5 alpha-crystallin domain mutant R120G-ACD	965	X
30375	Structure of two-domain translational regulator Yih1 reveals a possible mechanism of action	2682	X
30376	CcoTx-I	338	X
30377	Solution NMR structures for CcoTx-II	348	X
30378	Structure of a new ShKT peptide from the sea anemone Oulactis sp.	257	X
30379	NMR structure of Sodium/Calcium Exchanger 1 (NCX1) Two-helix Bundle (THB) domain	700	X
30380	SFTI-HFRW-1	149	X
30381	SFTI-HFRW-3	150	X
30382	SFTI-HFRW-2	134	X
30383	SFTI-HFRW-4	153	X
30385	Solution structure of conotoxin reg3b	86	X
30386	Two-State 14-mer UUCG Tetraloop calculated from Exact NOEs (State one: Conformers 1-5, State Two: Conformers 6-10)	200			X
30388	Solution NMR structure of cysteine-rich calcium bound domains of very low density lipoprotein receptor	1175	X
30389	Solution structure of AGL55	653	X
30390	Solution structure of KTI55	648	X
30391	Solution structure of VEK75	859	X
30394	Solution structure of a phosphate-loop protein	1275	X
30395	Solution structure of a phosphate-loop protein	1274	X
30396	The clavanin peptide in the presence of TFE (2,2,2-trifluoroethanol), presented a amphipathic alpha-helices from Phe-2 to Val-22 residues	164	X
30397	Zika virus capsid protein	1307	X
30398	Solution structure of Musashi2 RRM1	1326	X
30399	NMR-based structure of the FHA-2 domain from Mycobacterium tuberculosis ABC transporter Rv1747	1161	X
30400	NMR data-driven model of GTPase KRas-GMPPNP:Cmpd2 complex tethered to a nanodisc	266	X
30401	NMR data-driven model of GTPase KRas-GMPPNP tethered to a nanodisc (E3 state)	268	X
30402	Hybrid-2 form Human Telomeric G Quadruplex in Complex with Epiberberine	269		X
30403	NMR data-driven model of GTPase KRas-GMPPNP:Cmpd2 complex tethered to a nanodisc	268	X
30404	NMR structure of the Rous sarcoma virus matrix protein (M-domain) in the presence of myo-inositol hexakisphosphate	1081	X
30405	Solution NMR structure of the omega conotoxin MoVIB from Conus moncuri	176	X
30406	Solution NMR Structure of Conotoxin G117 from Conus geographus	265	X
30407	Solution structure of a 14mer fragment of the p21 protein	87	X
30408	peptide PaAMP1R3	245	X
30409	Isolation, Characterization, and Synthesis of the Barrettides: Disulfide-Containing Peptides from the Marine Sponge Geodia barretti	216	X
30410	Solution structure of the four-helix bundle region of human J-protein Zuotin, a component of ribosome-associated complex (RAC)	874	X
30411	Solution NMR structure of JzTx-V, a Nav 1.7 inhibitory peptide	136	X
30412	Backbone cyclised conotoxin Vc1.1 mutant - D11A, E14A	174	X
30413	JzTx-V toxin peptide, wild-type	140	X
30414	Lactam cyclised mimetic of a fragment of p21	91	X
30415	Lactam cyclised mimetic of a fragment of p21	89	X
30416	CSP1	164	X
30417	NMR Structure of Salmonella Type III Secretion system protein OrgC	606	X
30418	Solution Structure of Amebosin	1002	X
30419	Structure of a new ShKT peptide from the sea anemone Oulactis sp: OspTx2a-p1	263	X
30420	Structure of a new ShKT peptide from the sea anemone Oulactis sp: OspTx2a-p2	262	X
30421	Solution structure of the Burkholderia thailandensis transcription antitermination protein NusB (BTH_I1529) - Seattle Structural Genomics Center for Infectious Disease target ButhA.17903.a	1515	X
30422	Solution structure of the zebrafish granulin AaE	357	X
30423	Solution NMR structure of human BOK	1843	X
30424	LyeTxI-b, a synthetic peptide derived from Lycosa erythrognatha spider venom, shows potent antibiotic activity, in vitro and in vivo	274	X
30425	MT1-MMP HPX domain with Blade 4 Loop Bound to Nanodiscs	324	X
30426	MT1-MMP HPX Domain with Blade 2 Loop Bound to Nanodiscs	324	X
30427	CSP1-E1A	160	X
30428	CSP1-R3A	154	X
30429	CSP1-K6A	162	X
30430	CSP1-F11A	157	X
30431	CSP1-f11	149	X
30432	CSP2-d10	161	X
30433	CSP2-E1Ad10	151	X
30434	CSP2-l14	169	X
30435	CSP1	135	X
30436	Solution structure of SH3 domain from Shank1	290	X
30437	Solution structure of SH3 domain from Shank2	283	X
30438	Solution structure of SH3 domain from Shank3	285	X
30439	TFE-induced NMR structure of a novel bioactive peptide (PaDBS1R2) derived from a Pyrobaculum aerophilum ribosomal protein (L39e)	251	X
30440	TFE-induced NMR structure of a novel bioactive peptide (PaDBS1R3) derived from a Pyrobaculum aerophilum ribosomal protein (L39e)	246	X
30441	TFE-induced NMR structure of a novel bioactive peptide (PaDBS1R7) derived from a Pyrobaculum aerophilum ribosomal protein (L39e)	240	X
30442	TFE-induced NMR structure of an antimicrobial peptide (EcDBS1R5) derived from a mercury transporter protein (MerP - Escherichia coli)	244	X
30443	Three-Dimensional Structures of Cm-p1	91	X
30444	Solution structure of the Extraterminal (ET) Domain of BRD2	1508	X
30445	The NMR solution structure of CCL28	1246	X
30446	HRFLRH peptide NMR structure	77	X
30447	HRFLRH peptide NMR structure in the presence of Cd(II)	77	X
30448	HRFLRH peptide NMR structure in the presence of CO2	76	X
30449	HRFLRH peptide NMR structure in the presence of Zn(II)	76	X
30450	CS-rosetta determined structures of the N-terminal domain of AlgF from P. aeruginosa	2322	X
30451	Three-Dimensional Structures of [Phe3]Cm-p1 analogs	82	X
30452	Solution structure of a ultra-high affinity macrocycle bound to HIV-1 TAR RNA	520	X		X
30453	Trp-cage tr16b R16Nva : Elimination of pH Dependent Interactions	110	X
30454	Tamapin mutant DP30	201	X
30456	Solution structure of Trigger Factor dimer	1670	X
30457	HSP40 co-chaperone Sis1 J-domain	863	X
30458	Direct Activation of the Executioner Domain of MLKL by a Select Repertoire of Inositol Phosphates	2026	X
30459	NMR solution structure of tamapin, mutant Y31+N	210	X
30460	NMR solution structure of tamapin, mutant DP30/Y31+N	206	X
30461	NMR solution structure of tamapin, mutant E25K	208	X
30462	NMR solution structure of tamapin, mutant K27E	200	X
30463	NMR solution structure of tamapin, mutant E25K/K27E	206	X
30464	NMR solution structure of tamapin, mutant K20E	199	X
30465	NMR solution structure of tamapin, mutant Y31H	203	X
30466	NMR solution structure of tamapin, mutant Y31A	201	X
30467	NMR solution structure of tamapin, mutant E25A	203	X
30468	NMR solution structure of tamapin, mutant K27A	198	X
30469	NMR structure of the second qRRM2 domain of human hnRNP H	1094	X
30470	NMR Solution structure of Rivi3	289	X
30471	Human Titin ZIg10	1016	X
30472	Oligomeric Structure of the HIV gp41 MPER-TMD in Phospholipid Bilayers	23	X
30473	NMR structure for Sp1 transcription factor duplex 5'-d(GGGGCGGGG)	244		X
30474	De Novo Design of a Protein Heterodimer with Specificity Mediated by Hydrogen Bond Networks	1799	X
30475	Solution structure of ZmD32	415	X
30476	Solution structure of the cyclic tetrapeptide, PYPV	46	X
30477	NMR solution structure of wild type apo hFABP1 at 308 K	1524	X
30478	NMR solution structure of wild type hFABP1 in the presence of GW7647	1526	X
30479	NMR solution structure of Acan1 from the Ancylostoma caninum hookworm	340	X
30480	Consensus engineered intein (Cat) with atypical split site	1772	X
30481	Recombinant melittin	321	X
30482	Three-Dimensional Structures for mastoparano-L	153	X
30483	Three-Dimensional Structures for mastoparano-MO	182	X
30484	NMR structure for Sp1 transcription factor duplex 5'-d(GGGGCGGGA)	138		X
30485	NMR structure for Sp1 transcription factor duplex 5'-d(TGGGCGGGG)	133		X
30486	Solution structure of Rbfox2 RRM mimetic peptide CPfox2	106	X
30487	Solution structure of Rbfox2 RRM mimetic peptide CPfox4	117	X
30488	Solution structure of Rbfox2 RRM mimetic peptide CPfox5	127	X
30489	Solution structure of Rbfox2 RRM mimetic peptide CPfox6	106	X
30490	Solution structure of Rbfox2 RRM mimetic peptide CPfox7	100	X
30491	NMR solution structure of the CARD9 CARD bound to zinc	1161	X
30492	NMR solution structure of the CARD9 CARD	1259	X
30493	Solution NMR Structure of the Colied-coil PALB2 Homodimer	696	X
30494	NMR Data for Solution NMR Structures of Protein PF2048.1	881	X
30495	Solution NMR structure of a de novo designed double-stranded beta-helix	816	X
30496	Heterogeneous-Backbone Mimics of a Designed Disulfide-Rich Protein: Aib turn	187	X
30497	Heterogeneous-Backbone Mimics of a Designed Disulfide-Rich Protein: Orn turn	201	X
30498	Heterogeneous-Backbone Mimics of a Designed Disulfide-Rich Protein: Aib turn, beta3 helix, N-methyl hairpin	177	X
30499	Heterogeneous-Backbone Mimics of a Designed Disulfide-Rich Protein: Aib turn, Aib helix, N-methyl hairpin	161	X
30500	Structure of a protein complex	1251	X
30501	Solution structure of ZZZ3 ZZ domain in complex with histone H3 tail	655	X
30502	Solution structure of ZZZ3 ZZ domain in complex with histone H3K4ac peptide	665	X
30503	MPER-TM Domain of HIV-1 envelope glycoprotein (Env)	186	X
30504	Solution NMR Structure of a Class I Hydrophobin from Phanerochaete carnosa	930	X
30505	Solution NMR Structure of a Class I Hydrophobin from Wallemia ichthyophaga	1013	X
30506	NMR structure for Sp1 transcription factor duplex 5'-d(TGGGCGGGA)	139		X
30507	Cytokine-like Peptide Stress-response Peptide-1 from Manduca Sexta	149	X
30508	NMR Solution Structure of vil14a	142	X
30509	HS02 - Intragenic antimicrobial peptides derived from the protein unconventional myosin 1h	120	X
30510	Solution structure of HIV-1 TAR with Tat RNA Binding Domain	447	X		X
30511	Solution structure of 7SK stem-loop 1 with HIV-1 Tat RNA Binding Domain	517	X		X
30512	Solution structure of 7SK stem-loop 1	283			X
30513	TCR alpha transmembrane domain	377	X
30514	Human Obscurin Ig57 Domain	849	X
30515	NMR solution structure of lanmodulin (LanM) complexed with yttrium(III) ions	998	X
30516	The peptide PaAMP1B3 is an analog derived from the PaAMP1. The sequence of the ribosomal protein of Pyrobaculum aerophylum was used as template for rational design, using the Joker algorithm.	169	X
30517	Solution NMR structure of the KCNQ1 voltage-sensing domain	1577	X
30518	Lim5 domain of PINCH1 protein	797	X
30519	NMR Solution structure of GIIIC	217	X
30520	A consensus human beta defensin	333	X
30521	Solution NMR structure of spider toxin analogue [E17K]ProTx-II	333	X
30522	Solution NMR structure of spider toxin analogue [F5A,M6F,T26L,K28R]GpTx-1	363	X
30523	Solution structure of the large extracellular loop of FtsX in Streptococcus pneumoniae	1522	X
30524	NMR structure of Database designed and improved anti-Staphylococcal peptide DFT503 bound to micelles	114	X
30525	Solution NMR Structure of Engineered Cystine Knot Protein 2.5F	329	X
30527	De novo Designed Protein Foldit3	982	X
30528	Shuttle proteins complex	3054	X
30529	NMR structure of the cNTnC-cTnI chimera bound to calcium desensitizer W7	1305	X
30530	Antimicrobial lasso peptide citrocin	127	X
30531	Bat coronavirus HKU4 SUD-C	944	X
30532	Solution NMR Structure of DANCER3-F34A, a rigid and natively folded single mutant of the dynamic protein DANCER-3	683	X
30533	Solution structure of a c-JUN 5' UTR stem-loop associated with specialized cap-dependent translation initiation	765			X
30534	Solution structure of gomesin at 278 K	215	X
30535	Solution structure of gomesin at 298 K	216	X
30536	Solution structure of gomesin at 310K	216	X
30537	Solution NMR structure of a putative thioredoxin (trxA) in the reduced state from Rickettsia prowazekii, the etiological agent responsible for typhus. Seattle Structural Genomics Center for Infectious Disease target RiprA.00029.a	1317	X
30538	Solution structure of alpha-KTx-6.21 (UroTx) from Urodacus yaschenkoi	397	X
30543	NMR solution structure of the homodimeric, autoinhibited state of the CARD9 CARD and first coiled-coil	2457	X
30544	NMR solution structure of Protonectin (Agelaia pallipes pallipes) interacting with SDS micelles: an antimicrobial peptide with anticancer activity on breast cancer cells	101	X
30545	Structure of the Huttingtin tetramer/dimer mixture determined by paramagnetic NMR	37	X
30546	RNA Duplex containing the internal loop 5'-GCUU/3'-UUCG	179			X
30547	RNA Duplex containing the internal loop 5'-GCAU/3'-UACG	111			X
30548	RNA Duplex containing the internal loop 5'-UUCG/3'-GCUU	168			X
30550	Structure of Aedes aegypti OBP22 in the complex with arachidonic acid	1528	X
30551	Solution Structure of the Thioredoxin-like Domain of Arabidopsis NCP	1700	X
30552	MYC Promoter G-Quadruplex with 1:6:1 loop length	292		X
30553	Structure of the transmembrane domain of the Death Receptor 5 - Dimer of Trimer	130	X
30554	Structure of the transmembrane domain of the Death Receptor 5 mutant (G217Y) - Trimer Only	133	X
30555	Solution structure of AcaTx1, a potassium channel inhibitor from the sea anemone Antopleura cascaia	266	X
30556	Solution structure of human Coa6	794	X
30557	NMR Structure of WW291	136	X
30558	NMR structure of WW295	135	X
30559	Solution structure of the Tudor domain of PSHCP	717	X
30560	Solution structure of a c-JUN 5' UTR stem-loop associated with specialized cap-dependent translation initiation (WT apical loop)	707			X
30561	NMR solution structure of Pisum sativum defensin 2 (Psd2) provides evidence for the presence of hydrophobic surface clusters	489	X
30562	Solution structure of SFTI-KLK5 inhibitor	138	X
30565	Solution structure of the Arabidopsis thaliana RALF8 peptide	578	X
30566	hGRNA4-28_3s	125	X
30567	NMR Structure of the DNA binding domain of EhMybS3	355	X
30568	SOLUTION STRUCTURE OF CN29, A TOXIN FROM CENTRUROIDES NOXIUS SCORPION VENOM	168	X
30569	Structure of the C-terminal Helical Repeat Domain of Eukaryotic Elongation Factor 2 Kinase (eEF-2K)	2019	X
30570	NMR solution structure of Bcd1p120-303 from Saccharomyces cerevisiae	2381	X
30571	Solution structure of POS-1, a CCCH-type Tandem Zinc Finger protein from C. elegans	871	X
30572	Dimer-of-dimer amyloid fibril structure of glucagon	392	X
30573	NMR ensemble of computationally designed protein XAA_GVDQ mutant M4L	1761	X
30574	NMR ensemble of computationally designed protein XAA	1683	X
30575	The putative coiled coil domain of NPHP1 folds as a three helix bundle	1487	X
30576	Structure of Asf1-H3:H4-Rtt109-Vps75 histone chaperone-lysine acetyltransferase complex with the histone substrate.	368	X
30577	NMR structure of the 2:1 complex of a carbazole derivative BMVC bound to c-MYC G-quadruplex	203		X
30579	NMR solution structure of vicilin-buried peptide-8 (VBP-8)	452	X
30580	NMR solution structure of vicilin-buried peptide-8 (VBP-8)	448	X
30583	Endoplasmic reticulum protein 29 (ERp29) C-terminal domain: Structure Determination from Backbone Amide Pseudocontact Shifts Generated by Double-histidine Cobalt Tags	503	X
30584	Solution structure of human myeloid-derived growth factor	1751	X
30585	Solution structure of MLL4 PHD6 domain in complex with histone H4K16ac peptide	669	X
30586	Syn-safencin	80	X
30587	Syn-safencin 24	75	X
30588	Syn-safencin 56	70	X
30590	Structure of WHB in complex with Ubiquitin Variant	2295	X
30591	Remarkable rigidity of the single alpha-helical domain of myosin-VI revealed by NMR spectroscopy	252	X
30592	NMR structure of Orf47 from Lactococcus virus P2	425	X
30593	CSP1-cyc(K6D10)	138	X
30594	CSP1-cyc(Orn6D10)	130	X
30595	CSP1-cyc(Dab6E10)	135	X
30596	S8 phosphorylated beta amyloid 40 fibrils	123	X
30597	Wasabi Receptor Toxin	331	X
30598	Solution structure of scorpion Hottentotta jayakari venom toxin Hj1a	747	X
30599	Solution structure of VEK50RH1/AA	543	X
30600	Solution structure of truncated peptide from PAMap53	561	X
30601	CSP1-cyc(Dap6E10)	139	X
30602	NMR Structure of Branched K11/K48-Linked Tri-Ubiquitin	280	X
30603	Solution structure of VEK50 in the bound form with plasminogen kringle 2	491	X
30604	Solution NMR structure of a quiet outer membrane protein G Nanopore (OmpG mutant: Delta-L6-D215)	1199	X
30605	SOLUTION STRUCTURE OF THE COMPLEX OF MUTANT VEK50[RH1/AA] AND PLASMINOGEN KRINGLE 2	1570	X
30606	SOLUTION STRUCTURE OF THE COMPLEX OF MUTANT VEK50[RH2/AA] AND PLASMINOGEN KRINGLE 2	1602	X
30607	U-AITx-Ate1	85	X
30608	An order-to-disorder structural switch activates the FoxM1 transcription factor	331	X
30609	THREE-DIMENSIONAL STRUCTURE IN SOLUTION OF THE RIBBON DISULFIDE ISOMER OF THE NICOTINIC ACETYLCHOLINE RECEPTOR ANTAGONIST ALPHA-CONOTOXIN TxIA	148	X
30610	hMcl1 inhibitor complex	1876	X
30611	NMR solution structure of YfiD	482	X
30613	CS-Rosetta Model of PEA-15 Death Effector Domain	444	X
30614	CS-Rosetta Model of PEA-15 Death Effector Domain in the Complex with ERK2	465	X
30615	SOLID-STATE NMR STRUCTURE OF PISCIDIN 3 IN ALIGNED 4:1 PHOSPHATIDYLCHOLINE/CHOLESTEROL LIPID BILAYERS	20	X
30616	SOLID-STATE NMR STRUCTURE OF PISCIDIN 1 IN ALIGNED 4:1 PHOSPHATIDYLCHOLINE/CHOLESTEROL LIPID BILAYERS	21	X
30617	NMR Solution structure of native tachyplesin II peptide	177	X
30618	NMR Solution structure of native tachyplesin III peptide	181	X
30619	NMR Solution structure of cyclic tachyplesin I	201	X
30620	NMR Solution structure of cyclic tachyplesin II	178	X
30621	NMR Solution structure of cyclic tachyplesin III	204	X
30622	Solution Structure of lncRNA (LINK-A) 20-nt Hexaloop Hairpin	280			X
30623	Solution structure of the C-terminal zinc finger of the C. elegans protein MEX-5	368	X
30625	Antimicrobial lasso peptide ubonodin	172	X
30626	Solution structure of conotoxin MiXXVIIA	176	X
30627	Structural Basis for Client Recognition and Activity of Hsp40 Chaperones	955	X
30628	Structural Basis for Client Recognition and Activity of Hsp40 Chaperones	939	X
30629	Structural Basis for Client Recognition and Activity of Hsp40 Chaperones	850	X
30630	Solution structure of OlvA(BCS)	82	X
30631	Solution structure of OlvA(BC)	84	X
30632	Structural Basis for Client Recognition and Activity of Hsp40 Chaperones	949	X
30633	N-terminal domain of dynein intermediate chain from Chaetomium thermophilum	1109	X
30634	Structural Basis for Client Recognition and Activity of Hsp40 Chaperones	864	X
30635	Structural Basis for Client Recognition and Activity of Hsp40 Chaperones	909	X
30636	Structural Basis for Client Recognition and Activity of Hsp40 Chaperones	970	X
30637	Structural Basis for Client Recognition and Activity of Hsp40 Chaperones	869	X
30638	Structural Basis for Client Recognition and Activity of Hsp40 Chaperones	2726	X
30639	NMR data-driven model of KRas-GMPPNP:RBD-CRD complex tethered to a nanodisc (state A)	557	X
30640	NMR data-driven model of KRas-GMPPNP:RBD-CRD complex tethered to a nanodisc (state B)	557	X
30641	Backbone-modified variant of zinc finger 2 from the transcription factor Sp1 DNA binding domain: D-Pro in the metal-binding turn	211	X
30642	Backbone-modified variant of zinc finger 2 from the transcription factor Sp1 DNA binding domain: Aib in the metal-binding turn	207	X
30643	Backbone-modified variant of zinc finger 2 from the transcription factor Sp1 DNA binding domain: Orn in the metal-binding turn	206	X
30644	Backbone-modified variant of zinc finger 2 from the transcription factor Sp1 DNA binding domain: altered helix, loop, turn, and sheet	196	X
30645	Influenza B M2 Proton Channel in the Closed State - SSNMR Structure at pH 7.5	198	X
30646	Influenza B M2 Proton Channel in the Open State - SSNMR Structure at pH 4.5	238	X
30647	Dg12a	365	X
30648	Dg3b	400	X
30650	Synoeca peptide was isolated from the venom of wasp synoeca surinama.	154	X
30651	Lasso peptide pandonodin	235	X
30652	Human CstF-64 RRM	444	X
30653	Human CstF-64 RRM mutant - D50A	423	X
30654	NMR solution structure of triazole bridged SFTI-1	156	X
30655	Solution NMR structure of the DNAJB6b deltaST variant (Aligned on the J domain)	977	X
30656	Solution NMR structure of the DNAJB6b deltaST variant (Aligned on the CTD domain)	977	X
30657	Solution Structure of a Heat-Resistant Long-Acting Insulin Analog	456	X
30658	Solution structure of paxillin LIM4	769	X
30659	Solution structure of paxillin LIM4 in complex with kindlin-2 F0	1641	X
30660	Solution NMR structure of the nodule-specific cysteine-rich peptide NCR044 from Medicago truncatula	431	X
30661	Solution NMR Structure Of The Full Length Latent Form MinE Protein From Neisseria gonorrheae	460	X
30662	Solution NMR Structure Of The Partially Activated MTS Deleted Form MinE Protein (delta10-ngMinE) From Neisseria gonorrheae	459	X
30663	Solution NMR Structure Of The delta30-ngMinE Protein From Neisseria gonorrheae	254	X
30664	Solution NMR Structure Of The I24N-delta10-ngMinE Protein From Neisseria gonorrheae	277	X
30665	NMR assignment and RNA structure of 5' UTR region stem loop from West Nile Virus	505			X
30666	NMR solution structure of SFTI-R10	155	X
30667	NMR solution structure of SFTI1 based KLK7 protease inhibitor	149	X
30668	NMR solution structure of SFTI-1 based plasmin inhibitor	148	X
30669	NMR solution structure of triazole bridged matriptase inhibitor	157	X
30670	NMR solution structure of a triazole bridged KLK7 inhibitor	153	X
30671	NMR solution structure of triazole bridged plasmin inhibitor	168	X
30672	SMARCB1 nucleosome-interacting C-terminal alpha helix	495	X
30673	Backbone-modified variant of zinc finger 2 from the transcription factor Sp1 DNA binding domain: BTD in the metal-binding turn	211	X
30674	Zinc finger 2 from the transcription factor Sp1 DNA binding domain	211	X
30675	Solution-state NMR structural ensemble of human Tsg101 UEV in complex with K63-linked diubiquitin	542	X
30676	NMR structure of biofilm-related EbsA from Synechococcus elongatus	1376	X
30677	Solution structure of an organic hydroperoxide resistance protein from Burkholderia pseudomallei. Seattle Structural Genomics Center for Infectious Disease target BupsA.00074.a.	1396	X
30678	Structure of the HIV-1 gp41 transmembrane domain and cytoplasmic tail (LLP2)	460	X
30679	Gypsy Moth Pheromone-binding protein 1 (LdisPBP1) NMR Structure at pH 4.5	1746	X
30680	Sleeping Beauty transposase PAI subdomain mutant - H19Y	558	X
30681	3D structure of the leiomodin/tropomyosin binding interface	658	X
30682	Structure of acrorhagin I from the sea anemone Actinia equina	536	X
30683	Solution structure of the cyclic peptide 3.1B	111	X
30684	NMR structure of the HACS1 SH3 domain	757	X
30686	Solution structure of AGL55-Kringle 2 complex	605	X
30687	Solution structure of KTI55-Kringle 2 complex	578	X
30688	Molecular Recognition of Guanine Metabolites and Drugs by Vacancy-Bearing G-Quadruplex in the PDGFR-b Promoter	171		X
30690	CSP1-E1A-cyc(Dap6E10)	133	X
30691	NMR Structure of C-terminal Domain of phi29 ATPase	1185	X
30692	DanD	10	X
30693	EROS3 RDC and NOE Derived Ubiquitin Ensemble	997	X
30694	The HADDOCK structure model of GDP KRas in complex with its allosteric inhibitor E22	320	X
30695	Solution structure of delta-theraphotoxin-Hm1b from Heteroscodra maculata	362	X
30696	Solution NMR structure of Dictyostelium discoideum Skp1A (truncated) dimer	1506	X
30697	Solution Structure of the Tau pre-mRNA Exon 10 Splicing Regulatory Element	118			X
30698	Solution Structure of the Tau pre-mRNA Exon 10 Splicing Regulatory Element Bound to MH5	148			X
30699	Solution Structure of the Tau pre-mRNA Exon 10 Splicing Regulatory Element Bound to MQC	139			X
30700	Solution Structure of the Tau pre-mRNA Exon 10 Splicing Regulatory Element Bound to MIP	116			X
30701	61 nt human Hepatitis B virus epsilon pre-genomic RNA	474			X
30702	Solution NMR structure of enterococcal cytolysin S (CylLS") produced by Enterococcus faecalis	174	X
30703	Solution structure of the TTD and linker region of UHRF1	1792	X
30704	Solution structure of the TTD and linker region of mouse UHRF1 (NP95)	1963	X
30705	Solution structure of the PHD of mouse UHRF1 (NP95)	860	X
30706	De novo designed Rossmann fold protein ROS2_49223	1209	X
30707	De novo designed Rossmann fold protein ROS2_835	1091	X
30708	De novo designed Rossmann fold protein ROS2_36830	1217	X
30710	Solution NMR structure of enterococcal cytolysin L (CylLL") produced by Enterococcus faecalis	218	X
30711	NMR Solution Structure of Excelsatoxin A	356	X
30712	Solution NMR of Prochlorosin 1.1 produced by Prochlorococcus MIT 9313	89	X
30713	Solution NMR structure of Prochlorosin 2.10 produced by Prochlorococcus MIT 9313	131	X
30714	Solution NMR structure of Prochlorosin 2.1 produced by Prochlorococcus MIT 9313	142	X
30716	Stigmurin	65	X
30717	Hs05 - Intragenic antimicrobial peptide	116	X
30718	Solution NMR of Prochlorosin 2.8 produced by Prochlorococcus MIT 9313	159	X
30719	NMR solution structure of tamapin, mutant K20A	203	X
30720	Solution structure of antifungal plant defensin PvD1	436	X
30721	Solution structure of Pseudomonas aeruginosa IF3 C-terminal domain	1025	X
30722	Solution NMR structure of the N-terminal domain of the Serine/threonine-protein phosphatase 1 regulatory subunit 10, PPP1R10	1852	X
30723	Cap3G-TAR-F1	160			X
30724	Cap1G-TPUA	613			X
30725	Solution structure of the N-terminal helix-hairpin-helix domain of human MUS81	1096	X
30726	Structure of the C-terminal Domain of RAGE and Its Inhibitor	383	X
30727	NMR solution structure of natural scorpion toxin Cl13	765	X
30728	Structural characterization of novel conotoxin MIIIB derived from Conus magus	218	X
30729	NMR solution structure of a triazole bridged trypsin inhibitor based on the framework of SFTI-1	150	X
30730	Tandem UU:GA mismatch within an RNA helix	505			X
30731	Amyloid-beta(1-40) fibril derived from Alzheimer's disease cortical tissue	98	X
30734	NMR-driven structure of KRAS4B-GTP homodimer on a lipid bilayer nanodisc	154	X
30735	NMR-driven structure of KRAS4B-GDP homodimer on a lipid bilayer nanodisc	190	X
30736	Solution structure of the FYVE domain of ALFY	832	X
30737	Dimeric form of the trans-stabilized Hemolysin II C-terminal domain	424	X
30738	Solution NMR structure of the myristoylated feline immunodeficiency virus matrix protein	1165	X
30739	Solution NMR structure of the unmyristoylated feline immunodeficiency virus matrix protein	1207	X
30740	Solution NMR Structure of the G4L/Q5K/G6S (NOS) Unmyristoylated Feline Immunodeficiency Virus Matrix Protein	910	X
30741	Atomic-Resolution Structure of HIV-1 Capsid Tubes by Magic Angle Spinning NMR	1126	X
30744	NMR Structure of HSP1-NH2 antimicrobial peptide in presence of SDS-d25 micelles	134	X
30745	NMR Structure of HSP1-NH2 antimicrobial peptide in presence of DPC-d38 micelles	132	X
30746	NMR Structure of HSP-4 antimicrobial peptide in presence of DPC-d38 micelles	136	X
30747	Solution NMR structure of the orbitide xanthoxycyclin D	65	X
30748	Solution structure of vicilin-buried peptide-10 from cucumber	306	X
30749	Solution structure of the seed peptide C2 (VBP-1) from pumpkin	441	X
30750	NMR solution structure of leech peptide HSTX-I	235	X
30752	NMR soltution structure of homotarsinin homodimer - Htr	251	X
30753	Solution NMR structure of de novo designed TMB2.3	549	X
30754	NMR solution structure of Asterix/Gtsf1 from mouse (CHHC zinc finger domains)	886	X
30755	B24Y DKP insulin	525	X
30756	NMR structure of the putative GTPase-Activating (GAP) domain of VopE	1516	X
30757	Structure of the C-terminal domain of BCL-XL in membrane	200	X
30758	Pharmacological characterisation and NMR structure of the novel mu-conotoxin SxIIIC, a potent irreversible NaV channel inhibitor	188	X
30759	Structure of a Stable Interstrand DNA Crosslink Involving an dA Amino Group and an Abasic Site	196		X
30760	NMR structure of Ost4 in DPC micelles	406	X
30761	NMR structure of Ost4 in DPC micelles	366	X
30763	Solution NMR Structure of DE NOVO DESIGNED Rossmann 2x3 Fold Protein r2x3_168, Northeast Structural Genomics Consortium (NESG) Target OR386	1552	X
30765	Structural characterization of the type III secretion system pilotin-secretin complex InvH-InvG by NMR spectroscopy	1561	X
30767	Solution NMR structure of recifin, a cysteine-rich tyrosyl-DNA Phosphodiesterase I modulatory peptide from the marine sponge Axinella sp.	369	X
30768	Structure of the Self-Association Domain of Swallow	969	X
30769	Structure of HIV-1 Vpr in complex with the human nucleotide excision repair protein hHR23A	2569	X
30770	Ablb 1b isoform active state	977	X
30771	Abl isoform 1b inactive1 state	544	X
30772	Abl 1b isoform inactive2 state	553	X
30773	Intrinsically disordered bacterial polar organizing protein Z, PopZ, interacts with protein binding partners through an N-terminal Molecular Recognition Feature	1007	X
30774	NMR structure of the cNTnC-cTnI chimera bound to calcium desensitizer W7	1418	X
30775	Solution NMR structure of neuroVAL, a derived peptide from wasp	140	X
30776	Solution NMR structure of protonectin, a peptide from wasp	158	X
30777	Solution structure of a reconstructed XCL1 ancestor	771	X
30778	Solution NMR structure of protonectin-F, a derived peptide from wasp	136	X
30779	NMR structure of the Streptococcus pyogenes NAD+-glycohydrolase translocation domain	790	X
30782	A common binding motif in the ET domain of BRD3 participates in polymorphic structural interfaces with host and viral proteins	1058	X
30783	NMR Solution Structure of plant defensin AtD90	470	X
30784	NMR Solution Structure of plant defensin SlD26	397	X
30785	The solution structure of omega-theraphotoxin-Pm1b isolated from King Baboon spider	401	X
30786	Solution NMR structure of human Brd3 ET domain with MLV IN C-terminal Tail Peptide (TP) complex	1218	X
30787	Solution NMR structure of citrulassin F	59	X
30788	The FARFAR-NMR Ensemble of 29-mer HIV-1 Trans-activation Response Element RNA (N=20)	421			X
30789	Solution NMR structure of Prochlorosin 2.11 (Pcn2.11) produced by Prochlorococcus MIT 9313	86	X
30790	Solution NMR structure of human Brd3 ET complexed with NSD3(148-184) peptide	1368	X
30791	Solution NMR structure and dynamics of human Brd3 ET in complex with MLV IN CTD	1889	X
30792	Peptide from stony coral Heliofungia actiniformis: Hact-1	97	X
30793	Solution structure of lantibiotic from Paenibacillus kyungheensis	341	X
30795	SARS-CoV-2 Envelope Protein Transmembrane Domain: Pentameric Structure Determined by Solid-State NMR	161	X
30796	Solution NMR Structure of the Coiled-coil BRCA1-PALB2 Heterodimer	1254	X
30797	Dengue 5'UTR SLA	126			X
30798	Solution Structure of the Dysferlin C2A Domain in its Calcium-free State	1192	X
30799	Transmembrane structure of TNFR1	106	X
30800	Solution Structure of the Corynebacterium diphtheriae SpaA Pilin-Signal Peptide Complex	1691	X
30801	NMR solution structures of tirasemtiv drug bound to a fast skeletal troponin C-troponin I complex	1472	X
30802	Solution NMR Structure of DE NOVO DESIGNED Rossmann 3x3 Fold Protein r3x3_bp3, Northeast Structural Genomics Consortium (NESG) Target OR689	1614	X
30803	Solution structure of the major MYC promoter G-quadruplex with a wild-type flanking sequence	234		X
30804	Solution structure of the major MYC promoter G-quadruplex with a wild-type flanking in complex with NSC85697, a quinoline derivative	228		X
30805	Solution structure of the major MYC promoter G-quadruplex in complex with NSC85697, a quinoline derivative	205		X
30807	The structure of anti-CRISPR AcrIE2	897	X
30808	Solution structure of the PHD1 domain of histone demethylase KDM5A	635	X
30809	Solution structure of the PHD1 domain of histone demethylase KDM5A in complex with a histone H3(1-10) peptide	704	X
30810	Structure of the integrin aIIb(W968V)b3 transmembrane complex	316	X
30811	Solution structure of the alpha-conotoxin analogue [2-8]-alkyne Vc1.1	145	X
30812	Solution NMR structure of CDHR3 extracellular domain EC1	1403	X
30813	NMR Solution Structure of Acyclotide ribe 31	283	X
30814	Solution Structure of the Dysferlin C2A Domain in its Calcium-bound State	1464	X
30816	Au1 Domain of VEGF Readthrough Element	180			X
30817	Ax1 Domain of VEGF Readthrough Element	135			X
30818	Ax2 Domain of VEGF Readthrough Element	76			X
30819	NMR Structure of a tRNA 2'-phosphotransferase from Runella slithyformis	2036	X
30820	NMR Structure of a tRNA 2'-phosphotransferase from Runella slithyformis in complex with NAD+	1950	X
30821	Solution Structure of the R2ab Repeat Domain from Staph. epidermidis Autolysin (AtlE)	1633	X
30822	Deoxyuridine in DNA Structure: Solution Structure of [d(CGUGAATTCGCG)]2	78		X
30823	1,N6-ethenoadnine (E) in dsDNA sequence (5'-CGCGEATTCGCG-3')	85		X
30824	Protein complex	924	X
30825	Solution structures of full-length K-RAS bound to GDP	2208	X
30826	NMR solution structure of Nak1 from the Necator americanus hookworm	413	X
30827	Solution NMR structure of the dimeric form of the cyclic plant protein PDP-23 in H2O	249	X
30828	Solution NMR structure of the monomeric form of the cyclic plant protein PDP-23 in CD3CN/H2O	241	X
30829	Solution NMR structure of the cyclic plant protein PDP-23 in SDS micelles	171	X
30830	Solution NMR structure of the cyclic plant protein PDP-23 in DPC micelles	207	X
30832	ApoL1 N-terminal domain	1306	X
30833	Solution Structure of NuxVA	83	X
30834	NMR solution structure of Nav1.5 DIV S3b-S4a paddle motif in DPC micelle	349	X
30838	Connecting hydrophobic surfaces in cyclic peptides increases membrane permeability	10	X
30839	Connecting hydrophobic surfaces in cyclic peptides increases membrane permeability	10	X
30840	Connecting hydrophobic surfaces in cyclic peptides increases membrane permeability	10	X
30842	SARS-CoV-2 spike Protein TM domain	81	X
30843	Aspartimidylated Lasso Peptide Lihuanodin	84	X
30844	High resolution NMR solution structure of a de novo designed minimal thioredoxin fold protein	803	X
30845	The haddock model of GDP KRas in complex with promazine using chemical shift perturbations and intermolecular NOEs	310	X
30846	Structural characterization of two b-KTx scorpion toxins. One of them blocks human KCNQ1 potassium channels	300	X
30847	NMR structure of Beta-KTx14.3	257	X
30848	NMR Solution Structure of [T20K]kalata B1	273	X
30849	Omega ester peptide pre-fuscimiditide	136	X
30850	The isolated chicken ASIC1a thumb domain (ATD-c1a) retains the structure and ligand binding properties of the full length chicken ASIC1a	924	X
30851	Aspartimidylated omega ester peptide fuscimiditide	132	X
30852	[2]Catenane From MccJ25 Variant G12C G21C	125	X
30853	Denv1 5'UTR Stem3	119			X
30854	NMR solution structure of PsDef2 defensin from P. sylvestris	575	X
30855	Structure of the HIV-1 gp41 transmembrane domain and cytoplasmic tail	595	X
30856	Model of the HIV-1 gp41 membrane-proximal external region, transmembrane domain and cytoplasmic tail	656	X
30857	Structure of Nedd4L WW3 domain	594	X
30858	Structure of Nedd4L WW3 domain	786	X
30861	Solution NMR structure of the PNUTS amino-terminal Domain fused to Myc Homology Box 0	2062	X
30863	L-Phenylseptin	139	X
30864	D-Phenylseptin - The second residue of PHE of the peptide is a D-amino acid	124	X
30866	Structure of the cryptic HMA domain of the human copper transporter ATP7A	273	X
30867	Structural studies about ScnTx neurotoxin using Solution NMR 2D and 3D	724	X
30868	Solution structure of the HIV-1 PBS-segment	474			X
30869	Jug R 2 N-Terminal Fragment 3	329	X
30870	Jug R 2 Leader Sequence Residues 1-57	454	X
30871	Jug r 2 Leader Sequence Residues 69-111	361	X
30872	Solution structure of tarantula toxin omega-Avsp1a	396	X
30873	Structure of Hact-SCRiP1	293	X
30874	Structure and Interactions of DED1 of human cFLIP	2239	X
30875	Ara h 1 leader sequence, Ara h 1.0101 (25-83) A25G	493	X
30876	Solution NMR structure of an avian defensin, AvBD3, from mallard	364	X
30877	Magic Angle Spinning NMR Structure of Human Cofilin-2 Assembled on Actin Filaments	942	X
30878	Structural and functional studies about scorpine showed the presence of blocking channel and cytolytic activities as well as two different structural domains	287	X
30879	Structural and functional studies about scorpine showed the presence of blocking channel and cytolytic activities as well as two different structural domains	202	X
30880	NMR structure of the Human T-cell leukemia virus 1 matrix protein	1232	X
30881	Solution NMR Structure of PawL-Derived Peptide PLP-13	81	X
30882	Solution NMR Structure of PawL-Derived Peptide PLP-16	67	X
30883	Solution NMR Structure of PawL-Derived Peptide PLP-22	71	X
30884	Solution NMR Structure of PawL-Derived Peptide PLP-29	68	X
30885	Solution NMR Structure of PawL-Derived Peptide PLP-38	66	X
30886	Solution NMR Structure of PawL-Derived Peptide PLP-42	70	X
30887	Solution NMR Structure of PawL-Derived Peptide PLP-46	76	X
30888	NMR Structure of GCAP5	1551	X
30889	Solution NMR Structure of PawS-Derived Peptide PDP-24	251	X
30890	Solution NMR structure of de novo designed protein 0515	1198	X
30891	NMR Structure of Schistocin-1 antimicrobial peptide in presence of DPC-d38 micelles	229	X
30892	NMR Structure of Schistocin-2 antimicrobial peptide in presence of DPC-d38 micelles	170	X
30893	NMR Structure of Schistocin-3 antimicrobial peptide in presence of DPC-d38 micelles	138	X
30894	NMR Structure of Schistocin-4 antimicrobial peptide in presence of DPC-d38 micelles	145	X
30895	NMR Solution Structure of a CsrA-binding peptide	74	X
30896	Structure of Hact-4	316	X
30899	Solution NMR structure of HDMX in complex with Zn and MCo-52-2	1100	X
30900	LyeTx I	105	X
30901	Rules for designing protein fold switches and their implications for the folding code	650	X
30902	Rules for designing protein fold switches and their implications for the folding code	452	X
30903	Homotarsinin monomer - Htr-M	261	X
30904	Rules for designing protein fold switches and their implications for the folding code	696	X
30905	Rules for designing protein fold switches and their implications for the folding code	413	X
30906	The haddock model of GDP KRas in complex with promethazine using NMR chemical shift perturbations	310	X
30907	Solution Structure of Berberine Bound to a dGMP Fill-in G-Quadruplex in the PDGFR-b Promoter	171		X
30908	Solution NMR structure of the XVIPCD region from the T4SS effector X-Tfe(XAC2609) from Xanthomonas citri	964	X
30909	Fusion Peptide of SARS-CoV-2 Spike Rearranges into a Wedge Inserted in Bilayered Micelles	488	X
30910	Anaplastic lymphoma kinase (ALK) extracellular ligand binding region 673-1025	2231	X
30911	AUGalpha - FAM150B - ALKL2 77-152	849	X
30912	AUGbeta - FAM150A - ALKL1 60-128	824	X
30913	NMR structure of EpI[Y(SO)315Y]-OH	143	X
30915	NMR structure of native PnIA	123	X
30916	NMR structure of native AnIB	133	X
30917	NMR structure of AnIB-OH	130	X
30918	NMR structure of AnIB[Y(SO3)16Y]-NH2	136	X
30919	NMR structure of AnIB[Y(SO3)16Y]-OH	132	X
30920	NMR structure of native EpI	140	X
30921	NMR structure of EpI-OH	141	X
30922	NMR structure of EpI-[Y(SO3)15Y]-NH2	143	X
30923	Solution structure of the MYC promoter G-quadruplex in complex with berberine: conformer A	230		X
30924	Solution structure of the MYC promoter G-quadruplex in complex with berberine: conformer B	230		X
30925	NMR Solution structure of Se0862	1373	X
30926	Solution NMR structure of peptidase domain from Clostridium thermocellum PCAT1	1830	X
30927	SDE2-apo	655	X
30928	Solution structure of peptide toxin MIITX2-Mg1a from the venom of the Australian giant red bull ant Myrmecia gulosa	552	X
30929	Immature HIV-1 CACTD-SP1 lattice with Bevirimat (BVM) and Inositol hexakisphosphate (IP6)	762	X
30930	Immature HIV-1 CACTD-SP1 lattice with Inositol hexakisphosphate (IP6)	743	X
30931	Membrane bound structure of HR1 domain of SARS-CoV-2 spike protein	212	X
30932	Heterogeneous-backbone proteomimetic analogue of the disulfide-rich venom peptide lasiocepsin	197	X
30933	Solution NMR Structure of [Ala19]Crp4	354	X
30934	Solution NMR Structure of [D-Ala19]Crp4	347	X
30935	NMR Solution structure of linear [T20K]kalataB1	267	X
30936	Atomic-Resolution Structure of Kinesin-1 Motor Domain in Complex with Polymeric Microtubules by Magic Angle Spinning NMR	1376	X
30937	Solution NMR structure of PDLIM7 PDZ bound to SNX17 peptide	1244	X
30938	hyen D solution structure	296	X
30939	Structures of the Intracellular Domain and Transmembrane Domain of the Human alpha7 Nicotinic Acetylcholine Receptors	2113	X
30940	Hairpin near 3'-Splice Site of Influenza A Segment 7 Bound to 5-nt Oligonucleotide	189		X	X
30941	I5R8 Mastoparano is a peptide synthetic, modified of Mastoparano (extracted from wasp venom)	176	X
30942	An RNA aptamer that decreases flavin redox potential	165			X
30943	Solution structure of first cyclization domain (Cy1) from yersiniabactin synthetase	3188	X
30944	The solution structure of remipede double-ICK toxin phi-Xibalbin3-Xt3a	838	X
30945	Solution NMR structure of uperin 3.5 in SDS micelles	211	X
30946	NMR Solution Structure of hGal(2-12)KK, a solubility-tagged truncation of the human neuropeptide galanin	98	X
30947	NMR Solution Structure of hGal(1-12)KK, a solubility-tagged truncation of the human neuropeptide galanin	98	X
30948	NMR Solution Structure of hGal(1-12)KK, a solubility-tagged truncation of the human neuropeptide galanin	124	X
30949	NMR Solution Structure of Cter 27	324	X
30950	Solution NMR structure of substrate bound peptidase domain from PCAT1	1808	X
30951	NMR solution structure of a neurotoxic thionin from Urtica ferox	349	X
30952	Solution NMR structure of barrettide C	237	X
30953	Native mu-conotoxin KIIIA isomer	146	X
30954	Mu-conotoxin KIIIA isomer 2	146	X
30955	SARS-CoV-2 Nucleocapsid N-terminal domain (N-NTD) protein	875	X
30956	Solution structure of the zinc finger domain of murine MetAP1, complexed with ZNG N-terminal peptide	979	X
30957	EmrE S64V Mutant Bound to tetra(4-fluorophenyl)phosphonium at pH 8.0	724	X
30958	Filamin complex-2	807	X
30959	Domain III (EDIII) of the POWV E glycoprotein	1279	X
30960	Solution NMR Structure of Immunoglobulin-like Domain of Human Neuregulin-1	1418	X
30961	Solution structure of spider toxin Ssp1a	278	X
30962	NMR structure of cTnC-TnI chimera bound to calcium and A1	1602	X
30963	NMR structure of cTnC-TnI chimera bound to calcium and A2	1597	X
30965	cTnC-TnI chimera complexed with A1	1589	X
30966	cTnC-TnI chimera complexed with A2	1586	X
30967	cTnC-TnI chimera complexed with calcium	1570	X
30968	NMR solution structure TnC-TnI chimera	1577	X
30969	Solution Structure of Sds3 Capped Tudor Domain	972	X
30970	NMR structure of a designed cold unfolding four helix bundle	1334	X
30971	Solution structure of 7SK stem-loop 1 with HEXIM Arginine Rich Motif	403	X		X
30972	Solution structure of 7SK stem-loop 1 with HIV-1 Tat Subtype G Arginine Rich Motif	222	X		X
30973	Solution structure of 7SK stem-loop 1 with HIV-1 Tat Finland Arginine Rich Motif	219	X		X
30974	Solution structure of the model HEEH mini protein HEEH_TK_rd5_0341	572	X
30975	Truncated Ac-AIP-2	138	X
30976	The peptide Lt-MAP4 is an analog derived from the Ltc-3a. The primary sequence of the parental peptide was used as template for rational design, using the amino acid residues for modification of charge and hydrophobicity.	131	X
30977	NMR structure of crosslinked cyclophilin A	1625	X
30978	Structural characterization of the biological synthetic peptide pCEMP1	99	X
30979	Chickpea (Cicer arientinum) nodule-specific cysteine-rich peptide NCR13: Solution NMR structure of the isomer with C4:C10, C15:C30, and C23:C28 disulfide bonds	318	X
30980	B Domain of Staphylococcal protein A: Native backbone	424	X
30981	Backbone-modified variant of the B domain of Staphylococcal protein A: beta3-residues in helix 2	428	X
30982	Backbone-modified variant of the B domain of Staphylococcal protein A: Aib residues in helix 2	418	X
30983	Backbone-modified variant of the B domain of Staphylococcal protein A: beta3-residues in helix 3	427	X
30984	Backbone-modified variant of the B domain of Staphylococcal protein A: Aib residues in helix 3	423	X
30985	Solution structure of the phosphatidylinositol 3-phosphate binding domain from the Legionella effector SetA	1386	X
30986	NMR solution structure of the phosphorylated MUS81-binding region from human SLX4	982	X
30987	Disulfide-rich venom peptide lasiocepsin: P20A mutant	212	X
30988	Heterogeneous-backbone proteomimetic analogue of the disulfide-rich venom peptide lasiocepsin: native loop	200	X
30989	Heterogeneous-backbone proteomimetic analogue of the disulfide-rich venom peptide lasiocepsin: beta-3-Lys modified loop	192	X
30990	Heterogeneous-backbone proteomimetic analogue of the disulfide-rich venom peptide lasiocepsin: D-Ala modified loop	200	X
30991	Structural of the globular isoform of the novel conotoxin PnID derived from Conus pennaceus	121	X
30992	Structure of the globular isoform of the novel conotoxin PnID derived from Conus pennaceus	106	X
30993	Solution structure for Bartonella henselae BamE, a component of the beta-barrel assembly machinery complex. Seattle Structural Genomics Center for Infectious Disease target BaheA.17605.a	1259	X
30994	Iturin from Bacillus subtilis ATCC 19659	74	X
30995	Solution NMR structure of Vibrio cholerae ferrous iron transport protein C (FeoC)	793	X
30997	Solution NMR structure of 9-residue Rosetta-designed cyclic peptide D9.16 in d6-DMSO with cis/trans switching	106	X
30998	Solution NMR structure of 8-residue Rosetta-designed cyclic peptide D8.31 in d6-DMSO with cis/trans switching	168	X
30999	Solution NMR structure of 8-residue Rosetta-designed cyclic peptide D8.21 in d6-DMSO with cis/trans switching	49	X
31000	Solution NMR structure of 8-residue Rosetta-designed cyclic peptide D8.21 in 50% d6-DMSO and 50% water with cis/trans switching	104	X
31001	Solution NMR structure of 9-residue Rosetta-designed cyclic peptide D9.16 in CDCl3 with cis/trans switching	225	X
31002	Solution NMR structure of 8-residue Rosetta-designed cyclic peptide D8.31 in CDCl3 with cis/trans switching	44	X
31003	Solution NMR structure of 8-residue Rosetta-designed cyclic peptide D8.21 in CDCl3 with cis/trans switching	163	X
31004	Structure of the N-terminal domain of ViaA	2062	X
31005	NMR structure of the cNTnC-cTnI chimera bound to W8	1305	X
31006	NMR structure of the cNTnC-cTnI chimera bound to W6	1305	X
31007	Evolution avoids a pathological stabilizing interaction in the immune protein S100A9	1038	X
31008	DENV1 SLA RNA (DenvSLATL)	185			X
31009	DENV1 SLA three-way junction RNA (DenvSLAsh)	206			X
31010	NMR solution structure of xanthusin-1	317	X
31011	Solution NMR structure of hexahistidine tagged QseM (6H-QseM)	782	X
31012	Backbone-modified variant of the B domain of Staphylococcal protein A: beta3- and ACPC-residues in helix 2	434	X
31013	Vicilin Ana o 1.0101 leader sequence residues 20-75	447	X
31014	Ana o 1 Leader Sequence Residues 82-132	464	X
31015	Pis v 3.0101 Vicilin Leader Sequence Residues 5-52	333	X
31016	Pis v 3.0101 vicilin leader sequence residues 56-115	523	X
31017	NMR solution structure of the De novo designed small beta-barrel protein 29_bp_sh3	760	X
31018	NMR solution structure of the De novo designed small beta-barrel protein 33_bp_sh3	694	X
31019	Solution NMR structure of 9-residue Rosetta-designed cyclic peptide D9.16 in CDCl3 with cis/trans switching (B-TC conformation)	112	X
31020	GFP Nanobody NMR Structure	1039	X
31021	Solution NMR structure of 8-residue Rosetta-designed cyclic peptide D8.31 in d6-DMSO with cis/trans switching (B-CT conformation)	82	X
31022	Solution NMR structure of 8-residue Rosetta-designed cyclic peptide D8.21 in 50% d6-DMSO and 50% water with cis/trans switching (CC conformation, 50%)	52	X
31023	Solution NMR structure of 8-residue Rosetta-designed cyclic peptide D8.21 in CDCl3 with cis/trans switching (TC conformation, 53%)	108	X
31024	NMR structure of a Stapled Lanthipeptide Natural Product	158	X
31025	TPX2 Minimal Active Domain on Microtubules	851	X
31026	Intramembrane recognition between transmembrane domains of IL-7R and common gamma chain	548	X
31027	Intramembrane recognition between transmembrane domains of IL-9R and common gamma chain	596	X
31028	NMR shows why a small chemical change almost abolishes the antimicrobial activity of GccF	412	X
31029	NMR Structure of Ac-hGal(17-30)NH2, an N-terminally acetylated fragment of the C-terminus of human galanin	86	X
31030	Site 2 insulin receptor binding peptide IM459N21	247	X
31031	NMR Structure of Streptococcal Protein GB1 Backbone Modified Variant: beta-ACPC24, beta-3-Lys28, beta-3-Lys31, beta-ACPC35	388	X
31032	NMR Solution Structure of C-terminally amidated, Full-length Human Galanin	194	X
31033	Solution structure of a model HEEH mini-protein (HEEH_TK_rd5_0958)	552	X
31034	Preligand association structure of DR5	831	X
31035	Solution Structure of the H3 protein	1420	X
31036	Aspartimidylated Graspetide Amycolimiditide	152	X
31037	Antimicrobial lasso peptide cloacaenodin	145	X
31038	NMR-derived ensemble of the TAZ2 domain of p300 bound to the microphthalmia-associated transcription factor	1435	X
31039	VPS37A_21-148	1480	X
31040	Solution structure of the WH domain of MORF	738	X
31043	UBE3A isoform 3 AZUL	960	X
31044	The solution structure of abxF, an enzyme catalyzing the formation of chiral spiroketal of an antibiotics, (-)-ABX	2702	X
31045	Solution NMR structure of a computationally designed mastoparan-like peptide, mastoparan-R1	200	X
31046	The solution structure of abxF in complex with its product (-)-ABX, an enzyme catalyzing the formation of the chiral spiroketal of an anthrabenzoxocinone antibiotic, (-)-ABX	2672	X
31047	NMR structure of the solution of a mastoparan-like peptide, computationally designed mastoparan-R4	168	X
31048	Backbone modifications in the inter-helix loop of designed miniprotein oPPalpha: Asp10Asn11 turn	249	X
31049	Backbone modifications in the inter-helix loop of designed miniprotein oPPalpha: Aib10Gly11 turn	243	X
31050	Backbone modifications in the inter-helix loop of designed miniprotein oPPalpha: DPro10Gly11 turn	249	X
31051	Backbone modifications in the inter-helix loop of designed miniprotein oPPalpha: deltaOrn10-11 turn	246	X
31052	Backbone modifications in the inter-helix loop of designed miniprotein oPPalpha: Aib10Asn11 turn	252	X
31053	Backbone modifications in the inter-helix loop of designed miniprotein oPPalpha: DPro10Pro11 turn	253	X
31054	Structure of elevenin-Vc1 from venom of the Australian cone snail Conus victoriae	195	X
31055	NMR solution structure of lambda-MeuKTx-1	218	X
31056	Ubx Homeodomain NMR solution structure	862	X
31057	AbdA Homeodomain NMR Solution Structure	850	X
31058	Alpha7 nicotinic acetylcholine receptor intracellular and transmembrane domains bound to ivermectin in a desensitized state	2107	X
31059	Tau (297-391) in vitro untwisted fibril	284	X
31060	Structure of N-terminal of Schistosoma japonicum asparaginyl-tRNA synthetase	1173	X
31061	Structure of pre-miR-31 reveals an active role in Dicer processing	383			X
31062	Solution structure of mu-theraphotoxin Cg4a from Chinese tarantula Chilobrachys jingzhao	403	X
31063	Solution structure of Pmu1a	315	X
31064	Human diaphanous inhibitory domain bound to diaphanous autoregulatory domain	2422	X
31065	Backbone and sidechain resonance assignments of human Atg3 with deletions of resides 1 to 25 and residues 90 to 190	2092	X
31066	NMR Solution Structure of LvIC analogue	99	X
31068	STRUCTURE OF ALPHA-SYNUCLEIN FIBRILS DERIVED FROM HUMAN LEWY BODY DEMENTIA TISSUE	237	X
31069	FliT-FliJ fusion complex	1170	X
31070	FlgN-FliJ fusion complex	1258	X
31071	Backbone modifications in the inter-helix loop of designed miniprotein oPPalpha: Pro10DPro11 turn	251	X
31072	Backbone modifications in the inter-helix loop of designed miniprotein oPPalpha: Iva10Asn11 turn	250	X
31073	Reelin C-Terminal Region	341	X
31074	Temperature-dependent structures of tau aggregates	223	X
31075	Temperature-dependent structures of tau aggregates	329	X
31076	Taipan Natriuretic Peptide C -TNPc	193	X
31077	TCEIII NMR Structure	265			X
31078	TCEI_III NMR Structure	17			X
31079	Structural and functional characterisation of Tst2, a novel TRPV1 inhibitory peptide from the Australian sea anemone Telmatactis stephensoni	349	X
31080	BIVALENT INTERACTIONS OF PIN1 WITH THE C-TERMINAL TAIL OF PKC	1960	X
31081	The solution structure of the mini-protein EHEE_rd2_0005	500	X
31082	Solution Structure of the model miniprotein EEHEE_rd4_0871	544	X
31083	Solution structure of the model miniprotein EEHEE_rd4_0642	565	X
31084	Solution structure of the model miniprotein HHH_rd4_0518	545	X
31085	Open State of the SARS-CoV-2 Envelope Protein Transmembrane Domain, Determined by Solid-State NMR	212	X
31086	Antimicrobial lasso peptide achromonodin-1	196	X
31088	Solution NMR structure of a multifunctional synthetic peptide Hp-MAP3 derived from Temporin-PTa	171	X
31089	Backbone Dialkylation in Peptide Hairpins: Natural Backbone Prototype	106	X
31090	Backbone Dialkylation in Peptide Hairpins: (S)-Ethylpropylglycine variant	107	X
31091	Backbone Dialkylation in Peptide Hairpins: (R)-Ethylpropylglycine variant	109	X
31092	Solution NMR structure alpha-helix 3 of Cry10Aa protein	226	X
31093	Solution NMR structure of synthetic peptide AMPCry10Aa_5 rational designed from Cry10Aa bacterial protein	230	X
31094	Solution NMR structure of designed peptide BH33 (RHYYKFNSTGRHYHYY)	109	X
31095	Solution NMR structure of designed peptide BH21 (TMIEDPEAGHFHTSSA)	107	X
31096	Solution NMR structure of designed peptide PH1 (WHMWNTVPNAKQVIAA)	109	X
31097	Solution NMR structure of a RiPP proteusin precursor protein	293	X
31098	Solution structure of the zinc finger repeat domain of BCL11A (ZnF456)	959	X
31099	FARFAR-NMR ensemble of HIV-1 TAR with apical loop capturing ground and excited conformational states	503			X
31100	NMR structure of temporin L in solution	122	X
31101	Solution NMR structure of designed peptide BH26 (RGVTVPHNGESKDYSV)	102	X
31102	NMR structure of L5pG ([p23W, G24W]kalata B1)	254	X
31103	Solution structure for a putative Type I site-specific deoxyribonuclease from Neisseria gonorrhoeae (NCCP11945). Seattle Structural Genomics Center for Infectious Disease target NegoA.19201.a	1161	X
31104	SARS-CoV-2 Envelope Protein Transmembrane Domain: Dimeric Structure Determined by Solid-State NMR	22	X
31105	Solution structure of TET3/MLL4-PHD6	669	X
31106	The FARFAR-MD-NMR ensemble of an HIV-1 TAR excited state	199			X
31107	Solution NMR structure of KaiB variant from Thermosynechococcus elongatus vestitus (KaiBTV-4)	918	X
31108	Solution structure of ACKR3-targeting nanobody VUN701	1381	X
31109	Solution NMR Structure of the lasso peptide chlorolassin	97	X
31110	Solution NMR structure of the lasso peptide wygwalassin-A1	100	X
31111	Chickpea (Cicer arientinum) nodule-specific cysteine-rich peptide NCR13: Solution NMR structure of the isomer with C4:C23, C15:C30, and C10:C28 disulfide bonds	321	X
31112	Structure of the Carboxy terminus of Oleate Hydratase	543	X
31113	Carboxy terminus of Oleate Hydratase in phosphate buffer	531	X
31114	Site-specific Aspartic Acid Dehydration and Isomerization in Streptococcal Protein GB1: Wild-type Protein	386	X
31115	Site-specific Aspartic Acid Dehydration and Isomerization in Streptococcal Protein GB1: D-Asp40 Variant	386	X
31116	Site-specific Aspartic Acid Dehydration and Isomerization in Streptococcal Protein GB1: D-isoAsp40 Variant	386	X
31117	Site-specific Aspartic Acid Dehydration and Isomerization in Streptococcal Protein GB1: L-Aspartyl Succinimide 40-41 Variant	385	X
31118	Site-specific Aspartic Acid Dehydration and Isomerization in Streptococcal Protein GB1: L-isoAsp40 Variant	386	X
31119	Solution conformations of a 12-mer peptide bearing a natural N-hydrophobic triangle	93	X
31120	Solution structure of toxin, U-RDTX-Pp19, from assassin bug Pristhesancus plagipennis	415	X
31121	EmrE structure in the TPP-bound state (WT/E14Q heterodimer)	1454	X
31122	Solution NMR structure of pro-IL-18	2484	X
31123	Solution structure of a 12-mer peptide bearing a bicyclic Asx motif mimic (BAMM) as a synthetic N-cap	70	X
31124	NMR structure of the funnel-web spider toxin Hc3a	425	X
31125	EmrE structure in the proton-bound state (WT/L51I heterodimer)	907	X
31126	TxVIIB,U-superfamily conotoxin	221	X
31130	Solution NMR structure of recifin A [Y6F]	352	X
31134	Solution NMR structure of human DNMT1 N-terminal alpha-helical domain	1026	X
31136	Solution NMR structure of de novo designed protein F3 parent	468	X
31137	Solution NMR Structure of de novo design protein 312 parent	464	X
31138	HADDOCK models of human alphaM I-domain bound to the the N-terminal domain of the cytokine pleiotrophin	2226	X
31139	HADDOCK models of active human alphaM I-domain bound to the the C-terminal domain of the cytokine pleiotrophin	928	X
31140	Tetrahymena thermophila MLP1 RRM domain	1439	X
31141	Wheat Germ Agglutinin (WGA) domain A	237	X
31142	Wheat Germ Agglutinin (WGA) domain C	246	X
31143	Wheat Germ Agglutinin (WGA) domain D	204	X
31145	Graspetide pre-fuscimiditide A1C/T3C variant	130	X
31146	Pembrolizumab CDR-H3 Loop Mimic	242	X
31150	Chemical shifts of CD28 hinge (I114-P152) used in chimeric antigen receptor (CAR) T-cells	492	X
31151	NMR solution structure of cell-permeant miniature protein ZF5.3	323	X
31155	Solution NMR structure of the human LETM1 F-EF-hand domain in the presence of calcium	720	X
31156	Solution NMR structure of conofurin-Delta	123	X
31157	Backbone Modification in the GA Module of Protein PAB: Wild-type Sequence	351	X
31158	Backbone Modification in the GA Module of Protein PAB: beta3-residues at positions 20 and 24	354	X
31159	Backbone Modification in the GA Module of Protein PAB: beta3-residues at positions 22 and 26	343	X
31160	Backbone Modification in the GA Module of Protein PAB: beta3-residues at positions 23 and 26	349	X
31161	Backbone Modification in the GA Module of Protein PAB: ACPC residues at positions 22 and 26	346	X
31162	Backbone Modification in the GA Module of Protein PAB: ACPC residues at positions 5 and 13, beta3 residue at position 9	345	X
31163	Backbone Modification in the GA Module of Protein PAB: ACPC residues at positions 5 and 39, beta3 residue at position 26	345	X
31169	Solution structure of the scorpion toxin omega-Buthitoxin-Hf1a	82	X
31170	Solution NMR structure of halichondamide A, a fused bicyclic cysteine knot undecapeptide from the marine sponge Halichondria bowerbanki	126	X
31173	NMR structure of TLP-1 in solution	125	X
31174	NMR structure of TLP-2 in solution	134	X
31175	NMR structure of TLP-3 in solution	100	X
31177	Covalent Complex Between Parkin Catalytic (Rcat) Domain and Ubiquitin	464	X
31180	Solution NMR structure of the fungal loosenin PcaLOO12 from Phanerochaete carnosa	1140	X
31181	Lanthanide Binding Tag complex LBT3-NH2:La3+	150	X
31188	Structures of small molecules bound to RNA repeat expansions that cause Huntington's disease-like 2 and myotonic dystrophy type 1	83			X
31189	Structures of small molecules bound to RNA repeat expansions that cause Huntington's disease-like 2 and myotonic dystrophy type 1	82			X
31190	Structures of small molecules bound to RNA repeat expansions that cause Huntington's disease-like 2 and myotonic dystrophy type 1	70			X
31191	Structures of small molecules bound to RNA repeat expansions that cause Huntington's disease-like 2 and myotonic dystrophy type 1	107			X
31200	ETO2 MYND bound to MPPL peptide from GATAD2A	702	X
31202	NMR structures of small molecules bound to a model of an RNA CAG repeat expansion.	77			X
34000	D11 bound IGF-II	694	X
34001	D11 bound [S39_PQ]-IGF-II	713	X
34002	D11 bound [N29, S39_PQ]-IGF-II	811	X
34003	PrP226* - Solution-state NMR structure of truncated human prion protein	1435	X
34004	Solution structure of the human SNF5/INI1 domain	918	X
34005	Murin CXCL13 solution structure	996	X
34006	NMR Structure of Enterocin K1 in 50%/50% TFE/Water	474	X
34007	Solution structure of the complex between human ZNHIT3 and NUFIP1 proteins	1418	X
34008	NMR structure of the sea anemone peptide tau-AnmTx Ueq 12-1 with an uncommon fold	377	X
34009	Refined 3D NMR structure of the cytoplasmic rhodanese domain of the inner membrane protein YgaP from Escherichia coli	1111	X
34010	S-nitrosylated 3D NMR structure of the cytoplasmic rhodanese domain of the inner membrane protein YgaP from Escherichia coli	964	X
34011	Solution structure of the bacterial toxin LdrD in Tetrafluorethanol	297	X
34012	In situ atomic-resolution structure of the baseplate antenna complex in Chlorobaculum tepidum obtained combining solid-state NMR spectroscopy, cryo electron microscopy and polarization spectroscopy	207	X
34013	Solution structure of BOLA1 from Homo sapiens	1369	X
34014	NMR structure of Chicken AvBD7 defensin	502	X
34015	Myristoylated T41I/T78I mutant of M-PMV matrix protein	1161	X
34016	NMR structure of peptide 2 targeting CXCR4	45	X
34017	NMR structure of peptide 10 targeting CXCR4	50	X
34018	Lactococcin A immunity protein	1082	X
34019	Zinc bound dimer of the fragment of human amyloid-beta peptide with Alzheimer's disease pathogenic Taiwanese mutation D7H	103	X
34022	Structure of PfIMP2 (Immune Mapped Protein 2 from Plasmodium falciparum) - an antigenic protein	1925	X
34024	Gp5.7 mutant L42A	759	X
34025	G-Quadruplex formed at the 5'-end of NHEIII_1 Element in human c-MYC promoter bound to triangulenium based fluorescence probe DAOTA-M2	138		X
34026	NMR solution structure of human FNIII domain 2 of NCAM	1106	X
34027	NMR spatial structure of Tk-hefu peptide	218	X
34028	Specific-DNA binding activity of the cross-brace zinc finger motif of the piggyBac transposase	303	X
34029	Solution structure of the m-pmv myristoylated matrix protein	1069	X
34030	Solution NMR structure of farnesylated PEX19, C-terminal domain	1613	X
34031	Engineering protein stability with atomic precision in a monomeric miniprotein	292	X
34032	Engineering protein stability with atomic precision in a monomeric miniprotein	298	X
34033	Engineering protein stability with atomic precision in a monomeric miniprotein	297	X
34034	A two-quartet G-quadruplex formed by human telomere in KCl solution at neutral pH	182		X
34035	A two-quartet G-quadruplex formed by human telomere in KCl solution at pH 5.0	172		X
34036	Spatial structure of the lentil lipid transfer protein in complex with anionic lysolipid LPPG	1075	X
34037	recombinant mouse Nerve Growth Factor	2768	X
34038	SINEB2 element of the long non-coding RNA activator of translation AS Uchl1	174			X
34039	Minor form of the recombinant cytotoxin-1 from N. oxiana	792	X
34040	N-terminal motif dimerization of EGFR transmembrane domain in bicellar environment	554	X
34041	Solution structure of Rtt103 CTD-interacting domain bound to a Thr4 phosphorylated CTD peptide	1614	X
34042	Structural studies of the Aggregative Adherence Fimbriae of Enteroaggregative Escherichia coli	1661	X
34043	Salt-inducible protein splicing by inteins from extremely halophilic archaea and application to scarless segmental labeling of TonB protein	1132	X
34044	Solution structure of bacteriocin BacSp222 from Staphylococcus pseudintermedius 222	645	X
34045	Solution NMR structure of the X domain of Peste des Petits Ruminants phosphoprotein	1239	X
34046	NMR structure of the C-terminal domain of the Bacteriophage T5 decoration protein pb10	1054	X
34047	NMR structure of the N-terminal domain of the Bacteriophage T5 decoration protein pb10	921	X
34048	Solution structure of isolated 15th Fibronectin III domain from human fibronectin	954	X
34049	Structure of a Spumaretrovirus Gag central domain reveals an ancient retroviral capsid	2512	X
34050	Structure of a Spumaretrovirus Gag central domain reveals an ancient retroviral capsid	1326	X
34051	Structure of DNA AGCGA-quadruplex adopted by 15-mer d(GCGAGGGAGCGAGGG), VK34, oligonucleotide found in regulatory region of the PLEKHG3 human gene	137		X
34052	Solution structure of CsgF in DHPC micelles	1221	X
34053	Structure of a stable G-hairpin	109		X
34054	Structure of DNA tetrameric AGCGA-quadruplex adopted by 15-mer d(GCGAGGGAGCGAGGG), VK34, oligonucleotide found in regulatory region of the PLEKHG3 human gene	103		X
34055	C-terminal domain structure of VSG M1.1	572	X
34056	Structure of DNA AGCGA-quadruplex adopted by 15-mer oligonucleotide found in regulatory region of the PLEKHG3 human gene with G11 to I11 mutation, d(GCGAGGGAGCIAGGG),VK34_I11	79		X
34057	Solution structure of CUG-BP2 RRM3 in complex with 5'-UUUAA-3' RNA	1222	X		X
34058	Solution structure of Rtt103 CTD-interacting domain bound to a Ser2Ser7 phosphorylated CTD peptide	1647	X
34059	Spatial structure of antimicrobial peptide arenicin-1 mutant V8R	276	X
34060	NMR solution structure of Harzianin HK-VI in DPC micelles	142	X
34061	Second zinc-binding domain from yeast Pcf11	633	X
34062	Quadruplex with flipped tetrad formed by a human telomeric sequence	243		X
34063	Quadruplex with flipped tetrad formed by an artificial sequence	184		X
34064	Solution structure and dynamics of the first outer membrane cytochrome from Geobacter sulfurreducens	572	X
34065	NMR solution structure of Harzianin HK-VI in SDS micelles	144	X
34066	NMR solution structure of Harzianin HK-VI in trifluoroethanol	144	X
34067	Solution structure of the RBM5 OCRE domain in complex with polyproline SmN peptide.	800	X
34068	RBM5 OCRE domain	744	X
34069	Solution structure of oxidized and amidated human IAPP (1-37), the diabetes II peptide.	336	X
34070	Biosynthetic engineered A22S-B3K-B31R human insulin monomer structure in water/acetonitrile solutions.	351	X
34071	2'F-ANA/DNA Chimeric TBA Quadruplex structure	146		X
34072	NMR Structure of the Littorina littorea metallothionein, a snail MT folding into three distinct domains	846	X
34073	Trypanosoma brucei Pex14 N-terminal domain	813	X
34074	HYL-20	201	X
34075	HYL-20k	157	X
34076	NMR structure of the Littorina littorea metallothionein, a snail MT folding into three distinct domains	841	X
34077	Solution structure of the cinaciguat bound human beta1 H-NOX.	2534	X
34078	NMR spatial structure of alpha-mammal toxin BeM9	661	X
34079	Solution NMR structure of hnRNP A1 RRM1 in complex with 5'-UUAGGUC-3' RNA	1023	X		X
34080	hnRNP A1 RRM2 in complex with 5'-UCAGUU-3' RNA	1039	X		X
34081	Solution structure of TDP-43 (residues 1-102)	585	X
34082	Solution structure of the B. subtilis anti-sigma-F factor, FIN	794	X
34083	G-quadruplex formed within promoters of Plasmodium falciparum B var genes	301		X
34084	G-quadruplex formed within promoters of Plasmodium falciparum B var genes - form I	305		X
34085	Bamb_5917 Acyl-Carrier Protein	1133	X
34086	Solution structure of a human G-Quadruplex hybrid-2 form in complex with a Gold-ligand	250		X
34087	Biosynthetic engineered A21K-B31K-B32R human insulin monomer structure in water/acetonitrile solution	363	X
34088	Solid-state NMR Structure of outer membrane protein G in lipid bilayers	1935	X
34089	Sigma1.1 domain of sigmaA from Bacillus subtilis	912	X
34090	Peptide-membrane interaction between targeting and lysis	157	X
34091	Peptide-membrane interaction between targeting and lysis	158	X
34092	Peptide-membrane interaction between targeting and lysis	159	X
34093	Solution structure of C20S variant of Dehydroascorbate reductase 3A from Populus trichocarpa in complex with dehydroascorbic acid.	748	X
34094	NMR structure calculation of a composite Cys2His2 type zinc finger protein containing a non-peptide (or oligourea) helical domain	281	X
34095	Structure Of P63 SAM Domain L514F Mutant Causative Of AEC Syndrome	587	X
34098	Structure of Tau(254-290) bound to F-actin	36	X
34099	Structure of Tau(292-319) bound to F-actin	32	X
34100	NMR solution structure of the TSL2 RNA hairpin	221			X
34101	Solution structure of the Dbl-homology domain of Bcr-Abl	2874	X
34102	Solution structure of B. subtilis Sigma G inhibitor CsfB	534	X
34103	Structure of TRBP dsRBD 1 and 2 in complex with a 19 bp siRNA (Complex B)	1742	X		X
34104	Structure of TRBP dsRBD 1 and 2 in complex with a 19 bp siRNA (Complex A)	1742	X		X
34105	Dehydroascorbate reductase 3A from Populus trichocarpa complexed with GSH.	752	X
34106	NMR solution structure of ubl5 domain from polyubiquitin locus of T.thermophila.	1097	X
34108	NMR structure of TLR4 transmembrane domain (624-670) in DMPG/DHPC bicelles	1900	X
34109	NMR structure of TLR4 transmembrane domain (624-657) in DPC micelles	450	X
34110	Structure of the N-terminal domain of the Escherichia Coli ProQ RNA binding protein	1341	X
34111	Structure of the N-terminal domain of the Escherichia Coli ProQ RNA binding protein	559	X
34112	Solution structure of ComGC from Streptococcus pneumoniae	639	X
34113	Structure of PsDef1 defensin from Pinus sylvestris	573	X
34114	NMR Structural Characterisation of Pharmaceutically Relevant Proteins Obtained Through a Novel Recombinant Production: The Case of The Pulmonary Surfactant Polypeptide C Analogue rSP-C33Leu.	367	X
34115	Solution structure of detergent-solubilized Rcf1, a yeast mitochondrial inner membrane protein involved in respiratory Complex III/IV supercomplex formation	1779	X
34116	Nuclear Magnetic Resonance Structure of the Human Polyoma JC Virus Agnoprotein	457	X
34118	An i-motif containing the neutral cytidine protonated analogue pseudoisocytidine	75		X
34119	exendin-4 variant with dual GLP-1 / glucagon receptor activity	252	X
34120	Solution structure of the C-terminal domain of S. aureus Hibernating Promoting Factor (CTD-SaHPF)	1396	X
34121	NMR solution structure of lysostaphin	2622	X
34122	Solution NMR Structure of the C-terminal domain of ParB (Spo0J)	1822	X
34123	Solution structure of Drosophila melanogaster Loquacious dsRBD2	560	X
34124	Solution structure of Drosophila melanogaster Loquacious dsRBD1	770	X
34125	Cytotoxin-1 in DPC-micelle	414	X
34126	NMR structure and 1H, 13C and 15N signal assignments for Dictyostelium discoideum MATA protein	1347	X
34127	NMR structure and 1H, 13C and 15N signal assignments for Dictyostelium discoidans MATB protein S71A mutant	1219	X
34129	Structure of Tau(254-268) bound to F-actin	14	X
34130	NMR assignment and structure of a peptide derived from the fusion peptide of HIV-1 gp41 in the presence of dodecylphosphocholine micelles	303	X
34131	Insight into the molecular recognition mechanism of the coactivator NCoA1 by STAT6	1881	X
34132	NMR assignment and structure of a peptide derived from the fusion peptide of HIV-1 gp41 in the presence of hexafluoroisopropanol	386	X
34133	NMR assignment and structure of a peptide derived from the fusion peptide of HIV-1 gp41 in the presence of dodecylphosphocholine micelles	379	X
34134	NMR assignment and structure of a peptide derived from the fusion peptide of HIV-1 gp41 in the presence of dodecylphosphocholine micelles	251	X
34135	M2 G-quadruplex dilute solution	182		X
34136	M2 G-quadruplex 20 wt% ethylene glycol	184		X
34137	M2 G-quadruplex 10 wt% PEG8000	184		X
34138	NMR structure of an EphA2-Sam fragment	202	X
34139	LysF1 sh3b domain structure	1245	X
34140	Solution structure of the RNA binding domain of Nrd1	1838	X
34141	p130Cas SH3 domain	965	X
34142	p130Cas SH3 domain PTP-PEST peptide chimera	1104	X
34143	p130Cas SH3 domain Vinculin peptide chimera	1129	X
34144	NMR structure of TIA-1 RRM1 domain	1070	X
34145	G-quadruplex of Human papillomavirus type 52	248		X
34146	Solution Structure of the N-terminal Region of Dkk4	912	X
34149	Solution NMR structure of human GATA2 C-terminal zinc finger domain	594	X
34151	Solution structure of the complexed RCD1-RST	686	X
34152	Solution NMR structure of DREB2A(255-272) bound to RCD1-RST	159	X
34153	M. tuberculosis [4Fe-4S] protein WhiB1 is a four-helix bundle that forms a NO-sensitive complex with sigmaA and regulates the major virulence factor ESX-1	857	X
34154	NMR spatial structure of HER2 TM domain dimer in DPC micelles	588	X
34155	NMR solution structure of U11/U12 65K protein's C-terminal RRM domain (381-516)	1714	X
34157	NtMe polyamide in complex with 5'CGATGTACATCG3'- hairpin polyamides studies	482		X
34158	NtiPr polyamide in complex with 5'CGATGTACTACG3	431		X
34159	Im polyamide in complex with 5'CGATGTACATCG3'- hairpin polyamides studies	484		X
34160	Putative active dimeric state of GHR transmembrane domain	624	X
34161	Solution structure of the complex of TRPV5(655-725) with a Calmodulin E32Q/E68Q double mutant	1766	X
34162	Structure of minimal i-motif domain	116		X
34163	Structure of DNA-binding HU protein from micoplasma Spiroplasma melliferum	320	X
34164	Putative inactive (dormant) dimeric state of GHR transmembrane domain	624	X
34165	Structure-Activity Relationships and Biological Characterization of a Novel, Potent and Serum Stable C-X-C chemokine receptor type 4 (CXCR4) Antagonist	50	X
34166	Ligand-Based NMR Study of C-X-C Chemokine Receptor Type 4 (CXCR4)-Ligand Interactions in Living Cancer Cells	44	X
34167	Solution structure of domain III (DIII)of Zika virus Envelope protein	1305	X
34168	G-quadruplex structure of DNA oligonucleotide containing GGGGCC repeats linked to ALS and FTD	176		X
34169	Solution NMR structure of truncated, human Hv1/VSOP (Voltage-gated proton channel)	1180	X
34170	Solution structure of antifungal protein NFAP	624	X
34171	NMR derived model of the 5'-splice site of SMN2 in complex with the 5'-end of U1 snRNA	313			X
34172	NMR structure of the complex formed by an engineered region 2 of sigmaE in complex with GTAAAA	1256	X	X
34173	NMR solution structure of the external DII domain of Rvb2 from Saccharomyces cerevisiae	1323	X
34174	2'F-ANA-G modified quadruplex with a flipped tetrad	191		X
34175	Solution structure of lipase binding domain LID1 of foldase from Pseudomonas aeruginosa	929	X
34176	NMR solution structure of murine CXCL12 gamma isoform	1021	X
34178	Solid-state MAS NMR structure of the HELLF prion amyloid fibrils	482	X
34179	Solution structure of the LEDGF/p75 IBD - JPO2 (aa 1-32) complex	1730	X
34180	Solution structure of the LEDGF/p75 IBD - POGZ (aa 1370-1404) complex	1673	X
34181	Solution structure of the LEDGF/p75 IBD - MLL1 (aa 111-160) complex	1837	X
34182	Solution structure of the LEDGF/p75 IBD - IWS1 (aa 446-548) complex	2407	X
34183	Nemertide alpha-1	279	X
34184	4th KOW domain of human hSpt5	1492	X
34185	6th KOW domain of human hSpt5	1457	X
34186	Quadruplex with flipped tetrad formed by the c-myc promoter sequence	158		X
34187	Structure and dynamics conspire in the evolution of affinity between intrinsically disordered proteins	930	X
34188	Structure and dynamics conspire in the evolution of affinity between intrinsically disordered proteins	896	X
34189	Structure and dynamics conspire in the evolution of affinity between intrinsically disordered proteins	818	X
34190	Proteome-wide analysis of phospho-regulated PDZ domain interactions	824	X
34191	solution NMR structure of EB1 C terminus (191-260)	1672	X
34193	Solution Structure of Rhabdopeptide NRPS Docking Domain Kj12A-NDD	809	X
34194	Solution Structure of Rhabdopeptide NRPS Docking Domain Kj12B-NDD	823	X
34195	Solution Structure of Rhabdopeptide NRPS Docking Domain Kj12C-NDD	807	X
34196	Solution Structure of Docking Domain Complex of RXP NRPS: Kj12C NDD - Kj12B CDD	1028	X
34198	mf2	57	X
34199	Specific phosphorothioate substitution within domain 6 of a group II intron ribozyme leads to changes in local structure and metal ion binding	203			X
34200	NMR structure of the C-terminal domain of the human RPAP3 protein	1798	X
34201	Rtt109 peptide bound to Asf1	2420	X
34202	PH domain from PfAPH	1564	X
34203	NMR solution structure of non-bound [des-Arg10]-kallidin (DAKD)	111	X
34206	Backbone structure of bradykinin (BK) peptide bound to human Bradykinin 2 Receptor (B2R) determined by MAS SSNMR	22	X
34207	Backbone structure of free bradykinin (BK) in DDM/CHS detergent micelle determined by MAS SSNMR	22	X
34208	Backbone structure of Des-Arg10-Kallidin (DAKD) peptide in frozen DDM/CHS detergent micelle solution determined by DNP-enhanced MAS SSNMR	33	X
34209	Backbone structure of Des-Arg10-Kallidin (DAKD) peptide bound to human Bradykinin 1 Receptor (B1R) determined by DNP-enhanced MAS SSNMR	33	X
34210	2'F-araG modified quadruplex with flipped G-tract and central tetrad	167		X
34211	Complex structure of PACSIN SH3 domain and TRPV4 proline rich region	758	X
34212	NMR structure of purotoxin-6	291	X
34213	NMR structure of EphA2-Sam stapled peptides (S13ST)	200	X
34214	NMR structure of EphA2-Sam stapled peptides (S13STshort)	115	X
34215	NMR structure of an Odin-Sam1 stapled peptide	99	X
34216	PH domain from TgAPH	1510	X
34217	Solution structure of the RING domain of the E3 ubiquitin ligase HRD1	914	X
34218	Solution structure of the MRH domain of Yos9	1899	X
34219	Solution structure of the MRH domain of Yos9 complexed with alpha3,alpha6-Man5	1891	X
34220	NMR Solution Structure of MINA-1(254-334)	992	X
34221	The 1,8-bis(aminomethyl)anthracene and Quadruplex-duplex junction complex	219		X
34222	NMR ensemble of Macrocyclic Peptidomimetic Containing Constrained a,a-dialkylated Amino Acids with Potent and Selective Activity at Human Melanocortin Receptors	45	X
34223	NMR structure of the second TPR domain of the human RPAP3 protein in complex with HSP90 peptide DTSRMEEVD	1588	X
34224	NMR structure of the second TPR domain of the human RPAP3 protein in complex with HSP70 peptide SGPTIEEVD	1566	X
34225	Solution structure of a last generation P2-P4 macrocyclic inhibitor	1574	X
34226	Solution Structure of CaM/Kv7.2-hAB Complex	2850	X
34227	Solution NMR structure of CBM64 from S.thermophila	1030	X
34228	DNA-RNA Hybrid Quadruplex with Flipped Tetrad	163				X
34229	Solution NMR structure of CBM64 from S.thermophila using 20% 13C, 100% 15N	1030	X
34231	Solution Structure of p300Taz2-p63TA	1471	X
34232	NMR solution structure of monomeric CCL5 in complex with a doubly-sulfated N-terminal segment of CCR5	987	X
34233	Solution structure of p300Taz2-p73TA1	1280	X
34234	E.coli Sigma factor S (RpoS) Region 4	1133	X
34235	Solution NMR structure of Pseudomonas aeruginosa TonB CTD	1261	X
34236	Solution structure of mule deer prion protein with polymorphism S138	1577	X
34237	NMR structure of Casocidin-II antimicrobial peptide in 60% TFE	255	X
34238	NMR structure of Casocidin-I antimicrobial peptide in 60% TFE	322	X
34239	Gp36-MPER	381	X
34240	Protein environment affects the water-tryptophan binding mode. Molecular dynamics simulations of Engrailed homeodomain mutants	466	X
34243	Structure and dynamics of the platelet integrin-binding C4 domain of von Willebrand factor	916	X
34244	Concerted dynamics of metallo-base pairs in an A/B-form helical transition (major species)	292		X
34245	Concerted dynamics of metallo-base pairs in an A/B-form helical transition (minor species)	150		X
34246	NMR structure of UB2H, regulatory domain of PBP1b from E. coli	1098	X
34247	NMR Solution Structure of yeast TSR2(1-152)	1861	X
34248	NMR Solution Structure of Yeast TSR2(1-152) in Complex with S26A(100-119)	2134	X
34249	FLN5 (full length)	556	X
34250	The solution NMR structure of brevinin-1BYa in 33% trifluoroethanol	190	X
34251	The solution NMR structure of brevinin-1BYa in sodium dodecyl sulphate micelles	167	X
34252	The solution NMR structure of brevinin-1BYa in dodecylphosphocholine micelles	148	X
34253	The solution NMR structure of [C18S,C24S]brevinin-1BYa in 33% trifluoroethanol	172	X
34254	The solution NMR structure of [C18S,C24S]brevinin-1BYa in sodium dodecyl sulphate micelles	161	X
34255	Structure of the UB2H domain of E.coli PBP1B in complex with LpoB	934	X
34256	Solution structure of the TPR domain of the cell division coordinator, CpoB	1424	X
34257	Solution structure of the Ni metallochaperone HypA from Helicobacter pylori	1443	X
34258	Solution structure of FUS-ZnF bound to UGGUG	499	X		X
34259	Solution structure of FUS-RRM bound to stem-loop RNA	1500	X		X
34260	Structure of Nrd1 CID - Sen1 NIM complex	1592	X
34261	The solution structure of the LptA-Thanatin complex	1451	X
34262	Calcium bound form of human calmodulin mutant F141L	1550	X
34263	Calmodulin mutant - F141L apo-form Unstructured C-domain	1107	X
34264	exendin-4 based dual GLP-1/glucagon receptor agonist	258	X
34265	Solution structure of the r(UGGUGGU)4 RNA quadruplex	220			X
34266	exendin-4 based dual GLP-1/glucagon receptor agonist	271	X
34267	Antinociceptive evaluation of cyriotoxin-1a, the first toxin purified from Cyriopagopus schioedtei spider venom	220	X
34268	NMR structure of the scorpion toxin AmmTx3	275	X
34269	Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure	193		X
34270	AapA1 V26A toxin from helicobacter pylori 26695	239	X
34271	Structural insights into AapA1 toxin	253	X
34272	NMR structure of temporin B KKG6A in SDS micelles	97	X
34273	NMR structure of temporin B L1FK in SDS micelles	87	X
34274	NMR structure of temporin B in SDS micelles	91	X
34276	Tc-DNA/RNA duplex	349		X	X
34277	tc-DNA/tc-DNA duplex	190		X
34278	Plantaricin S-a in 100 mM DPC micelles. This is the alpha part of the bacteriocin plantaricin S.	291	X
34279	PLANTARICIN S-B IN 100 MM DPC MICELLES. THIS IS THE BETA PART OF THE BACTERIOCIN PLANTARICIN S	294	X
34280	Tc-DNA/DNA duplex	293		X
34281	Solution structure of the hazel allergen Cor a 1.0401	1595	X
34282	Cadmium(II) form of full-length metallothionein from Pseudomonas fluorescens Q2-87 (PflQ2 MT)	883	X
34283	NMR structure of temporin L in SDS micelles	92	X
34284	NMR structure of aurein 2.5 in SDS micelles	114	X
34285	Solution structure of the capsid domain from the activity-regulated cytoskeleton-associated protein, Arc	1682	X
34286	Solution structure of lipase binding domain LID1 of foldase from Pseudomonas aeruginosa	965	X
34287	NMR structure of the free helix bundle domain from the functional pRN1 primase	1165	X
34288	Cadmium(II) form of shortened metallothionein from Pseudomonas fluorescens Q2-87 (residues: 1-52)	549	X
34289	Cadmium(II) form of A44H mutant of shortened metallothionein from Pseudomonas fluorescens Q2-87 (residues 1-52)	553	X
34290	Hybrid structure of the pRN1 helix bundle domain in complex with DNA and 2 ATP molecules	1330	X	X
34291	NMR structure of the DNA-bound helix bundle domain from the functional pRN1 primase	1186	X	X
34292	The CTD of HpDprA, a DNA binding Winged Helix domain which do not bind dsDNA	703	X
34293	Zn(II) form of shortened metallothionein from Pseudomonas fluorescens Q2-87 (residues 1-52)	534	X
34294	Solution structure of rat RIP2 caspase recruitment domain	1542	X
34295	Stabilising and Understanding a Miniprotein by Rational Design.	306	X
34296	Polyamide - DNA complex NMR structure	200		X
34297	Adenine-driven structural switch from two- to three-quartet DNA G-quadruplex	156		X
34298	Solution structure of Melampsora larici-populina MlpP4.1	500	X
34299	A1-type ACP domain from module 5 of MLSA1	1182	X
34300	Structural characterization of the Mycobacterium tuberculosis Protein Tyrosine Kinase A (PtkA)	1935	X
34301	B1-type ACP domain from module 7 of MLSB	1101	X
34302	The major G-quadruplex form of HIV-1 LTR	229		X
34303	Receptor-bound Ghrelin conformation	132	X
34304	A computationally designed dRP lyase domain reconstructed from two heterologous fragments	748	X
34305	Trpzip2 structure in presence of exogenous haloprotectant molecule.	117	X
34306	Trpzip2 structure in presence of exogenous haloprotectant molecule.	132	X
34307	Structure of the human GABARAPL2 protein in complex with the UBA5 LIR motif	1765	X
34308	Active-site conformational dynamics of carbonic anhydrase II under native conditions: An NMR perspective	2269	X
34309	Yeast V-ATPase transmembrane helix 7 NMR structure in DPC micelles	164	X
34311	Solution structure of the RNA duplex formed by the 5'-end of U1snRNA and the 5'-splice site of SMN2 exon7	320			X
34312	Solution structure of the RNA duplex formed by the 5'-end of U1snRNA and the 5'-splice site of SMN2 exon7 in complex with the SMN-C5 splicing modifier	320			X
34313	Nicomacin-1 -- Novel antimicrobial peptides from the Arctic polychaeta Nicomache minor provide new molecular insight into biological role of the BRICHOS domain	289	X
34314	Peptide-membrane interaction between targeting and lysis	191	X
34315	Peptide-membrane interaction between targeting and lysis	218	X
34316	Peptide-membrane interaction between targeting and lysis	180	X
34317	Structure of human SRSF1 RRM1 bound to AACAAA RNA	844	X		X
34318	Solution structure of the globular domain from human histone H1.0	852	X
34319	NMR structure of Urotensin Peptide Asp-c[Cys-Phe-(N-Me)Trp-Lys-Tyr-Cys]-Val in SDS solution	60	X
34320	Pepducin UT-Pep2 a biased allosteric agonist of Urotensin-II receptor	95	X
34321	NMR solution structure of the C/D box snoRNA U14	537			X
34322	SOLUTION NMR STRUCTURE OF MAXIMIN 3 IN 50% TRIFLUOROETHANOL	234	X
34323	Structure of the RNA duplex containing pseudouridine residue (5'-Cp(PSU)pG-3' sequence context)	261			X
34324	Structure of the RNA duplex containing pseudouridine residue (5'-Gp(PSU)pC-3' sequence context)	254			X
34325	Solution NMR structure of PilE1 from Streptococcus sanguinis	1263	X
34326	Structure, dynamics and roX2-lncRNA binding of tandem double-stranded RNA binding domains dsRBD1/2 of Drosophila helicase MLE	2868	X
34328	Dodecamer DNA containing the synthetic base pair P-Z	181		X
34329	NMR structure of the third TPR domain of the human SPAG1 protein	1638	X
34330	Solution structure of TRIM28 RING domain	1038	X
34331	Human telomeric G-quadruplex with 8-oxo-G substitution in the central G-quartet	165		X
34332	Human telomeric G-quadruplex with 8-oxo-G substitution in the outer G-quartet	157		X
34334	NMR solution structure of the HVO_2922 protein from Haloferax volcanii	697	X
34335	H-Vc7.2, H-superfamily conotoxin	234	X
34336	Structural and functional insights into the condensin ATPase cycle	2185	X
34338	Solution NMR structure of outer membrane protein AlkL	614	X
34339	Structure determination of N-terminal fragment of UL49.5 protein from bovine herpesvirus 1 by NMR spectroscopy and molecular dynamics	218	X
34340	P31-43	83	X
34341	Structural investigation of the TasA anchoring protein TapA from Bacillus subtilis	1440	X
34342	P31-43.	79	X
34343	P31-43.	82	X
34344	NMR structure of BB_P28, Borrelia burgdorferi outer surface lipoprotein	1205	X
34345	NMR Structure of Big-defensin 1 [44-93] from oyster Crassostrea gigas	464	X
34346	NMR Structure of Big-defensin 1 from oyster Crassostrea gigas	890	X
34347	Assessment of a large enzyme-drug complex by proton-detected solid-state NMR without deuteration	2451	X
34348	[1-40]Gga-AvBD11	380	X
34349	[41-82]Gga-AvBD11	465	X
34350	Gga-AvBD11 (Avian beta-defensin 11 from Gallus gallus)	630	X
34351	Solution NMR ensemble for human ubiquitin at 298K compiled using the CoMAND method	728	X
34352	Solution NMR ensemble for a chimeric KH-S1 domain construct of exosomal polynucleotide phosphrylase at 298K compiled using the CoMAND method	1440	X
34353	TINA-conjugated antiparallel DNA triplex	178		X
34354	Truncated Evasin-3 (tEv3 17-56)	423	X
34355	Solution Structure of the Zn-loaded form of a Metallothionein from Helix Pomatia	577	X
34356	Solution Structure of the Cd-loaded form of a Metallothionein from Helix Pomatia	575	X
34357	Structure investigations of Protegrin-4 by High resolution NMR spectroscopy	81	X
34358	NMR solution structure of LSR2 binding domain.	354	X
34359	NMR solution structure of LSR2-T112D binding domain.	352	X
34360	Solution NMR of synthetic analogues of nisin and mutacin ring A and ring B - Nisin Ring B (Lan8,11) analogue	24	X
34361	NMR structure of BB_A03, Borrelia burgdorferi outer surface lipoprotein	1467	X
34362	tSH2 domain of transcription elongation factor Spt6 complexed with tyrosine phosphorylated CTD	1706	X
34363	Solution NMR of synthetic analogues of nisin and mutacin ring A and ring B - Mutacin I Ring B, major conformer	24	X
34365	Solid-state NMR structure of outer membrane protein AlkL in DMPC lipid bilayers	1567	X
34366	NMR structure of peptide 7, characterized by a cis-4-amino-Pro residue, with a significant lower MIC on E. coli	112	X
34367	NMR structure of peptide 8, characterized by a trans-4-cyclohexyl-Pro, with a dramatic reduction in activity on E. coli ATCC and lost effect on P. aeruginosa.	112	X
34369	Solution NMR of synthetic analogues of nisin and mutacin ring A and ring B - Mutacin I Ring B, minor conformer	22	X
34370	Solution NMR of synthetic analogues of nisin and mutacin ring A and ring B - Nisin Ring B	24	X
34371	Solution NMR of synthetic analogues of nisin and mutacin ring A and ring B - Mutacin I Ring A truncated analogue	30	X
34372	Solution NMR of synthetic analogues of nisin and mutacin ring A and ring B - Mutacin I Ring A	36	X
34373	Solution NMR of synthetic analogues of nisin and mutacin ring A and ring B - Mutacin I Ring A (Ser2, Ala5, Ala8) analogue	38	X
34374	Solution NMR of synthetic analogues of nisin and mutacin ring A and ring B - nisin ring A	32	X
34376	The N-terminal domain of rhomboid protease YqgP	2244	X
34378	Structure of kiteplatinated dsDNA	200		X
34379	Solution structure of sortase A from S. aureus in complex with 2-(aminomethyl)-3-hydroxy-4H-pyran-4-one based prodrug	1861	X
34380	Structure of peptide P7, which binds Cdc42 and inhibits effector interactions.	112	X
34381	NMR structure of Chromogranin A (F39-D63)	363	X
34383	Solution structure of birch pollen allergen Bet v 1a	1810	X
34384	C-SH2 domain of SHP-2 in complex with phospho-ITSM of PD-1	1545	X
34385	Solution Structure of ribosome-binding factor A (RbfA) under physiological conditions	1472	X
34386	SC14 G-hairpin	135		X
34387	The solution NMR structure of cis-dicarba-brevinin-1BYa in 33% trifluoroethanol	166	X
34388	The solution NMR structure of cis-dicarba-brevinin-1BYa in sodium dodecyl sulphate micelles	166	X
34389	A quadruplex hybrid structure with lpp loop orientation and 3 syn residues	136		X
34390	A quadruplex hybrid structure with lpp loop orientation and 5 syn residues	164		X
34391	3D NMR solution structure of ligand peptide (Ac)EVNPPVP of Pro-Pro endopeptidase-1	74	X
34392	NMR structure of cytotoxin 3 from Naja kaouthia in solution, major form	691	X
34393	Bordetella pertussis adenylate cyclase toxin transmembrane segment 411-490 in DPC micelles	885	X
34394	Solution structure and 1H, 13C and 15N chemical shift assignments for NECAP1 PHear domain	1580	X
34395	Solution structure and 1H, 13C and 15N chemical shift assignments for the complex of NECAP1 PHear domain with phosphorylated AP2 mu2 148-163	1655	X
34396	Structure of pore-forming amyloid-beta tetramers	632	X
34397	Imidazole Polyamide-DNA complex NMR structure (5'-CGATGTACATCG-3')	214		X
34398	Concerted dynamics of metallo-base pairs in an A/B-form helical transition (apo species)	304		X
34399	Extremely stable monomeric variant of human cystatin C with single amino acid substitution	1260	X
34400	RW16 peptide	176	X
34401	Solution NMR structure of the peptide 3967 from medicinal leech Hirudo medicinalis in dodecylphosphocholine micelles	172	X
34402	Solution NMR structure of the peptide 536_2 from medicinal leech Hirudo medicinalis in dodecylphosphocholine micelles	138	X
34403	2'-F-riboguanosine modified G-quadruplex with V-loop	149		X
34404	NMR structure of pleurocidin KR in SDS micelles	105	X
34405	NMR structure of pleurocidin VA in SDS micelles	116	X
34406	Solution NMR structure of the peptide 12530 from medicinal leech Hirudo medicinalis in dodecylphosphocholine micelles	172	X
34407	Solution structure of the fourth WW domain of WWP2 with GB1-tag	1249	X
34408	STRUCTURE OF [ASP58]-IGF-I ANALOGUE	724	X
34409	Structure of HIV-1 CAcSP1NC mutant(W41A,M42A) interacting with maturation inhibitor EP39	1074	X
34410	Winter flounder 1a-1 in SDS micelles	157	X
34411	Winter flounder 1a in SDS micelles	87	X
34412	Winter flounder 3 in SDS micelles	104	X
34413	Winter flounder 4 in SDS micelles	107	X
34414	a9 PEPTIDE	58	X
34416	Winter flounder 1 in SDS micelles	129	X
34417	M-TRTX-Preg1a (Poecilotheria regalis)	275	X
34418	M-BUTX-Ptr1a (Parabuthus transvaalicus)	235	X
34419	NMR solution structure of Hml-2 C-terminal dimer domain	912	X
34420	SH3-subunit of chicken alpha spectrin solved by NMR	625	X
34421	Solution structure of Staufen1 dsRBD3+4 - hARF1 SBS dsRNA complex.	2385	X		X
34422	Solution structure of Staufen1 dsRBD4 - hARF1 SBS dsRNA complex.	1382	X		X
34423	NMR structure of MLP124017	1323	X
34424	Precursor structure of the self-processing module of iron-regulated FrpC of N. Meningitidis with calcium ions	1665	X
34425	NMR solution structure of Helicobacter pylori TonB-CTD (residues 179-285)	1305	X
34427	Solution structure of the FUS/TLS RNA recognition motif in complex with U1 snRNA stem loop III	1761	X		X
34428	Mouse RBM20 RRM domain in complex with AUCUUA RNA	1478	X		X
34429	Mouse RBM20 RRM domain	1458	X
34430	NMR solution structure of staphylococcal protein A, C domain	758	X
34431	NMR structure of KRAS32R G9T conformer G-quadruplex within KRAS promoter region	469		X
34432	Protein allostery of the WW domain at atomic resolution: apo structure	374	X
34433	Protein allostery of the WW domain at atomic resolution	368	X
34434	Protein allostery of the WW domain at atomic resolution	378	X
34435	Intercalation of heterocyclic ligand between quartets in G-rich tetrahelical structure	217		X
34436	Guanine-rich oligonucleotide with 5'-GC end form G-quadruplex with A(GGGG)A hexad, GCGC- and G-quartets and two symmetric GG and AA base pairs	126		X
34437	Structure of the BRK domain of the SWI/SNF chromatin remodelling complex subunit BRG1 reveals a potential role in protein-protein interactions	558	X
34438	Guanine-rich oligonucleotide with 5'- and 3'-GC ends form G-quadruplex with A(GGGG)A hexad, GCGC- and G-quartets and two symmetric GG and AA base pair	145		X
34439	NMR structure of repeat domain 13 of the fibrillar adhesin CshA from Streptococcus gordonii.	853	X
34440	Solution structure of the amyloid beta-peptide (1-42)	280	X
34441	NMR structure of KRAS32R G25T conformer G-quadruplex within KRAS promoter region	304		X
34442	Solution structure of the HRP2 IBD	1098	X
34443	Timeless couples G quadruplex detection with processing by DDX11 during DNA replication	1830	X
34444	2'-F-arabinoguanosine and 2'-F-riboguanosine modified hybrid type G-quadruplex with V-loop	137		X
34445	2'-F-riboguanosine and 2'-F-arabinoguanosine modified G-quadruplex with V-loop and all-syn G-tract	156		X
34446	Bam_5924 docking domain	1136	X
34447	Bam_5920cDD 5919nDD docking domains	1516	X
34448	Bam_5925cDD 5924nDD docking domains	1938	X
34449	Solution Structure of the DNA-binding TubR fragment from Clostridium Botulinum	1071	X
34450	Solution structure of RfaH C-terminal domain from Vibrio cholerae	831	X
34451	Solution structure of MacpD, a acyl carrier protein, from Pseudomonas fluorescens involved in Mupirocin biosynthesis.	1301	X
34452	Reconstructing the Origins of the HemD-like fold	1403	X
34453	Solution structure of MeuNaTxalpha-1 toxin from Mesobuthus Eupeus	631	X
34454	A New Structural Model of Abeta(1-40) Fibrils	197	X
34455	Mixing Abeta(1-40) and Abeta(1-42) peptides generates unique amyloid fibrils	455	X
34456	Mixing Abeta(1-40) and Abeta(1-42) peptides generates unique amyloid fibrils	455	X
34457	Refined solution NMR structure of hVDAC-1 in detergent micelles	1504	X
34459	P. falciparum essential light chain, N-terminal domain	937	X
34460	Cytochrome C from Thioalkalivibrio paradoxus	699	X
34461	Solution structure and 1H, 13C and 15N chemical shift assignments for the complex of VPS29 with VARP 687-747	2435	X
34462	Solution structure of the modulator of repression (MOR) of the temperate bacteriophage TP901-1 from Lactococcus lactis	916	X
34463	Structural and DNA Binding Properties of Mycobacterial Integration Host Factor mIHF	1109	X
34464	NMR structure of the apo-form of Pseudomonas fluorescens CopC	1085	X
34465	Structure of a protein-RNA complex by ssNMR	425	X		X
34466	Solution structure of U2AF2 RRM1,2	2240	X
34467	Pre-folded structures govern folding pathways of human telomeric G-quadruplexes	50		X
34468	Solution structure of the antifungal protein PAFC	634	X
34469	Solution Structure of Docking Domain Complex of Pax NRPS: PaxC NDD - PaxB CDD	872	X
34470	Solution structure of PD-i6 peptide inhibitor of the human PD-1 extracellular domain	90	X
34471	Haddock model of NDM-1/morin complex	993	X
34472	Haddock model of NDM-1/myricetin complex	993	X
34473	NMR structure of N-terminal domain from A. argentata tubuliform spidroin (TuSp) at pH 5.5	1609	X
34474	Solution structure of PD-i3 peptide inhibitor of the human PD-1 extracellular domain	102	X
34475	LEDGF/p75 dimer (residues 345-467)	1561	X
34476	Solution structure of antimicrobial peptide, crabrolin Plus in the presence of Lipopolysaccharide	162	X
34477	Major subunit ComGC from S. sanguinis Com pseudopili	830	X
34478	NMR solution structure of class IV lasso peptide felipeptin A1 from Amycolatopsis sp. YIM10	176	X
34479	NMR solution structure of class IV lasso peptide felipeptin A2 from Amycolatopsis sp. YIM10	144	X
34480	Solution structure of Legionella pneumophila NttA	1342	X
34481	Solution NMR structure of the S0_2.126 designed protein	581	X
34482	Constitutive decay element CDE2 from human 3'UTR	253			X
34483	Constitutive decay element CDE1 from human 3'UTR	247			X
34484	Constitutive decay element CDE2 from human 3'UTR	253			X
34485	NMR solution structure of alpha-AnmTX-Ms11a-2 (Ms11a-2)	422	X
34486	NMR solution structure of alpha-AnmTX- Ms11a-3 (Ms11a-3)	496	X
34487	NMR solution structure of the Iron-Sulfur protein PioC from Rhodopseudomonas palustris TIE-1	615	X
34488	Designing a Granulopoietic Protein by Topological Rescaffolding 2: Moevan	1140	X
34489	Designing a Granulopoietic Protein by Topological Rescaffolding 1: Sohair	1334	X
34490	Major subunit ComGC from S. pneumoniae Com pseudopili	863	X
34491	Cortistatin analog with improved immunoregulatory activity	106	X
34492	drosophila Unr CSD78	1990	X
34493	solution structure of cold-shock domain 1 and 2 of drosophila Upstream of N-Ras (Unr)	1702	X
34494	Rhodospirillum rubrum oxidized CooT solution structure	853	X
34495	Rhodospirillum rubrum reduced CooT solution structure	854	X
34496	Ca2+-bound Calmodulin mutant N53I	1780	X
34497	Ca2+-free Calmodulin mutant N53I	1740	X
34498	solution structure of cold-shock domain 9 of drosophila Upstream of N-Ras (Unr)	1013	X
34499	2'-F-riboguanosine and LNA modified hybrid type G-quadruplex with V-loop	134		X
34500	Solution structure and dynamics of Zn-Finger HVO_2753 protein	641	X
34502	LNA modified G-quadruplex with flipped G-tract and central tetrad	149		X
34503	Second EH domain of AtEH1/Pan1	1268	X
34504	Second EH domain of AtEH1/Pan1	1227	X
34506	Solution NMR Structure of APP TMD	359	X
34507	Solution NMR Structure of APP TMD	316	X
34508	Solution NMR Structure of APP G38P mutant TM	326	X
34509	Solution NMR Structure of APP TMD V44M mutant	366	X
34510	Solution NMR Structure of APP TMD I45T mutant	310	X
34511	The N-terminal RNA-binding domain of the SARS-CoV-2 nucleocapsid phosphoprotein	1665	X
34512	Solution NMR structure of the C-terminal arm of RSV nucleoprotein	400	X
34513	Solution NMR structure of the oligomerization domain of respiratory syncytial virus phosphoprotein	482	X
34514	Solution NMR structure of the isolated NTE domain of BT1762-63 levan transporter	933	X
34515	NMR solution structure of unbound recombinant human Nerve Growth Factor (rhNGF)	2416	X
34516	Parallel 17-mer DNA G-quadruplex	153		X
34517	Structure of eIF4G1 (37-49) - PUB1 RRM3 chimera in solution	1232	X
34518	De-novo Maquette 2 protein with buried ion-pair	1438	X
34519	NMR solution structure of the carbohydrate-binding module family 5 (CBM5) from Cellvibrio japonicus CjLPMO10A	631	X
34520	NMR solution structure of the carbohydrate-binding module family 73 (CBM73) from Cellvibrio japonicus CjLPMO10A	600	X
34521	Ternary complex of Calmodulin bound to 2 molecules of NHE1	2552	X
34522	NMR structural analysis of yeast Cox13 reveals its C-terminus in interaction with ATP	962	X
34523	Solution NMR structure of human GATA2 N-terminal zinc finger domain	474	X
34524	Structure of a parallel c-Myc modified with 3' duplex stem-loop overhang	285		X
34525	Structure of a parallel c-Myc modified with 5' duplex stem-loop overhang	237		X
34526	Solution structure of unliganded MLKL executioner domain	1796	X
34527	Structure of the cysteine-rich domain of PiggyMac, a domesticated PiggyBac transposase involved in programmed genome rearrangements	918	X
34528	Solution structure of MLKL executioner domain in complex with a covalent inhibitor	1800	X
34529	G-quadruplex with a G-A bulge	185		X
34531	Solution structure of the water-soluble LU-domain of human Lypd6b protein	1076	X
34532	NMR structure of water-soluble domain of human Lynx2 (Lypd1) protein	911	X
34533	Structure of a parallel c-myc modified with 5' duplex stem-loop and 3' diagonal snap-back loop	242		X
34534	Spor protein DedD	1463	X
34535	Human TFIIS N-terminal domain (TND)	1049	X
34536	TFIIS N-terminal domain (TND) from human Elongin-A	1140	X
34537	TFIIS N-terminal domain (TND) from human LEDGF/p75	1189	X
34538	TFIIS N-terminal domain (TND) from human IWS1	1775	X
34539	TFIIS N-terminal domain (TND) from human PPP1R10	1943	X
34540	TFIIS N-terminal domain (TND) from human MED26	1138	X
34541	TFIIS N-terminal domain (TND) from human IWS1	1304	X
34542	Antiparallel basket-type G-quadruplex DNA structure formed in human Bcl-2 promoter containing 8-oxoG	180		X
34543	Antiparallel basket-type G-quadruplex DNA structure formed in human Bcl-2 promoter	166		X
34544	Solution structure of the C-terminal domain of the vaccinia virus DNA polymerase processivity factor component A20 fused to a short peptide from the viral DNA polymerase E9.	1760	X
34545	Solution structure of the C-terminal domain of the vaccinia virus DNA polymerase processivity factor component A20.	1674	X
34546	Emfourin (M4in) from Serratia proteamaculans, M4 family peptidase inhibitor	1480	X
34547	Structure of the trans-(Tyr39-Pro40) form of the Human Secreted Ly-6/uPAR Related Protein-1 (SLURP-1)	911	X
34548	Structure of the cis-(Tyr39-Pro40) form of the Human Secreted Ly-6/uPAR Related Protein-1 (SLURP-1)	936	X
34549	NMR structure of D3-D4 domains of Vibrio vulnificus ribosomal protein S1	2111	X
34550	NMR structure of flagelliform spidroin (FlagSp) N-terminal domain from Trichonephila clavipes at pH 7.2	1520	X
34551	NMR structure of flagelliform spidroin (FlagSp) N-terminal domain from Trichonephila clavipes at pH 5.5	1470	X
34552	Structure-function analyses of dual-BON domain protein DolP identifies phospholipid binding as a new mechanism for protein localisation to the cell division site	1881	X
34553	RNA duplex with a cytosine bulge in complex with berberine	98			X
34554	NMR solution structure for Tsp1a	310	X
34555	Structural evolution of the tissue-specific U2AF2 paralog and alternative splicing factor LS2	908	X
34556	Structural evolution of the tissue-specific U2AF2 paralog and alternative splicing factor LS2	1213	X
34557	Solution structure of the TAF4-RST domain	925	X
34558	Capra hircus Cathelicidin-1 (dodecylphosphocholine)	207	X
34559	Capra hircus Cathelicidin-1	159	X
34560	Solution structure of U1-A RRM2 (190-282)	1322	X
34564	Antimicrobial peptide Capitellacin from polychaeta Capitella teleta	194	X
34565	NMR structure of a DNA G-quadruplex containing two SP1 binding sites from HIV-1 promoter	316		X
34566	NMR2 structure of BRD4-BD2 in complex with iBET-762	32	X
34567	Transmembrane helix of tumor necrosis factor alpha in trifluorethanol	282	X
34568	Transmembrane helix of tumor necrosis factor alpha in trifluorethanol, S34P mutant	291	X
34569	Transmembrane helix of tumor necrosis factor alpha in trifluorethanol, AGALLL mutant	298	X
34570	Solution NMR structure of the SH3 domain of human Caskin1	570	X
34571	G-quadruplex with V-shaped loop from the first repeat of KCNN4 minisatellite	170		X
34572	Solution structure of the fluorogen-activating protein FAST in complex with the ligand N871b	1653	X
34573	Solution structure of the fluorogen-activating protein FAST in the apo state	1574	X
34574	NMR solution structure of Tbo-IT2	358	X
34575	Solution structure of a non-covalent extended docking domain complex of the Pax NRPS: PaxA T1-CDD/PaxB NDD	1718	X
34576	Solution structure of the Pax NRPS docking domain PaxB NDD	382	X
34577	Dynamic complex between all-D-enantiomeric peptide D3 with wild-type amyloid precursor protein 672-726 fragment (amyloid beta 1-55)	651	X
34578	Dynamic complex between all-D-enantiomeric peptide D3 with L723P mutant of amyloid precursor protein (APP) 672-726 fragment (amyloid beta 1-55)	633	X
34579	Synthetic DNA duplex dodecamer	265		X
34580	Single modified phosphoryl guanidine DNA duplex, Sp diastereomer	285		X
34581	DNA duplex with phosphoryl guanidine moiety, Rp-diastereomer	235		X
34582	Solution structure of A. thaliana core TatA in DHPC micelles	589	X
34583	NMR2 structure of TRIM24-BD in complex with a precursor of IACS-9571	30	X
34584	Solution structure of C-terminal RecA and RRM domains of the DEAD box helicase DbpA	1793	X
34585	Solution Structure of RoxP	1613	X
34586	NMR structure of an optimized version of the first TPR domain of the human SPAG1 protein	1608	X
34587	deoxyxylose nucleic acid hairpin	252		X
34588	deoxyxylose nucleic acid hairpin	233		X
34589	Solution structure of the chloroplast outer envelope channel OEP21	980	X
34590	GA repetition with i-motif clip at 5'-end	70		X
34591	GA attached to an i-motif clip at 3'-end	43		X
34592	AG repetition attached to a compact i-motif clip at 3'-end	50		X
34593	AG repetition attached to an extended i-motif clip at 3'-end	54		X
34594	Solution structure of DNA duplex containing a 2'-deoxy-2'2'-difluorodeoxycytidine (gemcitabine) modification	120		X
34595	Solution structure of DNA:RNA hybrid containing a 2'-deoxy-2'2'-difluorodeoxycytidine (gemcitabine) modification	113		X	X
34596	Solution structure of DNA duplex containing a 7,8-dihydro-8-oxo-1,N6-ethenoadenine base modification that induces exclusively A->T transversions in Escherichia coli	146		X
34598	Tick salivary protein BSAP1	860	X
34599	Solution structure of DNA:RNA hybrid duplex	121		X	X
34600	N-terminal C2H2 Zn-finger domain of Clamp	678	X
34602	NMR structure of Rv1813c from Mycobacterium tuberculosis	1196	X
34603	Solution structure of MLKL executioner domain in complex with a fragment	1730	X
34604	Solution structure of MLKL executioner domain in complex with a fragment	1731	X
34605	Solution structure of MLKL executioner domain in complex with a fragment	1738	X
34606	cytoplasmic domain of Vibrio cholerae ToxR	923	X
34607	periplasmic domain of Vibrio cholerae ToxR	728	X
34608	Calmodulin extracts the Ras family protein RalA from lipid bilayers by engagement with two membrane targeting motifs	1728	X
34609	NMR structure of GIPC1-GH2 domain	832	X
34610	Solution structure of toll like receptor 1 (TLR1) TIR domain	2081	X
34611	Three-quartet c-kit2 G-quadruplex stabilized by a pyrene conjugate	166		X
34612	PAF-D19S in 50 v/v % DMSO-water solution	370	X
34613	Solution structure of Boskar4; a de novo designed G-CSF agonist	1401	X
34614	BacSp222 bacteriocin: succinyl-K20 form	586	X
34615	Hybrid-2R quadruplex-duplex with (-p-p-l) topology and 3 syn residues	203		X
34616	The structure of an i-motif/duplex junction at neutral pH	222		X
34617	Solution NMR Structure of the Neh1 Domain of Human Nuclear factor erythroid 2-related factor 2 (NRF2)	528	X
34618	Solution structure of oxidized cytochrome c552 from Thioalkalivibrio paradoxus	1298	X
34619	NMR structure of the Anemonia erythraea AeTX-K toxin	267	X
34620	Oxytocin NMR solution structure	65	X
34621	NMR structure of the Bak transmembrane helix in DPC micelles	97	X
34622	NMR structure of the Bak transmembrane helix in lipid nanodiscs	48	X
34623	A self-complementary DNA dodecamer duplex contaning 5-hydroxymethylcitosine	105		X
34624	A self-complementary DNA dodecamer duplex contaning 5-hydroxymethylcitosine	108		X
34625	A self-complementary DNA dodecamer duplex contaning 5-hydroxymethylcitosine	67		X
34626	A self-complementary DNA dodecamer duplex contaning 5-hydroxymethylcitosine	72		X
34627	Solution structure of Legionella pneumophila LspC	1484	X
34628	NMR solution structure of SNX9 SH3 - EEEV nsP3 peptide complex	913	X
34629	EB1 bound to MACF peptide	849	X
34630	The NMR structure of the Zf-GRF domains from the mouse Endonuclease VIII-LIKE 3 (mNEIL3)	1163	X
34631	G-quadruplex structure of the C. elegans telomeric repeat: A two tetrads basket type conformation stabilised by a Hoogsteen C-T base-pair	253		X
34632	NMR SOLUTION STRUCTURE OF [Pro3,DLeu9]TL	110	X
34633	Solution structure of antimicrobial peptide cathelicidin-1 PcDode from sperm whale Physeter catodon	276	X
34634	NMR Solution Structure of Peptide 12: First-in-class cyclic Temporin L analogue with antibacterial and antibiofilm activities	120	X
34635	Structure and folding of a 600-million-year-old nuclear coactivator binding domain suggest conservation of dynamic properties	462	X
34636	Structure and folding of a 600-million-year-old nuclear coactivator binding domain suggest conservation of dynamic properties	466	X
34637	Oxytocin NMR solution structure	58	X
34638	Structure of the human UFC1 protein in complex with the UBA5 C-terminal UFC1-binding motif.	2268	X
34639	SOLUTION NMR STRUCTURE OF MAXIMIN 1 IN 50% TRIFLUOROETHANOL	187	X
34640	Solution structure of human interleukin-9	1379	X
34641	Solution structure of bee apamin	184	X
34642	Solution structure of the N-terminal domain of human telomeric Repeat-binding factor 2-interacting protein 1 (hRap1): implication for Rap1-TRF2 interaction in Human.	1209	X
34643	Solution structure of the human SF3A1 ubiquitin-like domain	1192	X
34645	Solution structures of HIV-1 and SIVmac p6 and their interaction with accessory proteins Vpr and Vpx in the presence of DPC micelles	90	X
34646	Solution structures of HIV-1 and SIVmac p6 and their interaction with accessory proteins Vpr and Vpx in the presence of DPC micelles	291	X
34647	Solution structures of HIV-1 and SIVmac p6 and their interaction with accessory proteins Vpr and Vpx in the presence of DPC micelles	359	X
34648	NMR solution structure of the C6 domain of von Willebrand Factor	859	X
34649	SOLUTION NMR STRUCTURE OF PALUSTRIN-CA IN 50% TRIFLUOROETHANOL	225	X
34650	NMR structure of human ACE2 21-42 fragment in HFIP/water 50/50 v/v	202	X
34651	NMR structure of a peptide deriving from SARS-CoV-2 S RBD 482-506 fragment in HFIP/H2O	193	X
34652	NMR structure of a peptide deriving from SARS-CoV-2 Lineage B.1.1.7 S RBD 482-506 fragment in HFIP/H2O	196	X
34653	NMR structure of a peptide deriving from SARS-CoV-2 Lineages P.1 and B.1.351 S RBD 482-506 fragment in HFIP/H2O	207	X
34654	Pre-catalytic complex of 10-23 DNAzyme with RNA target	547		X	X
34655	PAF in 50 v/v % DMSO-water solution	388	X
34656	Structure of Insulin-like growth factor 1 receptor's transmembrane domain	454	X
34657	Structure of Insulin-like growth factor 1 receptor's transmembrane domain	441	X
34660	Solution structure of Zipcode binding protein 1 (ZBP1) KH3(DD)KH4 domains in complex with N6-Methyladenosine containing RNA	1472	X		X
34661	Structure of SARS-CoV-2 nucleoprotein in dynamic complex with its viral partner nsp3a	1071	X
34662	Structure of Insulin receptor-related receptor's transmembrane domain	395	X
34663	Solution structure of Legionella pneumophila LspD	1206	X
34664	Parallel Q-D hybrid with 3' duplex stem-loop as a lateral snapback loop	292		X
34665	Solution structure of 1:1 complex of an indoloquinoline derivative SYUIQ-5 to parallel quadruplex-duplex (Q-D) hybrid	273		X
34666	NMR Structure of RgpB C-terminal Domain	977	X
34667	NMR solution structure of BCR4	508	X
34668	Solution structure of the chimeric Nrd1-Nab3 heterodimerization domains	1603	X
34669	Solution structure of the NRDI domain of Nab3	611	X
34670	NMR Structure of the U3 RNA G-quadruplex	323			X
34671	Structure of Viscotoxin A3 from Viscum Album in the complex with DPC micelles	295	X
34673	Solution structure of RBM39 RRM2 bound to 5'-AGCUUUG-3	1085	X		X
34674	Solution structure of an intramolecular RNA G-quadruplex formed by the 6A8U17U mutant from a 22mer guanine-rich sequence within the 5'UTR of BCL-2 proto onco-gene	432			X
34675	The solution structure of hsDND1 RRM12 bound to CUUAUUUG RNA	2300	X		X
34676	Solution structure of an intramolecular RNA G-quadruplex formed by the 6A8A17U mutant from a 22mer guanine-rich sequence within the 5'UTR of BCL-2 proto-oncogene	378			X
34677	Solution structure of an intramolecular RNA G-quadruplex formed by the 6A mutant from a 22mer guanine-rich sequence within the 5'UTR of BCL-2 proto-oncogene	332			X
34678	Solution structure of the C terminal domain of MgtC (PA4635) from Pseudomonas aeruginosa	966	X
34679	10bp DNA/DNA duplex	188		X
34680	Three-dimensional structure of the PGAM5 C12L mutant TMD	249	X
34681	Three-dimensional structure of the PGAM5 WT TMD	282	X
34682	Three-dimensional structure of the PGAM5 C12S mutant TMD	305	X
34683	Three-dimensional structure of the PGAM5 G17L mutant TMD	270	X
34685	Solution structure of a lanthanide-binding DNA aptamer	858		X
34686	Refined structure of the T193A mutant in the C-terminal domain of DNAJB6b	204	X
34688	Two-state liquid NMR Structure of a PDZ2 Domain from hPTP1E, apo form	961	X
34689	Two-state liquid NMR Structure of a PDZ2 Domain from hPTP1E, complexed with RA-GEF2 peptide	931	X
34691	NMR structure of Npl3 RRM1 bound to the AUCCAA RNA	970	X		X
34692	NMR structure of Npl3 RRM12 bound to the AUCCAGUGGAA RNA	1120	X		X
34693	Solution structure of the complex between plasmodial ZNHIT3 and NUFIP1 proteins	1310	X
34694	Magic-angle spinning NMR structure of the human voltage-dependent anion channel 1 (E73V/C127A/C232S) in DMPC lipid bilayers	1049	X
34695	Solution NMR structure of halophilic DnaE intein	1551	X
34696	Llp mutant C1G, lytic conversion lipoprotein of phage T5	502	X
34697	Conformational ensemble of solnatide in solution	156	X
34698	Regulatory domain dimer of tryptophan hydroxylase 2 in complex with L-Phe	888	X
34699	Solution structure of thanatin-like derivative 4 in complex with E.coli LptA	1454	X
34700	GB1 in mammalian cells, 50 uM	372	X
34701	GB1 in mammalian cells, 10 uM	372	X
34702	Red1-Iss10 complex	1117	X
34703	Solution structure of Tk-hefu-11	296	X
34704	Solution structure of the DNA-binding minor pilin FimT from Legionella pneumophila	1511	X
34705	Hm-AMP2	162	X
34706	Hm-AMP8	295	X
34707	Solution structure of the designed Armadillo repeat protein N(A4)M4C(AII) refined by pseudocontact shifts	435	X
34708	Structure in solution of the TANGO1 cargo-binding domain (21-131)	1315	X
34709	Solution structure of homodimeric Capsid protein (residues 17-95) of Tick-borne encephalitis virus (d16-TBEVC)	699	X
34710	Solution NMR structure of N-acetylglucosaminyltransferase V (GnTV) TMD	319	X
34711	Solution NMR structure of N-acetylglucosaminyltransferase V (GnTV) G26P mutant TMD	345	X
34712	Solution NMR structure of N-acetylglucosaminyltransferase V (GnTV) G22L mutant TMD	318	X
34713	Solution NMR structure of N-acetylglucosaminyltransferase V (GnTV) G22L and G26L double mutant TMD	324	X
34714	Phen-DC3 intercalation causes hybrid-to-antiparallel transformation of human telomeric DNA G-quadruplex	205		X
34715	Solution structure of RBM39 RRM1 bound to U1 snRNA stem loop 3	1248	X		X
34716	Solution structure of thanatin-like derivative 7 in complex with K. pneumoniae LptA	1713	X
34717	Structure of the ADP-ribosyltransferase TccC3HVR from Photorhabdus Luminescens	2067	X
34718	Solution NMR structure of the HTH_8cm consensus miniprotein in 30% TFE at 278K	297	X
34719	Solution structure of the PulM C-terminal domain from Klebsiella oxytoca	826	X
34720	Solution structure of thanatin-like derivative 4 in complex with E.coli LptA mutant Q62L	1450	X
34721	Structure of a hybrid-type G-quadruplex with a snapback loop (hybrid 1R')	164		X
34722	Structure of a parallel G-quadruplex with a snapback loop	174		X
34723	Structure of a hybrid-type G-quadruplex with a snapback loop and an all-syn G-column (hybrid-1R)	148		X
34724	RNA binding induces an allosteric switch in Cyp33 to repress MLL1 mediated transcription regulation	1294	X
34725	RNA binding induces an allosteric switch in Cyp33 to repress MLL1 mediated transcription regulation	1398	X		X
34726	RNA binding induces an allosteric switch in Cyp33 to repress MLL1 mediated transcription regulation	1181	X		X
34727	RNA binding induces an allosteric switch in Cyp33 to repress MLL1 mediated transcription	1872	X
34728	RNA binding induces an allosteric switch in Cyp33 to repress MLL1 mediated transcription regulation	1676	X
34729	The NMR structure of the MAX67 effector from Magnaporthe Oryzae	723	X
34730	The NMR structure of the MAX60 effector from Magnaporthe Oryzae	991	X
34731	The NMR structure of the MAX47 effector from Magnaporthe Oryzae	916	X
34732	Solution structure of Pi6, a low affinity blocking kappa-K+-channel peptide from the scorpion Pandinus imperator	177	X
34734	Triculamin: an Unusual Lasso Peptide with Potent Anti-mycobacterial Activity	194	X
34735	Dimeric i-motif from 2'Farabinocytidine-modified TC5	126		X
34736	Human Interleukin-4 mutant - C3T-IL4	865	X
34737	Structure of the low complexity domain of TDP-43 (fragment 309-350) with methionine sulfoxide modifications	390	X
34738	Phosphatidylserine-dependent synaptic vesicle membrane sculpting by synaptogyrin	1965	X
34739	NMR structure of holo-acp	1039	X
34740	Solution structure of Phen-DC3 intercalating into a quadruplex-duplex hybrid	290		X
34741	Solution structure of a phenyl-indoloquinoline intercalating into a quadruplex-duplex hybrid	213		X
34742	Solution NMR structure of AG41, a 41-amino acid insecticidal protein extracted from Medicago truncatula	412	X
34743	NMR structure of holo-acp	1003	X
34744	NMR structure of holo-acp	1008	X
34745	The Solution Structure of the Triple Mutant Methyl-CpG-Binding Domain from MeCP2 that Binds to Asymmetrically Modified DNA	608	X
34746	Solution structure of nanoFAST/HBR-DOM2 complex	1349	X
34747	solution structure of nanoFAST fluorogen-activating protein in the apo state	1329	X
34748	Solution NMR structure of full-length Nsp1 from SARS-CoV-2	2259	X
34749	Domain 2 of zinc-loaded Caenorhabditis elegans MTL-1	321	X
34750	Solution structure of TLR2 transmembrane and cytoplasmic juxtamembrane regions	631	X
34751	Solution structure of TLR3 transmembrane and cytoplasmic juxtamembrane regions	595	X
34752	Solution structure of TLR5 transmembrane and cytoplasmic juxtamembrane regions	593	X
34753	Solution structure of TLR9 transmembrane and cytoplasmic juxtamembrane regions	585	X
34754	Structural insights reveal a heterotetramer between oncogenic K-Ras4BG12V and Rgl2, a RalA/B activator	1187	X
34755	NMR structure of the antimicrobial peptide Of-Pis1 in DPC micelles	254	X
34756	Antimicrobial peptide capitellacin from polychaeta Capitella teleta in DPC (dodecylphosphocholine) micelles, monomeric form	163	X
34757	Antimicrobial peptide capitellacin from polychaeta Capitella teleta in DPC (dodecylphosphocholine) micelles, dimeric form	385	X
34758	Human HSP90 alpha ATP Binding Domain, ATP-lid open conformation, R60A	1217	X
34759	Human HSP90 alpha ATP Binding Domain, ATP-lid closed conformation, R46A	1217	X
34760	CPSF73 CTD3	908	X
34762	Molecular structure of Cu(II)-bound amyloid-beta monomer implicated in inhibition of peptide self-assembly in Alzheimer's disease	161	X
34763	Molecular structure of Cu(II)-bound amyloid-beta monomer implicated in inhibition of peptide self-assembly in Alzheimer's disease	161	X
34764	Calcium-bound Calmodulin variant G113R	759	X
34765	Solution structure of human apo/Calmodulin G113R (G114R)	772	X
34766	NMR solution structure of the N-terminal RRM and flanking linker regions of Polypyrimidine tract binding protein 1 using the CYANA CONSENSUS method.	1497	X
34767	NMR Structure of Big-defensin 5 from oyster Crassostrea gigas	915	X
34768	Hairpin adopted by modified oligonucleotide A32_mod found in the promoter of AUTS2 gene.	200		X
34769	Hairpin of adopted by oligonucleotide A36 found in the promoter of AUTS2 gene.	233		X
34770	Hairpin adopted by oligonucleotide A38 found in the promoter of AUTS2 gene.	236		X
34771	Solution structure of Lqq4 toxin from Leiurus quinquestriatus quinquestriatus	763	X
34772	An i-motif domain able to undergo pH-dependent conformational transitions (acidic structure)	183		X
34773	Solution Structure of thanatin-like derivative 5 in complex with E. coli LptA mutant Q62L	1802	X
34774	An i-motif domain able to undergo pH-dependent conformational transitions (neutral structure)	172		X
34775	Solution structure of Metridium senile toxin Ms13-1 with the unique fold	392	X
34776	Spider toxin Pha1b (PnTx3-6) from Phoneutria nigriventer targeting CaV2.x calcium channels and TRPA1 channel	537	X
34777	Structure of a symmetrical internal loop motif with three consecutive U:U mismatches from stem-loop 1 in the 3'-UTR of the SARS-CoV2 genomic RNA	249			X
34778	Stapling a host defense peptide for boosted dual targeting of CD14 and bacterial LPS	255	X
34779	apo structure of the specific silver chaperone needed for bacterial silver resistance	989	X
34780	Tetra-stranded double-ion dependent DNA (diDNA) NMR structure of telomeric C.elegans fragment	207		X
34781	Solution structure of carotenoid-binding protein AstaPo1 in complex with astaxanthin	2426	X
34782	The NMR structure of the MAX28 effector from Magnaporthe oryzae	648	X
34783	Macrophage inhibitory factor (MIF) in complex with small molecule PAV174	57	X
34784	Solution structure of the RNA helix formed by the 5'-end of U1 snRNA and an A-1 bulged 5'-splice site in complex with SMN-CY	320			X
34785	SH3 domain solved by the exact solid-state method from the Bruker Dynamics Center using the combined correction method with PDB 2NUZ	655	X
34786	Interleukin-4 (wild type) pH 2.4	1049	X
34787	RDC-refined Interleukin-4 (wild type) pH 5.6	1237	X
34790	JzTx-34 toxin peptide	232	X
34791	JzTx-34 toxin peptide H18A mutant	266	X
34792	JzTx-34 toxin peptide E20A mutant	265	X
34793	JzTx-34 toxin peptide W25A mutant	260	X
34794	JzTx-34 toxin peptide W31A mutant	228	X
34795	JzTx-34 toxin peptide W33A mutant	228	X
34796	Integrated NMR/MD structure determination of a dynamic and thermodynamically stable CUUG RNA tetraloop	238			X
34797	Solution structure of Mu3.1 from Conus mucronatus	193	X
34798	Structure of an i-motif domain with the cytosine analog 1,3-diaza-2-oxophenoxacione (tC) at neutral pH	177		X
34799	Structure of A4M4C bound to (KR)4 Solution backbone structure refined by PCS	442	X
34800	Solution NMR Structure of Alpha-Synuclein 1-25 Peptide in 50% TFE.	275	X
34801	Solution NMR Structure of Lactamised Alpha-Synuclein 2-12 Peptide in 50% TFE.	151	X
34802	Solution structure of thanatin analogue 7 in complex with LptAm(Ab)1.0	1598	X
34803	Solution structure of 6xHIS-tagged wild-type Gaussia luciferase	2212	X
34804	Solution NMR structure of Notch1 TMD	306	X
34805	Solution structure of the 8-17 DNAzyme in presence of Zn2+	334		X
34806	Solution NMR structure of Notch1 L1740-1743 TMD	360	X
34807	Solution NMR structure of Notch1 G1740-1743 TMD	317	X
34808	Solution NMR structure of Notch3 WT TMD	367	X
34809	Why does the herpes simplex 1 virus-encoded UL49.5 protein fail to inhibit the TAP-dependent antigen presentation?	164	X
34811	BRICHOS monomer	1071	X
34812	NMR solution structure of the heavy metal binding domain of P1B-ATPase LpCopA.	813	X
34813	BRICHOS trimer	1001	X
34814	TrkB transmembrane domain NMR structure in DMPC/DHPC bicelles	578	X
34816	Solution structure of a chimeric U2AF2 RRM2 / FUBP1 N-Box	1618	X
34817	bacteriophage T5 l-alanoyl-d-glutamate peptidase Zn2+/Ca2+ form	1317	X
34818	Structural basis of aggregate binding/recognition by the AAA+ disaggregase ClpG	581	X
34822	Structural characterization of PHOX2B and its DNA interactions shed lights into the molecular basis of the + 7Ala variant pathogenicity in CCHS	346	X
34825	Solution NMR structure of D. melanogaster TotA	790	X
34826	Structure of the dimeric, periplasmic domain of ExbD	2468	X
34827	NMR2 Structure of KRAS G12V (GMPPNP bound) in complex with 5-(1H-indol-2-l)piperazin-2-one	19	X
34828	NMR2 Structure of KRAS G12V (GMPPNP bound) in complex with (2E)-3-(1H-indol-2-yl)prop-2-enoic acid	17	X
34831	Molecular Docking of SPF30 Tudor domain with synthetic inhibitor 4-(pyridin-2-yl)thiazol-2-amine	515	X
34832	Three-layered parallel G-quadruplex with snapback loop from a G-rich sequence with five G-runs	186		X
34833	Three-layered basket-type G-quadruplex from a G-rich sequence with five G-runs	159		X
34834	(3+1) hybrid G-quadruplex from a G-rich sequence with five G-runs	169		X
34835	G-quadruplex with a 1-nt V-shaped loop from a G-rich sequence with five G-runs	189		X
34836	TINA-conjugated antiparallel DNA triplex	213		X
34837	Solution structure of the peptide U11-MYRTX-Tb1a from the venom of the ant Tetramorium bicarinatum	422	X
34838	Short RNA binding to peptide amyloids	39	X		X
34839	Structure of the WW domain tandem of PRPF40A	1243	X
34840	Structure of the WW domain tandem of PRPF40A in complex with SF1	1373	X
34841	NMR structure of arthrofactin A in micellar DPC solution	134	X
34843	RNA G-quadruplex from the 5'-UTR of human tyrosine kinase 2 (TYK2)	113			X
34844	Characterization of the zinc finger u-protein HVO_0758 from Haloferax volcanii: biological roles, zinc binding, and NMR solution structure	667	X
34845	d(ATTTC)3 dimeric structure	168		X
34846	Conformations of macrocyclic peptides sampled by NMR: models for cell-permeability. Chemical shift assignments of Cyclosporin A in apolar solvents	102	X
34847	NMR solution structure of C-terminal domain of CDNF	111	X
34848	Conformations of macrocyclic peptides sampled by NMR: models for cell-permeability. Chemical shift assignments of Omphalotin A in apolar solvents	92	X
34849	Conformations of macrocyclic peptides sampled by NMR: models for cell-permeability. Chemical shift assignments of Omphalotin A in methanol / water	93	X
34850	Conformations of macrocyclic peptides sampled by exact NOEs: models for cell-permeability. NMR structure of Omphalotin A in methanol / water indoleOut conformation.	93	X
34851	NMR2 Structure of KRAS G12V (GMPPNP bound) in complex with N-(furan-2-ylmethyl)-1H-benzimidazol-2-amine	17	X
34852	NMR2 Structure of KRAS G12V (GMPPNP bound) in complex with7-fluoro-N,N-dimethyl-1-benzofuran-2-carboxamide	15	X
34853	NMR2 Structure of KRAS G12V (GMPPNP bound) in complex with N-[2-(5-fluoro-1H-indol-3-yl)ethyl]acetamide	15	X
34854	NMR2 Structure of KRAS G12V (GMPPNP bound) in complex with N-(4-fluorophenyl)-2-(2-imino-1,3-thiazol-3-yl)acetamide	15	X
34855	NMR2 Structure of KRAS G12V (GMPPNP bound) in complex with 2-fluoro-N-[(3-methyl-1H-pyrazol-4-yl)methyl]aniline	15	X
34856	Formation of left-handed helices by C2'-fluorinated nucleic acids under physiological salt conditions	128		X
34857	NMR2 Structure of KRAS G12V (GMPPNP bound) in complex with N-methyl-1-(1-phenylpyrazol-4-yl)methanamine	15	X
34858	Formation of left-handed helices by C2'-fluorinated nucleic acids under physiological salt conditions	128		X
34859	NMR2 Structure of KRAS G12V (GMPPNP bound) in complex with 1-(5-methoxy-1H-indol-3-yl)-N,N-dimethylmethanamine	12	X
34860	NMR2 Structure of KRAS G12V (GMPPNP bound) in complex with 2-(methylsulfonylmethyl)-1H-benzimidazole	15	X
34861	NMR2 Structure of KRAS G12V (GMPPNP bound) in complex with N-(3-chlorophenyl)-2-pyrrolidin-1-ylacetamide	15	X
34862	NMR2 Structure of KRAS G12V (GMPPNP bound) in complex with 5-(1H-indol-2-yl)pyrrolidin-2-one	15	X
34863	Solution structure of a bimolecular quadruplex-duplex hybrid containing a V-shaped loop	303		X
34864	Folded alpha helical de novo proteins from Apilactobacillus kunkeei	654	X
34865	Folded alpha helical de novo proteins from Apilactobacillus kunkeei	403	X
34866	Folded alpha helical de novo proteins from Apilactobacillus kunkeei	442	X
34867	Formation of left-handed helices by C2'-fluorinated nucleic acids under physiological salt conditions	66		X
34868	Solution NMR structure of the peptidyl carrier domain TomAPCP from the Tomaymycin non-ribosomal peptide synthetase	1916	X
34869	Solution NMR structure of the peptidyl carrier domain TomAPCP from the Tomaymycin non-ribosomal peptide synthetase in its substrate-loaded state	1810	X
34870	Solution NMR structure of the novel adaptor domain TomBN91 from the Tomaymycin non-ribosomal peptide synthetase	1079	X
34872	Magic-angle spinning NMR Structure of Opa60 in Lipid Bilayers	405	X
34874	Solution structure and chemical shift assignments for HMG-D Y12F mutant complexed to a 14:12 dA2 bulge DNA	1099	X	X
34876	Hybrid-1R G-quadruplex with a +(lpp) loop progression	207		X
34877	(3+1) hybrid-2 G-quadruplex with a -(llp) loop progression	218		X
34878	Solution structure of Risdiplam bound to the RNA duplex formed upon 5'-splice site recognition	320			X
34879	Solution structure of branaplam bound to the RNA duplex formed upon 5'-splice site recognition	320			X
34880	A quadruplex-duplex hybrid with a three-layered hybrid-2 G-quadruplex topology	252		X
34881	A quadruplex-duplex hybrid with a three-layered chair G-quadruplex topology	255		X
34882	A quadruplex-duplex hybrid with a three-layered hybrid-2 G-quadruplex topology complexed with Phen-DC3	261		X
34883	NMR solution structure of thyropin IrThy-Cd from the hard tick Ixodes ricinus	618	X
34885	Solution structure of SMN-CX bound to the RNA helix formed upon SMN2 exon7 5'-splice site recognition	320			X
34886	NMR structure of PKS docking domains	1290	X
34887	the C-terminal domain of TonB protein from Salmonella enterica.	1131	X
34889	Solution structure of osmoregulator OsmY from E. coli.	1719	X
34892	Solution NMR structure of Integrin beta-1 TMD	442	X
34893	Solution NMR structure of Amyloid beta precursor like protein 2 TMD	295	X
34895	Structure of a chair-type antiparallel quadruplex-duplex hybrid at pH 6	260		X
34898	Solution structure of a parallel stranded G-quadruplex formed in ORAI1 promoter	173		X
34899	NMR solution structure of the CysD2 domain of MUC2	812	X
34900	Structure of a quadruplex-duplex hybrid with a (-pd+l) loop progression	251		X
34908	Solution Structure of cAMP-dependent Protein Kinase RII-alpha Subunit Dimerization and Docking Domain Complex with Microtubule Associated Protein 2c (84-111)	914	X
34909	The 5-terminal stem-loop RNA element of SARS-CoV-2 features highly dynamic structural elements that are sensitive to differences in cellular pH	609			X
34910	NMR solution structure of lipid transfer protei Sola l7 from tomato seeds	1039	X
34914	Single acyclic phosphonate nucleotide (S)-ZNA modification on DNA hairpin	190		X
34915	Single acyclic phosphonate nucleotide (R)-ZNA modification on DNA duplex	352		X
34918	SOLUTION STRUCTURE OF 6XHIS-TAGGED WILD-TYPE GAUSSIA LUCIFERASE	1313	X
34927	Trp-cage fortified Tc5b-Exenatide chimera (Ex4-Tc5bER) at 288K	166	X
34928	Trp-cage fortified Tc5b-Exenatide chimera (Ex4-Tc5bER) at 299K	170	X
34930	Trp-cage fortified Tc5b-Exenatide chimera (Ex4-Tc5bER) at 310K	170	X
34931	Trp-cage fortified Tc5b-Exenatide chimera (Ex4-Tc5bER) at 321K	142	X
34932	Trp-cage fortified Tc5b-Exenatide chimera (Ex4-Tc5bDR) at 277K	173	X
34933	Trp-cage fortified Tc5b-Exenatide chimera ( Ex-4-Tc5bDR) at 288K	172	X
34934	Trp-cage fortified Tc5b-Exenatide chimera (Ex-4-Tc5bDR) at 299K	168	X
34935	Trp-cage fortified Tc5b-Exenatide chimera (Ex-4-Tc5bDR) at 310K	167	X
34936	Trp-cage fortified Tc5b-Exenatide chimera (Ex-4-Tc5bDR) at 321K	162	X
34937	Trp-cage fortified Tc5b-Exenatide chimera (Ex4-Tc5bER) at 277K	172	X
34940	Human PEX5 TPR domain in complex with PEX14 KIPSWQIPV peptide	216	X
34941	Trp-cage fortified Tc5b-Exenatide chimera with disulfide bond cyclization (Ex-4-Tc5bSS) at 277K	169	X
34942	Solution structure of a silver ion mediated DNA duplex with universal 7-deazapurine substitutions	100		X
34943	Trp-cage fortified Tc5b-Exenatide chimera with disulfide bond cyclization (Ex-4-Tc5bSS) at 288K	167	X
34944	Trp-cage fortified Tc5b-Exenatide chimera with disulfide bond cyclization (Ex-4-Tc5bCC) at 299K	167	X
34945	Trp-cage fortified Tc5b-Exenatide chimera with disulfide bond cyclization (Ex-4-Tc5bCC) at 310K	168	X
34949	Trp-cage fortified Tc5b-Exenatide chimera with disulfide bond cyclization (Ex-4-Tc5bCC) at 321K	165	X
34950	Trp-cage fortified Tc5b-Exenatide chimera (Ex-4-Tc5bQR) at 277K	168	X
34951	Trp-cage fortified Tc5b-Exenatide chimera (Ex-4-Tc5bQR) at 288K	168	X
34952	Trp-cage fortified Tc5b-Exenatide chimera (Ex-4-Tc5bQR) at 299K	162	X
36000	SOLUTION STRUCTURE OF LYS37 ACETYLATED HUMAN SUMO1	1229	X
36001	Structure model of a protein-DNA complex	1148	X	X
36005	The NMR structure of calmodulin in CTAB reverse micelles	1287	X
36006	SOLUTION STRUCTURE OF LYS42 ACETYLATED HUMAN SUMO2	1174	X
36007	SOLUTION STRUCTURE OF LYS33 ACETYLATED HUMAN SUMO2	1173	X
36008	SOLUTION STRUCTURE OF LYS39 ACETYLATED HUMAN SUMO1	1230	X
36009	Solution NMR structure of Humanin containing a D-isomerized serine residue	180	X
36011	Solution structure of SUMO from Plasmodium falciparum	1004	X
36012	Solution structure of nedd8 from Trypanosoma brucei	780	X
36013	Solution structure of the complex between DP1 acidic region and TFIIH p62 PH domain	1546	X
36014	Solution structure of the Pin1-PPIase (S138A) mutant	1441	X
36016	Structure of roseltide rT1	160	X
36017	Solution NMR structure of a new lasso peptide sphaericin	231	X
36018	Solution structure of the first RRM domain of human spliceosomal protein SF3b49	1162	X
36019	Solution structure of rattusin	186	X
36020	Structure of two CCTG repeats	82		X
36021	Solution structure of heterodimeric coiled-coil domain of Drosophila GABAB receptor 1 and 3	1219	X
36022	Structure of two TTTA repeats	90		X
36023	NMR structure of SLBA, a chimera of SFTI	81	X
36024	NMR structure of TIBA, a chimera of SFTI	115	X
36025	Solution structure of Tilapia Piscidin 4 (TP4) from Oreochromis niloticus	189	X
36026	Solution structure of human Gelsolin protein domain 1 at pH 5.0	983	X
36027	Solution structure of human Gelsolin protein domain 1 at pH 7.3	1207	X
36034	NMR structure of eIF3 36-163	1133	X
36037	Solution structure of a histone binding domain	1064	X
36038	VG13P structure in LPS	78	X
36040	Morintides mO1	210	X
36041	Highly disulfide-constrained antifeedant jasmintides from Jasminum sambac flowers	186	X
36044	Structure of gold nano particle-tagged VG16KRKP in Salmonella typhi LPS	104	X
36045	Solution structure of E.coli HdeA	984	X
36047	Solution NMR structure of peptide toxin SsTx from Scolopendra subspinipes mutilans	296	X
36048	Solution NMR Structure of DNA Mismatch Repair Protein MutT (Family Nudix Hydrolase) from Methicillin Resistant Staphylococcus aureus 252	1702	X
36049	NMR structure of the SARS Coronavirus E protein pentameric ion channel	811	X
36050	Solution structure of the Family 1 carbohydrate-binding module, unglycosylated form	366	X
36051	Solution structure of the Family 1 carbohydrate-binding module with mannosylated Thr1	398	X
36052	Solution structure of the Family 1 carbohydrate-binding module with mannosylated Ser3	366	X
36053	Solution structure of the Family 1 carbohydrate-binding module with mannosylated Ser14	366	X
36054	Solution structure of the Family 1 carbohydrate-binding module with glucosylated Ser3	366	X
36055	Solution structure of the Family 1 carbohydrate-binding module Q2A mutant with mannosylated Ser3	361	X
36056	Solution structure of the Family 1 carbohydrate-binding module Y5A mutant with mannosylated Ser3	359	X
36057	Solution structure of a novel antimicrobial peptide, P1, from jumper ant Myrmecia pilosula	155	X
36058	Refined solution structure of musashi1 RBD2	1094	X
36059	Solution structure of musashi1 RBD2 in complex with RNA	1128	X		X
36060	Solution Structure of the N-terminal Domain of TDP-43	820	X
36061	Ligand induced structure of AmyP-SBD	1625	X
36062	N-terminal Zinc Finger of Synaptotagmin-like Protein 4	53	X
36064	Solution structure of heterodimeric coiled-coil domain of Drosophila GABAB receptor 1 and 2	1025	X
36066	Disulfide-constrained Wound Healing Peptide Derived from Pereskia bleo	214	X
36068	Vaccatide: Antifungal Glutamine-rich 8C-Hevein-like Peptide, vH1	204	X
36069	Esculentin-1a(1-21)NH2	120	X
36070	NMR solution structure of the aromatic mutant H43W H67F cytochrome b5	912	X
36071	NMR solution structure of the aromatic mutant H43F H67F cytochrome b5	883	X
36072	C-terminal zinc finger of RING finger protein 141	41	X
36073	TK9 NMR structure in DPC micelle	50	X
36074	TK9 NMR structure in SDS micelle	50	X
36075	The PHD finger of human Kiaa1045 protein	672	X
36077	Solution structure for human HSP70 substrate binding domain	2114	X
36078	Solution structure for human HSP70 substrate binding domain L542Y mutant	2026	X
36079	Beta-Ginkgotides: Hyperdisulfide-constrained peptides from Ginkgo biloba	102	X
36080	NMR Structure and Localization of a Large Fragment of the SARS-CoV Fusion Protein: Implications in Viral Cell Fusion	253	X
36081	Retracted state of S65-phosphorylated ubiquitin	731	X
36082	Relaxed state of S65-phosphorylated ubiquitin	814	X
36083	Solution NMR structure of a new lasso peptide subterisin	173	X
36084	Solution structure of C-terminal domain of TRADD	1320	X
36085	Anti-CRISPR protein AcrIIA4	1046	X
36086	Solution structure of the major fish allergen parvalbumin Sco j 1 derived from the Pacific mackerel	1317	X
36087	EFK17A structure in Microgel MAA60	132	X
36096	NMR solution structure of SMO1, Sumo homologue in Caenorhabditis elegans	999	X
36097	Structure of FLN IG21 domain in complex with C-terminal peptide of beta-2	607	X
36098	EFK17DA structure in Microgel MAA60	132	X
36101	Solution structure of the complex between UVSSA acidic region and TFIIH p62 PH domain	1836	X
36103	Pholiota squarrosa lectin trimer	270	X
36105	Solution structure of arenicin-3 derivative N6	219	X
36106	Solution structure of arenicin-3 derivative N1	215	X
36107	Solution structure of arenicin-3 derivative N2	230	X
36109	NMR-Based Model of the 22 Amino Acid Peptide in Polysialyltransferase Domain (PSTD) of the Polysialyltransferase ST8Sia IV	260	X
36110	NMR-Based Model of the 22 Amino Acid Peptide in Polysialyltransferase Domain (PSTD) of the Polysialyltransferase ST8Sia IV in the Presence of Polysialic Acid (PolySia)	248	X
36111	Solution structure of yeast Fra2	869	X
36112	NMR structure of the domain 5 of the E. coli ribosomal protein S1	444	X
36114	NMR structure of YAP1-2 WW1 domain with LATS1 PPxY motif complex	582	X
36115	NMR structure of YAP1-2 WW2 domain with LATS1 PPxY motif complex	325	X
36116	The structure of a chair-type G-quadruplex of the human telomeric variant in K+ solution	175		X
36117	SOLUTION STRUCTURE OF HUMAN MOG1	1638	X
36119	Solution Structure of the DISC1/Ndel1 complex	1487	X
36124	Antimicrobial peptide Andersonin-Y1 (AY1)	109	X
36125	Antimicrobial peptide AY1C designed from the skin secretion of Chinese Odorous frogs	103	X
36126	Designed peptide CAY1 from Odorrana andersonii skin secretion	108	X
36129	Solution NMR Structure and Backbone Dynamics of the Partially Disordered Arabidopsis thaliana Phloem Protein 16-1, A Putative mRNA Transporter	1637	X
36133	Solution structure of BCL-XL bound to P73-TAD peptide	1531	X
36136	Designed protein dRafX6	880	X
36142	Solution structure of LysM domain from a chitinase derived from Volvox carteri	602	X
36143	zinc finger domain of METTL3-METTL14 N6-methyladenosine methyltransferase	959	X
36144	Antimicrobial peptide-PEM-2-W5K/A9W	100	X
36146	mBjAMP1 structure	138	X
36147	solution structure of SMAP-18	121	X
36148	solution structure of G2,7,13A SMAP-18 analogue	131	X
36149	LPS bound solution structure of WS2-KG18	110	X
36150	LPS bound solution NMR structure of WS2-VR18	94	X
36157	Nukacin ISK-1 in active state	174	X
36158	Nukacin ISK-1 in inactive state	171	X
36159	Solution structure for the 1:1 complex of a platinum(II)-based tripod bound to a hybrid-1 human telomeric G-quadruplex	260		X
36160	Solution structure for the unique dimeric 4:2 complex of a platinum(II)-based tripod bound to a hybrid-1 human telomeric G-quadruplex	262		X
36161	Solution structure of the SBDbeta domain of yeast Ssa1	2038	X
36162	Solution structure of the SBDalpha domain of yeast Ssa1	1128	X
36163	Solution NMR structures of BRD4 first bromodomain with small compound MMQO	1437	X
36165	Solution structure of integrin b2 monomer tranmembrane domain in bicelle	687	X
36166	Solution structure of H-RasT35S mutant protein in complex with KBFM123	19	X
36167	Solution NMR structure of a new lasso peptide brevunsin	179	X
36168	Solution structure of G-quadruplex formed in vegfr-2 proximal promoter sequence	271		X
36170	NMR structure of IRD7 from Capsicum annum.	498	X
36171	NMR structure of IRD12 from Capsicum annum.	502	X
36172	NMR structure of p75NTR transmembrane domain in complex with NSC49652	394	X
36174	SOLUTION NMR STRUCTURE OF A 14-MER DOUBLE STRANDED DNA DUPLEX CGCGAAATTTCGCG	258		X
36175	A-ubiquitin like protein from the trypanosoma brucei	814	X
36176	Solution Structure of the N-terminal Domain of the Yeast Rpn5	1567	X
36177	Structure of omega conotoxin Bu8	135	X
36179	Solution structure of centrin4 from Trypanosoma brucei	1473	X
36180	Solution Structure of Thioredoxin-Like Effector Protein (TRX3) from Edwardsiella tarda	630	X
36181	Solution structure of peptidyl-prolyl cis/trans isomerase domain of Trigger Factor in complex with MBP	1275	X
36185	Solution structure of RRM domian of La protein from Trypanosoma brucei	897	X
36186	Solution Structure of the DNA complex of the C-terminal Domain of Rok	1409	X	X
36187	Solution Structure of the DNA-Binding Domain of Rok	1219	X
36207	The NMR Structure of the Polysialyltranseferase Domain (PSTD) in Polysialyltransferase ST8siaIV	406	X
36220	Solution structure of the N-terminal domain of the anti-sigma factor RsgI1 from Clostridium thermocellum	708	X
36221	Solution structure of the Sigma-anti-sigma factor complex RsgI1N-SigI1C from Clostridium thermocellum	2245	X
36228	Three-dimensional Solution NMR Structure of KYE28-PEG48 in Microgel	172	X
36243	Mouse receptor-interacting protein kinase 3 (RIP3) amyloid structure by solid-state NMR	112	X
36244	Solution structure of the Rho GTPase binding domain (RBD) of ELMO1	1360	X
36258	Structure of Glargine insulin in 20% acetic acid-d4 (pH 1.9)	333	X
36263	Structure of anti-prion RNA aptamer	239			X
36264	Solution structure of the intermembrane space domain of the mitochondrial import protein Tim21 from S. cerevisiae	1400	X
36265	Three-dimensional LPS bound structure of VG16KRKP-KYE28	290	X
36266	Three-dimensional cytoplasmic membrane-bound structure of VG16KRKP-KYE28	290	X
36273	NMR solution structure of Roseltide rT7	172	X
36284	Structure of the beta2 adrenergic receptor in the full agonist bound state	38	X
36288	Solution structure of Gaussia Liciferase by NMR	1960	X
36293	membrane-bound PD-L1-CD	394	X
36294	membrane-bound Bax helix2-helix5 domain	387	X
36299	Solution structure of SPA-2 SHD	1371	X
36309	Solution structure of Taf14ET-Sth1EBMC	1530	X
36320	Solution structure of anti-CRISPR AcrIF7	770	X
36321	Solution NMR Structure of Peptide P9R	205	X
36326	NMR solution structure of a DNA minidumbbell containing an abasic bulge between two CCTG repeats	92		X
36327	Solution NMR structure of NF1; de novo designed protein with a novel fold	1304	X
36328	Solution NMR structure of NF2; de novo designed protein with a novel fold	854	X
36329	Solution NMR structure of NF7; de novo designed protein with a novel fold	1486	X
36330	Solution NMR structure of NF5; de novo designed protein with a novel fold	1338	X
36331	Solution NMR structure of NF6; de novo designed protein with a novel fold	1287	X
36332	Solution NMR structure of NF4; de novo designed protein with a novel fold	1498	X
36333	Solution NMR structure of NF8 (knot fold); de novo designed protein with a novel fold	1043	X
36334	Solution NMR structure of NF3; de novo designed protein with a novel fold	1350	X
36335	Solution NMR structure of fold-0 Chantal; de novo designed protein with an asymmetric all-alpha topology	1151	X
36336	Solution NMR structure of fold-C Rei; de novo designed protein with an asymmetric all-alpha topology	1384	X
36337	Solution NMR structure of fold-Z Gogy; de novo designed protein with an asymmetric all-alpha topology	1556	X
36338	Solution NMR structure of fold-K Mussoc; de novo designed protein with an asymmetric all-alpha topology	1428	X
36339	Solution NMR structure of fold-U Nomur; de novo designed protein with an asymmetric all-alpha topology	1341	X
36341	N-terminal domain (NTD) Solution structure of aciniform spidroin (AcSpN) from Nephila antipodiana.	1053	X
36342	The NMR structure of the BEN domain from human NAC1	1961	X
36343	a new lasso peptide koreensin	179	X
36345	Solution structure of recombinant APETx1	483	X
36368	Solution structure of the C-terminal domain of Mycobacterium Tuberculosis ribosome maturation factor protein RimM	889	X
36378	NMR solution structures of the DNA minidumbbell formed by 5'-mCTTGXmCTTG-3'	102		X
36379	NMR solution structures of the DNA minidumbbell formed by two CmCTG repeats at pH 5	85		X
36380	NMR solution structures of the DNA minidumbbell formed by two CCTG repeats at pH 5	76		X
36385	Solution structure of Gaussia Liciferase by NMR	1960	X
36404	Solution structure of the C-clamp domain from human HDBP1 in complex with DNA	611	X	X
36405	Solution structure of RPB6, common subunit of RNA polymerases I, II, and III	1509	X
36411	Aptamer enhancing peroxidase activity of myoglobin	220		X
36417	Prion Derived Tetrapeptide Stabilizes Thermolabile Insulin via Conformational Trapping	316	X
36419	A peptide with high affinity for B-Cell lymphoma2(Bcl-2)	251	X
36422	T-hairpin structure found in the RNA element involved in the piRNA biogenesis	76			X
36426	Solution structure of apo-WhiB4 from Mycobacterium tuberculosis	1384	X
36427	Protein complex between phosphorylated ubiquitin and Ubqln2 UBA	813	X
36430	Solution structure of The first RNA binding domain of Matrin-3	1210	X
36431	The solution structure of the second RRM domain of Matrin-3	1278	X
36445	Solution structure of the chimeric peptide of the first SURP domain of Human SF3A1 and the interacting region of SF1.	1190	X
36447	NMR structure of the zeta-subunit of the F1F0-ATPase from Sinorhizobium meliloti	1019	X
36471	solution structure of an anti-CRISPR protein	977	X
36473	Solution structure of Tetrahymena p75OB1-p50PBM	2327	X
36489	Solution structure of T. brucei RAP1	1212	X
36515	Solution structure of the periplasmic domain of the anti-sigma factor RsgI1 from Clostridium thermocellum	2223	X
36516	Solution structure of the periplasmic domain of RsgI6 from Clostridium thermocellum	2216	X
36527	NMR Structure of OsCIE1-Ubox S237D mutant	878	X
36528	NMR Structure of OsCIE1-Ubox	916	X
36589	Solution structures of the N-terminal divergent caplonin homology (NN-CH) domains of human intraflagellar transport protein 54	1751	X
50000	PPARg LBD bound to the inverse agonist T0070907 and NCoR corepressor peptide	1213	X
50001	Solution structure of protein ARR_CleD in complex with c-di-GMP	398	X
50002	Pof8 RNA recognition motif 2	513	X
50003	EB3 200-281 NMR chemical shift assignments	267	X
50004	Backbone 1H, 13C, and 15N Chemical Shift Assignments for human Leptin	670	X
50007	Backbone 1H, 13C, and 15N Chemical Shift Assignments for proIAPP in DPC Micelles	1132	X
50008	ngMinE/I24N	398	X
50009	Backbone and methyl assignment of bacteriorhodopsin incorporated into nanodiscs	1136	X
50010	NMR reveals light-induced changes in the dynamics of a photoswitchable fluorescent protein	1653	X
50011	rsFolder_off	1343	X
50014	ctSpp2(208-254) backbone assignment	220	X
50015	Assignment of Titin domain I83	1270	X
50017	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the hnRNPA1 LCD (deltaHexa construct)	575	X
50018	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP017	34			X
50019	CproIAPP in DPC at pH 4.5	130	X
50021	Backbone NMR assignments of the Smurf2 WW1 domain	124	X
50022	The WW1 domain enhances auto-inhibition in Smurf ubiquitin ligases	707	X
50023	sf1c2	461	X
50024	Smurf1 HECT	112	X
50025	Backbone 1H, 13C, and 15N Chemical Shift Assignments for ribose-5-phosphate isomerase of Mycobacterium tuberculosis (MtRpiB)	708	X
50026	2H,15N,13C-labeled FUS-LC fibrils	241	X
50027	The unusual structure of Ruminococcin C1 antimicrobial peptide confers activity against clinical pathogens	407	X
50028	HIV-1 gp41 Membrane Proximal External Region-Transmembrane Domain (MPER-TMD) Peptide in LMPG micelle	563	X
50029	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP015	34			X
50030	CDC25B-WT	292	X
50031	CDC25B-R482A	292	X
50032	CDC25B - R544A	288	X
50033	CDC25B - W550A	288	X
50034	Backbone 1H, 13C, and 15N Chemical Shift Assignments for APLP1 E1 domain	295	X
50035	Backbone 1H, 13C, and 15N Chemical Shift Assignments for dL3D1	415	X
50036	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP016	36			X
50037	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP018	34			X
50038	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP019	34			X
50039	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP020	34			X
50040	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP021	36			X
50041	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP022	32			X
50042	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP023GC	34			X
50043	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP023GU3	34			X
50044	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP024	34			X
50045	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP025	36			X
50046	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP026	36			X
50047	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP027	32			X
50048	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP028	36			X
50049	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest01	36			X
50050	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest02	36			X
50051	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest03	36			X
50052	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest04	36			X
50053	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest05	32			X
50054	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest06	36			X
50055	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest07	34			X
50056	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest08	32			X
50057	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest09	36			X
50058	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest10	32			X
50059	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest11	34			X
50060	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest12	32			X
50061	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest13	36			X
50062	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest14	32			X
50063	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest15	36			X
50064	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest16	32			X
50065	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest17	34			X
50066	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest18	34			X
50067	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest19	32			X
50068	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP-GU	36			X
50069	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA PL01	24			X
50070	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA PL02	24			X
50071	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA PL03	22			X
50072	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA PL04	24			X
50073	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA UU1	32			X
50074	1H, 13C, and 15N backbone assignments of the pheromone binding protein 2 from the Ostrinia furnacalis (OfurPBP2)	1479	X
50075	Membrane-bound human PD-L1 cytoplasmic domain	394	X
50077	1H, 15N and 13C assignment of BRCA2 48-218(C4A)	800	X
50078	1H, 15N and 13C assignment of BRCA2 53-131	351	X
50079	1H, 15N, 13C assignment of BRCA2 190-284	443	X
50080	Backbone 1H, 13C and 15N resonance assignment of USP7 TRAF-like domain free and in complex with DNA polymerase iota	791	X
50082	hGrb2	901	X
50084	E6AP C-lobe	1464	X
50085	Collective exchange processes reveal an active site proton cage in bacteriorhodopsin	88	X
50086	1H, 15N, 13Ca, 13Cb assignments for yeast Gal4 AD residues 828-881	232	X
50088	Structure and function of the bacterial toxin phenomycin	1107	X
50089	MBP in the solid state	2125	X
50090	G335D TDP43_267-414	541	X
50091	Fce4 domain of Immunoglobulin E	544	X
50093	C-terminal lobe of NOX5 EF-domain calcium loaded	269	X
50094	The N-terminal PARP-like domain of TASOR	860	X
50095	1H, 15N chemical shift assignments of the imino groups of yeast tRNAPhe: influence of the post-transcriptional modifications	54			X
50096	1H, 15N chemical shift assignments of the imino groups of yeast tRNAPhe: influence of the post-transcriptional modifications	56			X
50097	1H, 15N chemical shift assignments of the imino groups of yeast tRNAPhe: influence of the post-transcriptional modifications	56			X
50098	Nipah virus phosphoprotein, residues 1-100	479	X
50099	Nipah virus phosphoprotein residues 91-190	469	X
50100	Nipah virus phosphoprotein residues 173-240	319	X
50101	Nipah virus phosphoprotein residues 223-319	459	X
50102	Nipah virus phosphoprotein residues 299-401	470	X
50103	Nipah virus phosphoprotein residues 387-479	407	X
50104	Backbone 1H, 13C, and 15N Chemical Shift Assignments of human Grb2 N-terminal SH3 domain in complex with Sos1-derived peptide	251	X
50105	Nipah virus phosphoprotein residues 588-650	298	X
50106	Backbone 1H, 13C, and 15N Chemical Shift Assignments of human Grb2 N-terminal SH3 domain conjugated with Sos1-derived modified peptide	255	X
50107	1H, 13C and 15N chemical shift assignments for VPS29	1722	X
50108	1H, 13C and 15N chemical shift assignments for VARP 687-747	598	X
50109	Nonexchangeable proton shifts for d(GTATGGCCATAC)2	83		X
50110	Sequential solid-state NMR assignment of Snu13p in Snu13p:Rsa1p:Hit1p complex	516	X
50113	Influenza A virus M2 cytoplasmic tail at pH 7.2	143	X
50114	Resonance assignment of human STIM1 CC1 fragment	958	X
50115	Backbone 13C, and 15N Chemical Shift Assignments for ChiZ N-terminal Domain	287	X
50117	UN2A	403	X
50118	Resonance assignment of human STIM1 CC1 R304W mutant	757	X
50119	Intramolecular synergy enhances the microtubule end-binding affinity of EB1	272	X
50120	Intramolecular synergy enhances the microtubule end-binding affinity of EB1	217	X
50121	1H, 15N assignments of single-stranded DNA binding domains from the 70 kDa subunit of Human Replication Protein A bound to ssDNA	382	X
50122	Backbone 1H, 13C and 15N Chemical Shift Assignments for Full length Exon-1 Huntington protein	176	X
50123	Backbone 13C, and 15N Chemical Shift Assignments for KirBac1.1	1627	X
50124	Complete sequential assignment of the protein K1-CanA from Pyrodictium abyssi	2170	X
50125	VDAC E73V assignment in DHPC7 micelles	498	X
50126	PACSIN 1 domain SH3	590	X
50127	Influenza A virus M2 cytoplasmic tail at pH 5.5	169	X
50128	SUMO1 flavonoids	2288	X
50129	Backbone assignments of Tau fragment (225-324)	615	X
50130	Backbone assignments of Tau fragment (225-324) with P301L mutation	618	X
50131	Backbone 1H and 15N chemical shift assignments of KL Sup35NM	518	X
50132	Backbone 1H and 15N chemical shift assignments of chimeric SC Sup35NM, 5MT-A	488	X
50133	Backbone 1H and 15N chemical shift assignments of chimeric SC Sup35NM, 5MT-B	488	X
50134	Backbone 1H and 15N chemical shift assignments of chimeric SC Sup35NM, 4MT-A	488	X
50135	KirBac1.1_POPC	1583	X
50138	NMR insights into the pre-amyloid ensemble and secretion targeting of the curli subunit CsgA	535	X
50139	Backbone 1H,13C, and 15N Chemical Shift Assignments for the S. typhimurium tryptophan synthase alpha subunit	1100	X
50141	Backbone chemical shift assignments of the APO Fowlpox virus resolvase (APO Fpr)	598	X
50142	Nb-SUMO1	423	X
50143	1H, 15N, and 13C backbone chemical shift assignments for the first bromodomain of BRD2 (BRD2-BD1)	507	X
50145	1H, 15N, and 13C backbone chemical shift assignments for the first bromodomain of BRD4 (BRD4-BD1)	431	X
50146	1H, 15N, and 13C backbone chemical shift assignments for the second bromodomain of BRD4 (BRD4-BD2)	311	X
50147	1H, 15N, and 13C backbone chemical shift assignments for the second bromodomain of BRD3 (BRD3-BD2)	253	X
50148	1H, 15N, and 13C backbone chemical shift assignments for the first bromodomain of BRD3 (BRD3-BD1)	468	X
50149	1H, 15N, and 13C backbone chemical shift assignments for the second bromodomain of BRD2 (BRD2-BD2)	295	X
50151	Partial backbone resonance assignments for Human DND1-RRM2	324	X
50152	Coat protein of filamentous bacteriophage IKe (fIKE); backbone chemical shifts assignment by 4D Non-uniformly sampled CANCOCX	237	X
50153	Isolation and characterization of antimicrobial peptides with unusual disulfide connectivity from the colonial ascidian Synoicum turgens [Turgencin B(Mox2)]	362	X
50154	C-terminal domain of TDP-43 at acidic pH	1182	X
50156	Backbone assignment of DUSP22	683	X
50157	BR-PsrP	1085	X
50158	1H, 13C, 15N and IVL methyl group chemical shift assignments	1776	X
50159	Oligosaccharyltransferase subunit Ost4p	406	X
50160	Point mutant of Oligosaccharyltransferase subunit, Ost4V23D	366	X
50161	Backbone 1H, 13C, and 15N Chemical Shift Assignments for hyen D	296	X
50162	hyen L	71	X
50163	hyen E	61	X
50164	hyen M	61	X
50165	hyen C	62	X
50166	P2MIN	1390	X
50167	DnaJB1 J-domain+G/F rich region	1022	X
50168	J-domain region of DnaJA2	342	X
50169	DnaJB1 J-domain	132	X
50172	Rab1b bound to GTP	676	X
50173	Rab1b bound to GDP	672	X
50174	Rab1b bound to GTP (AMPylation at Y77)	682	X
50175	Rab1b bound to GDP (AMPylation at Y77)	299	X
50176	Rab1b bound to GTP (Phosphocholination at S76)	682	X
50177	Rab1b bound to GDP (Phosphocholination at S76)	682	X
50178	Cdc42 bound to GTP	296	X
50179	Cdc42 bound to GDP	282	X
50180	Cdc42 bound to GTP (AMPylation at T35)	333	X
50181	Cdc42 bound to GDP (AMPylation at T35)	2026	X
50182	Cdc42 bound to GTP (AMPylation at Y32)	2026	X
50183	Cdc42 bound to GDP (AMPylation at Y32)	2026	X
50185	AcrIIA5	1449	X
50186	Identification of a novel N-linked glycan on the Archaellins and S-layer protein of the thermophilic methanogen, Methanothermococcus thermolithotrophicus	86				X
50187	RBM5 RRM1-Zf1	540	X
50188	Structures of the free and bound forms of the intrinsically disordered plant viral genome-linked protein	1000	X
50189	hnRNPF prion-like domain 365-415 backbone and Cbeta chemical shifts	244	X
50190	NMR backbone assignment and dynamics of Heimdallarchaeota Profilin from the superphylum Asgard	1146	X
50191	RBM5 RRM1-Zf1-C191G	212	X
50192	Solid state NMR assignments for the patient FOR005 l-III immunoglobulin light chain variable domain amyloid fibrils	261	X
50193	Structures of the free and bound forms of the intrinsically disordered plant viral genome-linked protein	286	X
50195	Skp_A108L_monomer	411	X
50196	Backbone chemical shifts of E2A residues 1-100	528	X
50198	1H, 15N Resonance Assignments of VAMP2(1-96) in SH-SY5Y Cells	138	X
50199	1H, 15N Resonance Assignments of VAMP2(1-96) in HEK-293T Cells	138	X
50201	Chemical shift assignment of the Connexin43 cytoplasmic loop domain	766	X
50202	Mode of action of teixobactins in cellular conditions	70	X			X
50203	1H, 13C, and 15N Chemical Shift Assignments of the cGMP-Binding Domain D of the Plasmodium falciparum PKG (cGMP-bound)	447	X
50204	Musashi-1 C-terminal domain, residues 194-362	752	X
50205	Solution NMR resonance assignments for segmentally labelled C-terminal fragment of plant villin-4 protein	478	X
50206	Backbone chemical shift assignments of the KIX:MLLMyb complex	680	X
50207	Purification of native CCL7 and its functional interaction with selected chemokine receptors	593	X
50208	Purification of native CCL7 and its functional interaction with selected chemokine receptors	620	X
50210	EAP34	979	X
50211	Solution-state NMR assignments of the patient FOR005 l-III immunoglobulin light chain variable domain	367	X
50212	Backbone 1H, 13C and 15N resonance assignments of 116 kDa Mycobacterium tuberculosis inorganic pyrophosphatase hexamer	745	X
50213	Backbone 1H, 13C, and 15N Chemical Shift Assignments of the yeast TIM8/13 complex	1271	X
50214	1HN and 15N assignment of PhoQ PD at pH 6.5	250	X
50215	1H, 13C and 15N resonance assignments for the microtubule binding region of the kinetoplastid kinetochore protein KKT4 115-174	606	X
50216	HR1c domain from PRK1	1178	X
50217	Solution structure of Mincle	534	X
50218	UvrD_CTD	868	X
50219	Mfd_RID	854	X
50220	Staphylococcus aureus EF-GC3 methyl chemical shift assignments in complex with FusB	625	X
50221	Staphylococcus aureus EF-GC3 methyl side chain chemical shifts	626	X
50228	1H, 13C and 15N resonance assignments for the microtubule binding region of the kinetoplastid kinetochore protein KKT4 145-232	441	X
50229	1H, 13C and 15N resonance assignments for the microtubule-binding region of the kinetoplastid kinetochore protein KKT4 115-343	1050	X
50231	BRCA1 219-504 Chemical Shift Assignment	1991	X
50235	Backbone assignments of the cIAP1-Bir3 domain	450	X
50236	WT1-KTS RNA complex	846	X		X
50237	free aptamer RNA	396			X
50238	Backbone (1H, 13C and 15N) Chemical Shift Assignments and 15N Relaxation Parameters for protein kinase Inhibitor alpha (PKIa) free state	707	X
50239	Molecular Basis for the Adaptive Evolution of Environment Sensing by H-NS Proteins	341	X
50240	Molecular Basis for the Adaptive Evolution of Environment Sensing by H-NS Proteins	341	X
50241	Chemical Shifts of Vitronectin Hemopexin-like Domain with DHPC and CaCl2	881	X
50242	Chemical shifts for [r(UGGUGG)d(U)]4 G-quadruplex	58			X
50243	Backbone (1H, 13C and 15N) Chemical Shift Assignments and 15N Relaxation Parameters for protein kinase Inhibitor alpha (PKIa) bound to cAMP-dependent protein kinase A	497	X
50244	[r(UGGUGG)(2'OMeU)]4 G-quadruplex	57			X
50245	[r(UGGUGGC)]4 G-quadruplex	58			X
50246	[r(UGGUGGT)]4 G-quadruplex	57			X
50247	[r(UGGUGG)d(T)]4 G-quadruplex	58			X
50248	[r(UGGUGG)(LNA-T)]4 G-quadruplex	56			X
50249	[r(UGGUGGPs)]4 G-quadruplex	56			X
50250	Backbone assignments of LeishIF4E-1 bound to m7GTP	915	X
50251	Heme-bound REV-ERBb ligand binding domain (LBD)	463	X
50253	4E-BP2 chemical shift data for SSP calculation	2446	X
50254	hnRNPA2 1-189	851	X
50255	hnRNPA2 1-189 310K	328	X
50256	hCPEB3	2241	X
50257	hnRNPA2 1-189 bound to rA2RE11	176	X		X
50258	ch-TOG 1-250	1017	X
50259	1H, 13C and 15N Resonance Assignments of the Transactivation domain of the Human Forkhead Transcription Factor FOXO4	168	X
50260	1H, 15N and 13C backbone assignments of GDP-bound Rab4a	667	X
50261	Vitronectin hemopexin-like domain with DHPC	862	X
50263	NMR backbone assignment of the transmembrane helix of TREM2, an Alzheimer linked disease protein	167	X
50264	NMR Backbone Resonance Assignment of TREM2 transmembrane helix K186A variant	165	X
50265	NMR backbone resonance assignment of TREM2 transmembrane helix in complex with the partner protein DAP12	159	X
50267	1H, 15N and 13C backbone assignments of GTP-bound Rab4a	652	X
50268	Small Molecule Targeting IRES Domain Inhibits Enterovirus 71 Replication via an Allosteric Mechanism that Stabilizes a Ternary Complex	119			X
50269	Fe+2-containing acireductone dioxygenase (Homo sapiens)	1567	X
50270	Cre Recombinase Catalytic Domain	1153	X
50271	NOP15 81-180 Y94W	398	X
50273	Maturation of the Functional Mouse CRES Amyloid from Globular Form	426	X
50274	Orb2A Prion Like Domain	906	X
50275	Maturation of the Functional Mouse CRES Amyloid from Globular Form	650	X
50276	Backbone Assignments for human BCL-XL(1-212)	651	X
50277	Backbone assignments of Ca 2+ /calmodulin-dependent protein kinase 1D	1331	X
50278	Canonical and modified dsDNA 12mers	159		X
50283	Backbone and methyl chemical shift assignments, relaxation data and order parameters of Galectin-3C in complex with meta-fluoroaryltriazole galactopyranosyl 1-thio-D-glucopyranoside derivative	584	X
50284	Backbone and methyl chemical shift assignments, relaxation data and order parameters of Galectin-3C in complex with para-fluoroaryltriazole galactopyranosyl 1-thio-D-glucopyranoside derivative	584	X
50285	Backbone and methyl chemical shift assignments, relaxation data and order parameters of Galectin-3C in complex with ortho-fluoroaryltriazole galactopyranosyl 1-thio-D-glucopyranoside derivative	584	X
50298	phosphorylated BAF	617	X
50299	Identification of Phenothiazine Derivatives as UHM-Binding Inhibitors of Early Spliceosome Assembly	379	X
50300	Sequence-specific resonance assignments of the Chlamydomonas reinhardtii SAS-6 N-terminal domain, F145E variant	676	X
50301	Urea Denatured Staphylococcal Nuclease	417	X
50302	Human beta-2 microglobulin D76N variant	952	X
50304	EapH1	547	X
50305	Assignment NaK2K Y66F channel	474	X
50308	Sequence-specific resonance assignments of the human SAS-6 F131D head domain	444	X
50309	Leishmania major MCC BCCP backbone chemical shift assignments	839	X
50310	Backbone 1H, and 15N chemical shift Assignments for the ligand-free GlnBP	302	X
50312	13C and 15N Chemical Shift Assignments for human A117V variant Y145Stop Prion Protein Amyloid Fibrils	90	X
50313	13C and 15N Chemical Shift Assignments for human M129V variant Y145Stop Prion Protein Amyloid Fibrils	80	X
50314	FtsZ CTD (317-383)	316	X
50315	ABD	54	X
50316	ABD12	37	X
50317	ABD23	30	X
50318	ABD1	24	X
50319	ABD2	13	X
50320	ABD3	17	X
50321	ABD2'	9	X
50322	ABD23ss	30	X
50323	ABD23ac	30	X
50324	Assigned backbone chemical shifts of DEPTOR-PDZ	411	X
50325	Backbone chemical shift assignment of the FRB domain of mTOR	480	X
50326	Backbone chemical shift assignment of the linker region of DEPTOR	463	X
50328	BBP28 reduced 23-148	534	X
50329	NPAT	404	X
50330	Ubkeks	921	X
50331	CXCL8-CXCR1 N-domain solution NMR structure	995	X
50334	1H, 13C, and 15N backbone chemical shift assignments of the nucleic acid-binding domain of coronavirus-2 non-structural protein 3e	587	X
50335	FLASH_1923	831	X
50336	yarp	800	X
50337	SARS Cov2 nsp7 backbone assignments	1090	X
50338	1H, 13C, 15N resonance assignment of the apo form of the small, chitin-active lytic polysaccharide monooxygenase JdLPMO10A from Jonesia denitrificans	1040	X
50339	Assignment of base 15N and 1H chemical shifts for <5_SL5B+C>	684			X
50340	Assignment of base 15N and 1H chemical shifts for 5_SL5stem	149			X
50341	Assignment of base 15N and 1H chemical shifts for <3_s2m>	63			X
50342	Assignment of base 1H and 15N chemical shifts for 3_SL1	145			X
50343	Assignment of base 1H and 15N chemical shifts for 3_SL2	94			X
50344	Assignment of base 1H and 15N chemical shifts for 5_SL2+3	95			X
50345	Trypanosoma cruzi PEX-14 N-terminal domain	128	X
50346	Assignment of base 15N and 1H chemical shifts for 5_SL5a	772			X
50347	Assignment of anomeric protons and base 1H, 13C and 15N chemical shifts for 5_SL4	664			X
50348	Assignment of base imino 1H and 15N chemical shifts for PK	50			X
50349	Assignment of base 15N and 1H chemical shifts for <5_SL1>	609			X
50350	Assignment of base 15N and 1H chemical shifts for 3_SL3base	74			X
50351	Assignment of base 15N, 13C and 1H chemical shifts for 5_SL6	181			X
50352	Assignment of base 15N and 1H chemical shifts for 5_SL8	62			X
50353	1H, 13C, 15N chemical shift assignment of NTD MaSp2 from Nephila clavipes	1597	X
50355	1H, 13C, 15N backbone and ILMVA methyl group assignment of the N-terminal RecA domain of the DEAD-box RNA helicase DbpA from E.coli	1854	X
50356	1H, 13C, 15N backbone and ILMVAT methyl group assignment of the C-terminal RecA and RBD domains of the DEAD-box RNA helicase DbpA from E.coli	1793	X
50357	1H, 15N backbone and ILMVA methyl group assignment of the DEAD-box RNA helicase DbpA from E.coli	1811	X
50358	Backbone 1H, 13C, 15N chemical shift assignments for Cu-CCH	515	X
50359	Backbone 1H, 13C, 15N chemical shift assignments for apo-CCH	562	X
50360	BBP28(23-148) oxidized	1737	X
50361	1H, 13C and 15N chemical shift assignment of an intein protein from a cyanobacterium Spirulina platensis	1719	X
50362	BBP28(50-148) reduced	373	X
50366	hCEACAM1 N-terminal IgV domain N97A mutant	488	X
50368	hCEACAM1 N-terminal IgV domain	513	X
50369	Human AK3 apo-form	927	X
50370	Nipah Virus Phosphoprotein N-terminal Region (1-406)	1733	X
50371	Backbone assigenments of the Lon protease from Mycobacterium tuberculosis complex	890	X
50372	1H and 13C chemical shifts for a peptide encompassing residues 391-409 of CB1 receptor in DPC micelles	228	X
50373	1H and 13C chemical shifts for a peptide encompassing residues 391-409 of CB1 receptor in 30% TFE	228	X
50374	1H and 13C chemical shifts for a peptide encompassing residues 391-409 of CB1 receptor in aqueous solution	361	X
50375	1H and 13C chemical shifts for a peptide encompassing residues 63-76 of beta-arrestin1 in DPC micelles	160	X
50376	1H and 13C chemical shifts for a peptide encompassing residues 63-76 of beta-arrestin 1 in 30% TFE	180	X
50377	1H and 13C chemical shifts for a peptide encompassing residues 63-76 of beta-arrestin 1 in aqueous solution	263	X
50378	M2, M2-L1, M2-L3, M2-L1L3 G-quadruplexes + Trisubstituted Naphtalene Diimide NDI-5	763		X
50379	N SARS-CoV-2 SR-rich motif (182-197)	80	X
50380	Hepatits C virus NS5A protein AHD1 domain	458	X
50381	The Structural Basis of PTEN Regulation by Multi-Site Phosphorylation	347	X
50382	1H and 13C chemical shifts for a mixture of a CB1-derived peptide and a beta-arrestin1-derived peptide in aqueous solution	389	X
50383	1H and 13C chemical shifts for a mixture of a CB1-derived peptide and a beta-arrestin1-derived peptide in 30% TFE	388	X
50384	1H and 13C chemical shifts for a mixture of a CB1-derived peptide and a beta-arrestin1-derived peptide in DPC micelles	428	X
50385	Proton solid-state NMR assignment of pRN1	644	X
50386	Phosphorylated tEIN backbone and I/L/V methyl resonance assignment	2083	X
50387	1H, 13C, and 15N backbone chemical shift assignments of the macrodomain of SARS-CoV-2 non-structural protein 3b	834	X
50388	1H, 13C, and 15N backbone chemical shift assignments of the macrodomain of SARS-CoV-2 non-structural protein 3b bound to ADPr	727	X
50389	Backbone Assignments of the Rec3 domain of CRISPR-Cas9 for S. pyogenes	983	X
50391	DedD	1466	X
50392	1H, 13C, and 15N backbone chemical shift assignments of coronavirus-2 non-structural protein Nsp10	661	X
50393	MERS-CoV macro domain with ADP-ribose at 298K and 308K	1056	X
50394	MERS-CoV macro domain with NAD at 298K and 308K	584	X
50395	MERS-CoV macro domain with ATP at 298K and 308K	580	X
50396	MERS-CoV macro domain with ADP at 298K and 308K	582	X
50397	MERS-CoV macro domain with AMP at 298K and 308K	586	X
50398	Backbone/side_chain assignment of human FOXO4 86_207	1114	X
50399	1H, 13C, 15N chemical shifts for the PmScsC linker peptide in water	137	X
50400	1H, 13C, 15N chemical shifts for PmScsC linker peptide in 50% TFE	130	X
50401	hFOXO4_240_280 backbone assignment	89	X
50402	hFOXO4_465-500	133	X
50403	hFOXO4_FHCR3	463	X
50404	NMR assignments of the FinO domain in RNA chaperone RocC (repressor of competence)	1121	X
50405	WT1(-KTS) backbone and side chain 13C, 15N and 1H assignments	1228	X
50407	V98A EcRNHI* (Cys-free) 15N-1H Backbone Chemical Shifts	304	X
50408	V98A EcRNHI 15N-1H Backbone Chemical Shifts	292	X
50409	SoRNHI 15N-1H Backbone Chemical Shifts	302	X
50410	NMR signal assignments and backbone dynamics of the apo-C-terminal domain of orange carotenoid protein from cyanobacteria	1506	X
50411	EmrE S64V Mutant Bound to tetra(4-fluorophenyl)phosphonium at pH 5.8	727	X
50412	Backbone and side-chain chemical shift assignments of p50 subunit of NF-kB transcription factor	3060	X
50414	A10 nanobody protein backbone assignation	388	X
50415	Chemical shift assignment of cyclorasin 9A5 in water	85				X
50416	Chemical shift assignment of cyclorasin 9A5 in DMSO	85				X
50417	Chemical shift assignment of cyclorasin 9A54 in water	96				X
50418	Chemical shift assignment of cyclorasin 9A54 in DMSO	99				X
50421	Detection of key sites of dimer dissociation and unfolding initiation during activation of acid-stress chaperone HdeA at low pH	1313	X
50422	Resonance assignment of SARS-CoV-2 macro domain	1895	X
50423	Chemical shifts assignments of synaptobrevin-2 in trans-SNARE complex by solid-state NMR	331	X
50424	1H, 13C and 15N backbone NMR assignments of pathogenic variant C84Y of cardiac troponin C (cTnC)	1190	X
50425	Influenza A matrix protein 1	678	X
50426	FOXP2_FH_504-594	159	X
50427	FOXP2_247-341	318	X
50428	1H, 13C, 15N solid-state MAS NMR assignments of influenza virus hemagglutinin stalk long alpha helix (LAH) antigen	444	X
50430	Monomeric ETV6 PNT domain with a V112E mutation	124	X
50431	ETV6 PNT Domain with an V112E PNT domain complexed to an unlabelled A93D PNT domain	148	X
50432	ETV6 PNT Domain with an A93D PNT domain complexed to an unlabelled V112E PNT domain	148	X
50433	Monomeric ETV6 PNT domain with an A93D mutation	418	X
50434	Backbone assignments of AEG12	697	X
50437	Mutation that removes disulfide in HdeA results in an unfolded protein that gains structure at low pH	761	X
50438	H2A and H2B tails in nucleosome	1932	X
50443	1H, 13C, and 15N resonance assignments of reduced apo-WhiB4 from Mycobacterium tuberculosis	1384	X
50444	Amide assignments of human GMCSF at low pH	195	X
50445	Backbone resonance assignment of dopamine N-acetyltransferase (Dat)	897	X
50446	1H, 13C and 15N Backbone Chemical Shift Assignments of SARS-CoV-2 Nsp3a	842	X
50447	1H, 15N, 13C resonance assignment of the Fam20C hyperphosphorylated human Osteopontin (17-314)	1115	X
50448	1H-13C-15N Sars Unique Domain CoV-2 (nsp3c) N-terminal domain	1611	X
50449	Backbone Chemical Shift Assignments, Chemical shift perturbation and PRE data for XcpH soluble domain from P. aeruginosa	562	X
50450	1H, 13C and 15N backbone resonance assignments for isolated PDZ1 domain of the DegP serine protease from E. coli	369	X
50451	DegP-PDZ2	245	X
50452	DegP-PDZ1PDZ2-25C	642	X
50453	DegP-PDZ1PDZ2-50C	2050	X
50454	human PARP-1 CAT domain HN, N, CA and CB assignments and backbone amide group 15N relaxation data	1985	X
50455	Backbone amide group 15N and 1H assignments and 15N relaxation data for human PARP-1 CAT domain complexed to veliparib	652	X
50456	Backbone amide group 15N and 1H assignments and 15N relaxation data for human PARP-1 CAT domain complexed to olaparib	652	X
50457	Backbone amide group 15N and 1H assignments and 15N relaxation data for human PARP-1 CAT domain complexed to talazoparib	648	X
50458	Backbone amide group 15N and 1H assignments and 15N relaxation data for human PARP-1 CAT domain complexed to EB-47	602	X
50459	Backbone amide group 15N and 1H assignments and 15N relaxation data for human PARP-1 CAT domain L765F mutant	648	X
50460	Backbone amide group 15N and 1H assignments and 15N relaxation data for human PARP-1 CAT domain L765A mutant	658	X
50461	Backbone amide group 15N and 1H assignments and 15N relaxation data for human PARP-1 CAT domain L713F mutant	662	X
50463	L-Phenylseptin	117	X
50464	Solution structure of pase A	231	X
50465	1H, 13C and 15N chemical shift assignments of the human Death-associated protein 1 (DAP-1)	1285	X
50466	Backbone 1H and 15N Chemical Shift Assignments for NEDD8	142	X
50467	Backbone 1H, 13C and 15N Chemical Shift Assignments for Relaxed State of S65-phosphorylated NEDD8	257	X
50468	Backbone 1H, 13C and 15N Chemical Shift Assignments for Retracted State of S65-phosphorylated NEDD8	246	X
50469	A28	1319	X
50470	Backbone 1H, 13C, and 15N Chemical Shift Assignment for Human Atg3 without N-terminal 25 resides	1167	X
50471	Backbone 1H, 15N, and 13C Chemical Shift Assignments for the Apo-State of Kemp Eliminase HG3.17	1310	X
50472	Methyl assignments of Hsp90 FL AIM LV pro-R labeled	732	X
50473	Backbone Resonance Assignments of OmpR DNA-binding domain.	446	X
50474	Methyl assignments of Hsp90 FL AIM LV pro-R labeled bound to AMP-PNP	716	X
50476	NfsB chemical shifts	1018	X
50477	Backbone 1H, 13C, and 15N Chemical Shift Assignments of co-activator nuclear receptor interacting domain TIF2 NRID	726	X
50478	Human growth hormone receptor intracellular domain	475	X
50479	1H, 15N, and 13C resonance assignments for human Atg3 with deletion of residues 90-190	933	X
50480	1H, 13C, and 15N resonance assignment for human Atg3 with deletion of 90 to 190 residues in bicelles	796	X
50481	1H, 13C, and 15N backbone resonance assignments of human Atg3 P21A with deletion of 90 to 190 residues in bicelles	602	X
50484	S-nitrosated mutant of human thioreodoxin 1 (C32S/C35S/C69S/C73S)	1291	X
50485	Mutant of human thioreodoxin 1 (C32S/C35S/C69S/C73S)	1304	X
50486	1H and 13C chemical shifts for hECP30 in aqueous solution	958	X
50487	1H and 13C chemical shifts for Orn analogue of hECP30 in aqueous solution	701	X
50488	1H and 13C chemical shifts for [DOrn1,DPro2] analogue of hECP30 in aqueous solution	708	X
50489	1H and 13C chemical shifts for [DPro2]-Orn analogue of hECP30 in aqueous solution	713	X
50490	1H and 13C chemical shifts for hECP30 in DPC micelles	352	X
50491	1H and 13C chemical shifts for Orn analogue of hECP30 in DPC micelles	356	X
50492	1H and 13C chemical shifts for [DOrn1,DPro2] analogue of hECP30 in DPC micelles	359	X
50493	1H and 13C chemical shifts for [DPro2]-Orn analogue of hECP30 in DPC micelles	360	X
50496	Sarcomeric intrinsically disordered protein FATZ-1 (N-FATZ-1)	973	X
50497	Sarcomeric intrinsically disordered protein FATZ-1 (D91-FATZ-1)	545	X
50507	1H, 15N and 13C NMR assignments of the N-terminal domain of HKU1-bCoV nucleoprotein.	1571	X
50509	Backbone and sidechain assignments of RRM1 domain of human RBM6	832	X
50512	Backbone chemical shifts assignments of PLEKHA7	455	X
50513	Backbone chemical shift assignments for the Betacoronavirus SARS-CoV-2 non-structural protein Nsp9	765	X
50515	NMR assignments of the Fc fragment of mouse immunoglobulin G2b glycoprotein non-galactosylated (G0) glycoform	505	X			X
50516	Nsp3c SUD-M	1471	X
50517	Nsp3c SUD-C	804	X
50518	1H, 13C, and 15N backbone chemical shift assignments of the C-terminal dimerization domain of SARS-CoV-2 nucleocapsid protein	566	X
50522	NMR assignment of Fc fragment of mouse immunoglobulin G2b glycoprotein galactosylated (G2) glycoform	526	X			X
50523	SsoSSB 1-114	1355	X
50524	Backbone 1H, 13C, and 15N Chemical Shift Assignments for c-FLIPs_C8-1a compex	2184	X
50525	transmembrane domain of PD-L1	625	X
50526	Assigned chemical shifts for PABPC1 RRM1 and BTG2(APRO)	866	X
50527	Backbone chemical shift assignments for the C-terminal domain of wild type human prion protein (residues 125-230) at 16deg C, pH 7.	464	X
50528	Backbone chemical shift assignments for the C-terminal domain of T183A human prion protein (residues 125-230) at 16deg C, pH 7.	377	X
50529	Resonance assignment of the designed MASP2 inhibitor SFMI2	86	X
50530	Methyl assignments of recombinant wild-type human alpha1-antitrypsin	784	X
50531	Methyl assignments of recombinant wild-type human alpha1-antitrypsin bound to GSK716	724	X
50532	Methyl assignments of human M alpha1-antitrypsin	784	X
50533	Methyl assignments of human M alpha1-antitrypsin bound to GSK716	716	X
50534	Methyl assignments of human Z alpha1-antitrypsin	724	X
50535	Methyl assignments of human Z alpha1-antitrypsin bound to GSK716	708	X
50536	S AAT	764	X
50537	Backbone Assignments for the Human Interleukin-17A Homodimer	485	X
50538	Backbone Assignments for the Human Interleukin-17F Homodimer	555	X
50539	Mechanistic basis for ubiquitin modulation of a protein energy landscape	261	X
50540	Backbone Assignments for the Human Interleukin-17AF Heterodimer	1199	X
50541	13C and 15N Chemical Shift Assignments for the Tubular Assembly of the Rous Sarcoma Virus Capsid Protein	1268	X
50542	Alpha-endosulfine (ENSA)	707	X
50543	Chemical shift assignment of the SH3 domain of human Caskin1	570	X
50544	1H, 13C, 15N backbone and side-chain resonance assignments of the G131V pathogenic mutant of human prion protein	1266	X
50545	1H, 13C and 15N NMR chemical shift assignment of A. thaliana RCD1 RST 487-589	463	X
50546	Backbone 1H,13C, and 15N Chemical Shift Assignments for the Toho-1 b-lactamase R274N/R276N double mutant enzyme	1221	X
50548	1H, 13C, and 15N NMR chemical shift assignment of the complex formed by the first EPEC EspF repeat and N-WASP GTPase binding domain	1215	X
50549	Chemical shift assignment of End Binding Protein 1	485	X
50550	13C and 15N Chemical Shift Assignments for the Spherical Assembly of the Rous Sarcoma Virus Capsid Protein	1201	X
50552	structure of SRSF1 RRM1 bound to RNA (AACAAA)	837	X		X
50554	C8-AcpP FabF titration	288	X
50555	Backbone assignment of B-domain of bacterial Fatty acid kinase bound to palmitic acid	1296	X
50556	A121I-FakB1 bound to palmitic acid	1308	X
50557	SARS-CoV-2 nucleoprotein 175-263	292	X
50558	1H, 13C and 15N Backbone Chemical Shift Assignments of the N-terminal and Central Intrinsically Disordered Domains of SARS-CoV-2 Nucleoprotein	438	X
50559	Titration of C8-AcpP with the E. coli thioesterase 1 TesA	286	X
50560	Titration of AcpP with the E. coli 3-oxoacyl-[acyl-carrier-protein] reductase FabG	288	X
50561	Titration of C8-AcpP with the E. coli Enoyl-[acyl-carrier-protein] reductase FabI	288	X
50563	Mutation G132S enhances resistance of Mycobacterium tuberculosis b-lactamase against sulbactam	749	X
50564	Mutation G269S enhances resistance of Mycobacterium tuberculosis b-lactamase against sulbactam	490	X
50565	Mutation A55E enhances resistance of Mycobacterium tuberculosis b-lactamase against sulbactam	488	X
50566	Mutation D172N enhances resistance of Mycobacterium tuberculosis b-lactamase against sulbactam	751	X
50567	Structure of PCSK9 antagonist P9-38	214	X
50568	1H and 15N assignments for 14-residues peptide that is cleaved by MPro	28	X
50569	1H and 15N assignments for 14-residue peptide after cleavage by MPro	23	X
50570	PfAlu RNA Helix3	15			X
50571	PfAlu RNA Helix4	12			X
50572	PfAlu RNA Helix5	15			X
50574	1H, 15N and 13C sequence-specific backbone assignment of the MAP Kinase Binding Domain of Dual Specificity Phosphatase 1	1116	X
50575	Cyclosporin E in chloroform	163				X
50576	NfsB + nicotinate	398	X
50579	1H, 13C, and 15N resonance assignments of WRKY33-C(V352-A422) from Arabidopsis thaliana	766	X
50580	WRKY33-C(331-422)	905	X
50581	combined_WRKY33-C	232	X
50582	1H, 13C, and 15N resonance assignments of SIB1	299	X
50583	1H, 13C, and 15N resonance assignments of combined SIB1	217	X
50584	Ebola Virus Glycoprotein Interacts with Cholesterol to Enhance Membrane Fusion and Cell Entry, wt	164	X
50585	Assignment of alpha-synuclein fibrils in the presence of anionic phospholipids	304	X
50591	Ebola Virus Glycoprotein Interacts with Cholesterol to Enhance Membrane Fusion and Cell Entry, G660L mutant	160	X
50592	Slow disulfide bridge formation in the folded CH2 domain	346	X
50593	nsP3 VEEV	999	X
50594	NMR resonance assignments for a docking domain pair with an attached thiolation domain from the PAX peptide-producing NRPS from Xenorhabdus cabanillasii	775	X
50595	Backbone and aliphatic side chain of Gamma mini-lid R133A	2240	X
50596	Solution structure and conformational dynamics of a doublet acyl carrier protein from prodigiosin biosynthesis	2487	X
50598	peptide containing C-terminal Asp for random coil chemical shifts at pH 2.3 and 7.4 under denaturing conditions	60	X
50599	reference peptide including N-terminal Pro at pH values of 2.3 and 7.4 under denaturing conditions	48	X
50600	reference peptide containing Asp-Pro at the pH values of 2.3 and 7.4 under denaturing conditions	76	X
50601	Reference peptide containing iso-aspartate at the pH values of 2.3 and 7.4 under denaturing conditions	78	X
50602	Backbone assignment for human Mad1-CTD (597-718)	563	X
50603	Human Glucocorticoid Receptor DNA binding domain (DBD) assigned chemical shifts	402	X
50604	Human Histone H2A type-2A in Nucleosome	72	X	X
50606	NMR chemical shifts of Ly29-43C-C peptide	217	X
50607	Ly29-43 C,C	215	X
50608	Chemical shifts of nAchR loop C fragment mLs202-114C,C	156	X
50609	chemical shifts of the nAchR loop C fragment 202-214 stabilized by disulfides	156	X
50610	T9 DNA	172		X
50611	U9 DNA	252		X
50612	NMR assignments of ARID4B Tudor domain	1774	X
50613	U8 DNA	248		X
50614	dhU3 DNA	241		X
50615	DDD DNA	241		X
50616	A3T3 DNA	155		X
50617	MeC9 DNA	155		X
50618	1H 13C 15N assignment of IDR2-domain (176-248) of Nucleocapsid Protein of SARS-CoV 2 in the 1-248 construct	313	X
50619	1H 13C 15N assignment of IDR1-domain (1-47) of Nucleocapsid Protein of SARS-CoV 2 in the 1-248 construct	215	X
50620	1H, 13C and 15N backbone chemical-shift assignments of SARS-CoV-2 non-structural protein 1 (leader protein)	835	X
50621	SARS-CoV-2 nsp9	496	X
50622	nsp9 viral protein	379	X
50625	A (3+1) hybrid G-quadruplex containing right loop progression	237		X
50626	Backbone chemical shift assignments for the D3 translational isoform of the human glucocorticoid receptor	825	X
50627	Backbone chemical shift assignments for the D2 translational isoform of the human glucocorticoid receptor	775	X
50628	Backbone chemical shift assignments for the D1 translational isoform of the human glucocorticoid receptor	770	X
50629	Hinge region of the Trypanosoma brucei PKA regulatory subunit (TbPKAr)	208	X
50630	Hinge region of the Trypanosoma brucei PKA regulatory subunit	229	X
50631	Hinge region of the Trypanosoma brucei PKA regulatory subunit	218	X
50632	Hinge region of the Trypanosoma brucei PKA regulatory subunit	244	X
50633	NMR data of gallium binding peptide M3 (without gallium)	96	X
50634	NMR data of gallium binding peptide M3 (with gallium)	95	X
50635	NMR data of gallium binding peptide C3.15 (without gallium)	103	X
50636	NMR data of gallium binding peptide C3.15 (with gallium)	103	X
50637	Minimal trans VS ribozyme in 5 mM MgCl2	156			X
50638	13C, 15N and 1H assignment of the homeodomain of human SIX1	737	X
50639	Chemical shift assignment of cyclorasin 12A in DMSO	84				X
50640	1H, 13C, 15N Chemical Shift Assignments for the A45E mutant of Myristoylated HIV-1 Matrix	359	X
50641	1H, 13C, 15N Chemical Shift Assignments for the Q63R mutant of Myristoylated HIV-1 Matrix	370	X
50642	1H, 13C, 15N Chemical Shift Assignments for the L75G mutant of Myristoylated HIV-1 Matrix	371	X
50643	1H, 13C, 15N Chemical Shift Assignments for the T70R mutant of Myristoylated HIV-1 Matrix	345	X
50644	Chemical shift assignment of cyclorasin 9A12 in DMSO	92				X
50645	Chemical shift assignment of cyclorasin 9A44d in DMSO	94				X
50646	Chemical shift assignment of cyclorasin 12A in water	82				X
50647	Chemical shift assignment of cyclorasin 9A12 in water	84				X
50648	Chemical shift assignment of cyclorasin 9A44d in water	92				X
50649	1H, 13C, and 15N backbone chemical shift assignments of yeast sulfhydryl oxidase Erv1	432	X
50650	human Angiogenin pH 6.3 35oC	570	X
50651	NMR assignment of T35S mutant of K-Ras4b(1-169) bound to GppNHp	812	X
50652	NMR assignment of T35S/Q61L mutant of human K-Ras4b(1-169) bound to GppNHp	820	X
50676	PPACK-Thrombin	1238	X
50678	thrombin-thrombomodulin complex	705	X
50679	human thrombin	1063	X
50680	Red1 backbone chemical shift assignments for residues 288-322	516	X
50681	1H, 13C, 15N reduced mitoNEET assignment	509	X
50682	1H, 13C, 15N oxidized mitoNEET assignment	74	X
50683	Resonance assignment of human STIM1 CC3 fragment	470	X
50686	Backbone chemical shift assignment, R1 and R2 relaxation rates of R272E/K273E mutant of deubiquitinase A	743	X
50687	SARS CoV-2 Non structural protein 2 C-terminal instrinsically disordered region (Nsp2 CtIDR)	207	X
50688	Solution NMR structure of mouse N4BP1 CUE domain	546	X
50689	Chemical shift assignments of the Campylobacter jejuni helical cell shape determining protein Pgp2 in its apo form	1239	X
50691	Chemical shift assignment of thorarchaeota profilings	1205	X
50694	1H, 15N, 13C backbone resonance assignment of the monomer C-terminal domain of Enzyme I from Thermoanaerobacter tengcongensis	1197	X
50695	1H, 15N, 13C backbone resonance assignment of the monomer C-terminal domain of Enzyme I from Thermoanaerobacter tengcongensis	1398	X
50696	CD11b I-domain	703	X
50697	The N-terminal domain (NTD) of MtaLonA	1454	X
50698	Domains 5 of the gelation factor from Dictyostelium discoideum	375	X
50699	NMR titration of a C6-AcpP with the FabA E. coli 3-hydroxydecanoyl dehydratase	288	X
50700	Titration of C10-AcpP wit the E. coli 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase FabA	288	X
50701	htau40 assignment	724	X
50702	Degron-tagged Ig2D5	445	X
50707	Backbone 1H, 13C and 15N chemical shift assignments of the N-terminal Bro1 domain of human ALIX.	1508	X
50708	N-terminal acetylated FUS LC (1-163)	744	X
50709	RGG Mini	228	X
50710	RGG FUS	471	X
50711	1H, 13C, and 15N chemical shift assignments of the N-terminal fragment of PaaR2 regulator encoded on the cryptic prophage CP933-P in Escherichia coli O157:H7	744	X
50712	1H, 13C and 15N backbone resonance assignment of HIV-1 Gag(276-432) encompassing the C-terminal domain of the capsid protein, the spacer peptide 1 and the nucleocapsid protein	691	X
50713	Solution NMR backbone assignments of the N-terminal Zb domain from Homo Sapiens ADAR1p150.	417	X
50714	Solution NMR backbone assignments of the N-terminal Za domain from Homo Sapiens ADAR1p150.	368	X
50715	Solution NMR backbone assignments of the N-terminal Za-linker-Zb segment from Homo Sapiens ADAR1p150.	1065	X
50718	Monomeric phospholamban in oriented bicelles	22	X
50719	Monomeric phosphorylated phospholamban in oriented bicelles	22	X
50720	Phospholamban bound to SERCA in oriented bicelles (calcium-free E2 state)	10	X
50721	Phospholamban bound to SERCA in oriented bicelles (calcium-bound E1 state)	10	X
50722	Phosphorylated phospholamban bound to SERCA in oriented bicelles (calcium-free E2 state)	17	X
50723	Phosphorylated phospholamban bound to SERCA in oriented bicelles (calcium-bound E1 state)	12	X
50725	backbone assignments of SARS-CoV-2 Nsp9	332	X
50730	Backbone and heme resonance assignment of PpcAF6L mutant from G.metallireducens	153	X
50731	Backbone and heme resonance assignment of PpcAW45M mutant from G.metallireducens	151	X
50732	Backbone and heme resonance assignment of PpcAF6LW45M mutant from G.metallireducens	151	X
50733	NN206* (P22A and M85A; hereafter NN206*)	685	X
50734	NMR backbone resonance assignment of the selenoprotein SelW1 (oxidized) from Chlamydomonas reinhardtii.	1035	X
50735	Molecular insights into substrate recognition and discrimination by the N-terminal domain of Lon AAA+ protease	684	X
50736	Molecular insights into substrate recognition and discrimination by the N-terminal domain of Lon AAA+ protease	65	X
50737	Smad4 interdomain linker	447	X
50738	Smad2 interdomain linker	274	X
50739	Backbone 1H, 13C, and 15N Chemical Shift assignments for the +7K+12D mutant of hnRNPA1-LCD	590	X
50740	Backbone assignments of the N-terminal region of the partitioning protein IncC1 from the plasmid RK2	602	X
50741	Backbone 1H, 15N and 13C chemical shift assignments for HEV ORF1 peptide [1622-1647] (isolate G3-HEV83-2-27) in 20% TFE-d2	153	X
50742	1H,13C,15N backbone resonance assignment for 1-164 construct of XRCC4	861	X
50743	dmEB1N+linker	963	X
50744	Nanodisc reconstitution of flavin mononucleotide binding domain of cytochrome-p450-reductase enables high-resolution NMR probing	767	X
50745	NMR backbone resonance assignment of the selenoprotein SelW1 (reduced) from Chlamydomonas reinhardtii.	1084	X
50746	1H, 13C and 15N assignment of the flexible C-terminus of alpha-synuclein bound to lipid vesicles	186	X
50747	1H, 13C, 15N backbone NMR resonance assignments of Psb28 in complex with the C-terminal peptide of CP47	687	X
50749	Ligand-induced structural transition combined with paramagnetic ions facilitate unambiguous NMR assignments of methyl groups in crowded spectra	796	X
50750	1H, 13C and 15N chemical shift backbone resonance NMR assignment of Tobacco Calmoduline 2	752	X
50751	Resonance assignment of Decorin binding protein A from European species Borrelia afzelii	1507	X
50752	Backbone chemical shift assignments of PSD-95 N-terminal domain	515	X
50754	Backbone and side-chain resonance assignments of the A2 domain of mouse von Willebrand factor	845	X
50755	Titration of a C6 acyl mimetic loaded E. coli ACP with the E. coli Octanoyltransferase, LipB	284	X
50756	Titration of a C8 acyl mimetic loaded E. coli ACP with the E. coli Octanoyltransferase, LipB	288	X
50757	Titration of a C10 acyl mimetic loaded E. coli ACP with the E. coli Octanoyltransferase, LipB	288	X
50758	Backbone resonance assignment of C-terminal intracellular domain of Tir effector from Escherichia coli O127:H6	814	X
50759	Backbone resonance assignment of Phosphorylated C-terminal intracellular domain of Tir effector from Escherichia coli O127:H6	802	X
50760	1H, 13C,15N and 31P chemical shift assignment of the stem-loop 4 from the 5'-UTR of SARS-CoV-2	525			X
50761	ARNT PAS-B WT sequence, unfolded in 8M urea	560	X
50762	ARNT PAS-B F444Q/F446A/Y456T sequence unfolded in 8M urea	573	X
50763	ARNT PAS-B Y456T sequence unfolded in 8M urea	573	X
50765	Assignments of free human Tsg101 UEV domain	905	X
50766	Backbone resonance assignments of LINE-1 retrotransposable element ORF1 protein N-terminal region.	278	X
50767	S. aureus pepG1 NMR solution structure	269	X
50768	1H and 13C chemical-shift assignments of the isoleucine, leucine and valine methyl groups of Bombyx Mori Vasa	600	X
50769	1H and 15N chemical-shift assignments of the backbone amide groups of the RecA_N domain of Bombyx Mori Vasa	328	X
50770	1H and 15N chemical-shift assignments of the backbone amide groups of the RecA_C domain of Bombyx Mori Vasa	226	X
50771	The 1H, 15N, and 13C resonance assignments of the N-terminal domain of the nucleocapsid protein from the Middle East Respiratory Syndrome Coronavirus	1625	X
50772	The 1H, 15N, and 13C resonance assignments of the N-terminal domain of the nucleocapsid protein from the Middle East Respiratory Syndrome Coronavirus	1451	X
50773	Backbone 1H, 15N assignment of 15N-labeled oncogenic mutant human KRas4B-G12V(1-169) bound to GTP at physiological pH	234	X
50774	Full assignment of 13C,15N-labeled Mg2+-free oncogenic mutant human KRas4B-G12C(1-169) bound to GDP in open conformation at physiological pH	986	X
50776	Substrate sequence determinants governing the specificity of ClpS1 in plant chloroplasts	549	X
50777	Chemical Shift Assignments of OXA-24/40	1106	X
50778	Structure and topology of DWORF in bicelles by oriented solid-state NMR	28	X
50779	Structure and topology of DWORF-P15A in bicelles by oriented solid-state NMR	19	X
50780	Partial assignment of the dimeric SARS-CoV-2 Main Protease	1050	X
50781	Backbone 1H, 13C, and 15N chemical shift assignments for ClpX residues 1-55	217	X
50782	MqsA Residues 1-34	107	X
50783	NMR chemical shift assignments of a module of unknown function in cellulosomal secondary scaffoldin ScaF from Clostridium thermocellum	2856	X
50784	MqsA residues 1-76	271	X
50785	In Vitro Fibrillized 0N3R Tau	507	X
50786	N-terminal domain of human HSP90 alpha1 form	1221	X
50787	Backbone chemical shift assignments of saccharomyces cerevisiae Ess1 Prolyl-isomerase C120S	757	X
50789	1H, 13C and 15N chemical shift assignments of the C-terminal domain of human UDP-Glucuronosyltransferase 2B7 (UGT2B7)	1576	X
50790	Triple Resonance Assignments of Human D-Dopachrome Tautomerase (MIF2)	386	X
50793	ular mechanisms underlying the role of the centriolar CEP164-TTBK2 complex in ciliopathies	1299	X
50794	NMR assignment of the Feline Immunodeficiency Virus p24 capsid	856	X
50795	Backbone assignment for yeast Fip1 (1-226)	916	X
50796	Backbone assignment for yeast Yth1 zinc finger domain 4	159	X
50797	Backbone assignment for yeast Yth1 zinc finger domain 4, 5 and C-terminal residues	392	X
50798	GHR-TMD in DHPC micelles	188	X
50799	Backbone chemical shift assignment of the alpha-crystallin domain of the Small heat shock protein, IbpB from E. coli	248	X
50801	Backbone 1H, 13C, and 15N Chemical Shift Assignment for Brd3-BD1	554	X
50802	Backbone 1H, 13C, and 15N Chemical Shift Assignment for Brd3-BD1 bound to inhibitor PCC	462	X
50803	Chemical shift assignment of NDRG1-C, the C-terminal domain of NDRG1	884	X
50804	1H, 13C and 15N chemical shift assignments of RNA binding protein RBM3	934	X
50805	Histone H3 tail within tetrasome	134	X	X
50806	Histone H3 tail within nucleosome	130	X	X
50807	Histone H3 tail within hexasome	231	X	X
50808	Backbone and sidechain 1H, 13C, and 15N Chemical Shift assignments for nanobody Nb23	1330	X
50809	SARS-Cov-2 spike receptor binding domain	799	X
50811	NMR resonance assignment of the green kiwi fruit allergen Act d 8.0101	1798	X
50812	NMR resonance assignment of the golden kiwi fruit allergen Act c 8.0101	1793	X
50813	Interactions of SARS-CoV-2 envelope protein with amilorides correlate with antiviral activity	288	X
50814	1H, 13C and 15N Backbone Chemical Shift Assignments of the SH3 domain of the JNK-interacting protein 1	297	X
50815	1H, 13C and 15N Backbone Chemical Shift Assignments of the A541L SH3 variant of the JNK-interacting protein 1	234	X
50816	1H, 13C and 15N Backbone Chemical Shift Assignments of the V517A SH3 variant of the JNK-interacting protein 1	232	X
50817	1H, 13C and 15N Backbone Chemical Shift Assignments of the Y526A SH3 variant of the JNK-interacting protein 1	291	X
50818	1H, 13C and 15N Backbone Chemical Shift Assignments of the H493A SH3 variant of the JNK-interacting protein 1	228	X
50820	1H, 15N, 13C, backbone resonance assignment of the human apo Alkbh5, pH 6.0	1006	X
50821	1H, 15N, 13C, backbone resonance assignment of the Zn/aKG bound human Alkbh5, pH 6.0	1016	X
50824	Amide NH assignments of the S95C mutant of the armadillo designed protein YMA tagged with the diamagnetic PCS tag Lu-4R4S-DOTA-M8 and their corresponding PCSs upon tagging with the paramagnetic tag Tm-4R4S_DOTA-M8	214	X
50825	Amide NH assignments of the S53C mutant of the armadillo designed protein YMA tagged with the diamagnetic PCS tag Lu-4R4S-DOTA-M8 and their corresponding PCSs upon tagging with the paramagnetic tag Tm-4R4S_DOTA-M8	214	X
50826	Amide NH assignments of the S20C mutant of the armadillo designed protein YMA tagged with the diamagnetic PCS tag Lu-4R4S-DOTA-M8 and their corresponding PCSs upon tagging with the paramagnetic tag Tm-4R4S_DOTA-M8	214	X
50827	Amide NH assignments of the S221C mutant of the armadillo designed protein YM4A tagged with the diamagnetic PCS tag Lu-4R4S-DOTA-M8 and their corresponding PCSs upon tagging with the paramagnetic tag Tm-4R4S_DOTA-M8	443	X
50828	Amide NH assignments of the S137C mutant of the armadillo designed protein YM4A tagged with the diamagnetic PCS tag Lu-4R4S-DOTA-M8 and their corresponding PCSs upon tagging with the paramagnetic tag Tm-4R4S_DOTA-M8	443	X
50829	Amide NH assignments of the Q50C mutant of the armadillo designed protein YM4A tagged with the diamagnetic PCS tag Lu-4R4S-DOTA-M8 and their corresponding PCSs upon tagging with the paramagnetic tag Tm-4R4S_DOTA-M8	443	X
50830	N-terminal module of SMARCC1/BAF155	916	X
50831	1H, 15N, 13C, backbone resonance assignment of the 5'-GG(m6A)CT-3' bound human Alkbh5, pH 6.0	1803	X	X
50835	SARS-CoV-2 Nucleocapsid 1-209 35 C	579	X
50836	1H, 13C, and 15N resonance assignments of Magnesium bound Calmodulin	308	X
50837	1H, 13C, and 15N resonance assignments of Mg2+-Calmodulin bound to BP2 derived from the STRA6 vitamin A transporter	665	X
50839	NMR backbone resonance assignment of Japanese encephalitis virus capsid protein	512	X
50842	Solution structure of Miz-1 Zinc fingers 10 to 12	906	X
50845	Prefoldin Pyrococcus Horikoshii	1575	X
50846	Imino resonance assignment of murine Ox40 mRNA 3'UTR	68			X
50847	ZEBRA-responsive element 2 DNA	42		X
50848	methylated ZEBRA-responsive element 2 DNA	42		X
50849	1H, 13C, and 15N resonance assignments of Mg2+/Ca2+-Calmodulin bound to BP2 derived from the STRA6 vitamin A transporter	398	X
50850	1H, 13C, and 15N resonance assignments of Calmodulin bound to peptides derived from the STRA6 vitamin A transporter in the absence and presence of divalent metal ions	268	X
50851	1H, 13C, and 15N resonance assignments of Calmodulin bound to peptides derived from the STRA6 vitamin A transporter in the absence and presence of divalent metal ions	198	X
50852	Sequential backbone assignment of mature a-Synuclein fibrils prepared from a-helical intermediate species	342	X
50858	TIM91012	100	X
50859	Tim9	123	X
50860	Tim9 reduced	367	X
50861	Tim10	264	X
50862	Tim10	384	X
50863	Tim12	433	X
50864	Tim12	389	X
50865	Complex of the CBP TAZ1 domain and a CITED2-HIF-1alpha fusion peptide	682	X
50866	CITED2-HIF-1alpha fusion peptide	310	X
50867	Complex of the CBP TAZ1 domain and a CITED2-HIF-1alpha fusion peptide (L63A)	757	X
50868	SOCS2-SH2_GHRpY	265	X
50869	SOCS2-SH2_GHRpY_F3	279	X
50870	NUDT9 - ADPR complex	1209	X
50871	A peptide with high affinity for B-Cell lymphoma2(Bcl-2)	251	X
50872	Structural description of DNA target search by a disordered transcription factor	473	X
50873	Structural description of DNA target search by a disordered transcription factor	485	X	X
50880	CREB 285 to 315 apo	399	X
50886	Exenatide peptide	419	X
50887	Backbone Assignments of HNH Nuclease from G. stearothermophilus Cas9	415	X
50888	1H 15N 13C chemical shift assignment of the construct of human ataxin-3 including residues 182-291	581	X
50889	NMR backbone assignment of the mitochondrial membrane protein MPV17	764	X
50890	Backbone NMR assignments of the mitochondrial membrane protein MPV17 without cysteine residues	752	X
50891	NMR backbone chemical shift assignments of the mitochondrial membrane protein MPV17 labeled with MMTS in DPC micelles	593	X
50892	1H, 13C, and 15N resonance assignments of Calmodulin bound to BP1 derived from the STRA6 vitamin A transporter	455	X
50895	Chemical Shift Assignment of Human Alpha-Synuclein bound to SDS micelles	805	X
50896	Chemical Shift Assignment of SDS micelle-bound alpha-synuclein homogeneusly modified with CEL	813	X
50897	hDVL2 DEP (401-510)	616	X
50898	hDVL2 DEP domain (401-510) S418E mutant	624	X
50899	1HN, 13C, and 15N backbone resonance assignments of the dimerization and earmuff domains of SET/TAF-1B/I2PP2A (residues 23-225)	885	X
50900	A peptide with high affinity for murine double minute2	239	X
50901	SH3-PRR2 peptide complex	660	X
50902	NMR structure of the antimicrobial RiLK1 peptide in SDS micelles	96	X
50903	TCPTP residues 1-302	1024	X
50904	TCPTP residues 303-387	378	X
50905	TCPTP residues 303-387 RK variant	303	X
50906	Chemical shifts of human Dss1	341	X
50907	Rules for designing protein fold switches and their implications for the folding code	268	X
50908	human CSNAP	272	X
50909	Rules for designing protein fold switches and their implications for the folding code	258	X
50910	Rules for designing protein fold switches and their implications for the folding code	332	X
50912	Structure of the transmembrane domain of the CD28 dimer	451	X
50913	PTP1B 1-301 L204A	988	X
50914	Backbone (NH, CA, CB) chemical shifts of free ERH-2 from C.elegans	389	X
50915	WT nsp1	1850	X
50916	Backbone 1H, 13C and 15N chemical shift assignments of HIV-1 p6.	181	X
50917	The solution structure of human HEBP1	816	X
50918	Isoleucine d1 methyl assignments for Actin bound with Ca-ATP	96	X
50919	Assignment of MIL(ProS)V(ProS)A methyl group-labelled MNV P-domain	552	X
50920	1H, 13C, and 15N Chemical Shift Assignments of cAMP-Binding Domains A and B of the PKA Regulatory Subunit	1258	X
50921	Backbone resonance assignment of human HEBP2	798	X
50922	RNA91	137			X
50923	RNA90	141			X
50924	RNA89	144			X
50925	RNA75	138			X
50926	RNA74	143			X
50927	RNA73	143			X
50928	RNA24	150			X
50929	RNA23	145			X
50930	RNA21	150			X
50931	RNA8	147			X
50932	RNA7	140			X
50933	RNA5	137			X
50934	Assignment of HPr48, an N-terminal fragment of the disordered histidine phosphocarrier protein HPr	413	X
50936	DksA N88D	597	X
50938	Natural Teixobactin - Lipid II complex	113				X
50940	Drosophila melanogaster atypical Tm1 (aTm1) residues 1-213	656	X
50941	NMR assignments and secondary structure determination of the N-terminal domain of ribosome maturation factor M from Staphylococcus aureus	1100	X
50942	NMR backbone resonance assignment of the pro-apoptotic Bak in its apo state	676	X
50944	Backbone and nearly complete side-chain chemical shift assignments of the human Uncharacterized protein CXorf51A	1411	X
50945	Metallo-b-lactamase inhibitor phosphonamidate monoesters	1060	X
50946	Structure of Alpha-1-acid Glycoprotein bound to UCN-01 and complete backbone assignments and NMR	1198	X
50948	NEDD8_Q40E	138	X
50949	Backbone 1H, and 15N Chemical Shift Assignments for M82I SUMO1	170	X
50950	MoPrP(89-230)_G4	243	X
50951	MoPrP(89-230)_G2	274	X
50952	MoPrP(89-230)_U3G1	286	X
50953	The 1H, 15N and 13C resonance assignments of the C-terminal domain of Serpine mRNA binding protein 1 (SERBP1)	1457	X
50955	Backbone Chemical Shift Assignments of human glutathione peroxidase 4 (GPx4)	782	X
50956	Side chain 1H, 13C, 15N chemical shift assignments of lysine residues in delta+PHS/V66K staphylococcal nuclease selectively labeled with SAIL Lysine	231	X
50957	1H, 15 N, and 13 C resonance assignments of the SH3-like tandem domain of human KIN17 protein	1668	X
50959	Resonance assignment of Mg-bound CorA in DMPC	727	X
50960	The N-terminal region of human p53 (residues 1-312)	1231	X
50961	1H, 15N and 13C chemical shift assignments of the PYK2(728-839) polypeptide	1133	X
50962	Backbone 1H, 13C and 15N chemical shift assignment of C-terminal polybasic region of human Semaphorin 3A	471	X
50963	Backbone Resonance Assignment of PDI b'xa' Domain Construct	1081	X
50964	yRad6	549	X
50966	1H, 15N, 13C resonnance assigments and secondary structure of PulL, a component of the Klebsiella oxytoca type II secretion system	877	X
50968	KR-12	142	X
50969	SARS-CoV macro domain ADPr bound	743	X
50970	MERS-CoV macro domain free state	849	X
50971	MERS-CoV MD ADPr	851	X
50972	1H,13C, 15N chemical shift assignment of NTD MaSp1 from Triconephila clavipes	1552	X
50974	Average nucleotide chemical shifts of the free full-length RNA from MS2 bacteriophage	14			X
50976	Human obscurin Ig13	1008	X
50977	Human obscurin Ig12	918	X
50978	TC-KKA	174	X
50979	Helix19-6	219	X
50980	AMTC31-6	310	X
50981	AMTC26-4	247	X
50982	AMTC27-6	272	X
50983	AMTC24-5	232	X
50985	1H, 13C and 15N Chemical Shift Assignments of the R957C mutant from Arkadia (RNF111) E3 RING domain in solution	708	X
50986	Proton NMR chemical shifts of GGCCTG2	93		X
50987	Proton NMR chemical shifts of GGCCTG3	123		X
50988	Proton NMR chemical shifts of GGCCTG3-T2	101		X
50989	Proton NMR chemical shifts of GGCCTG4	158		X
50993	SARS-CoV macro domain in the free state	818	X
50994	Backbone 1H, 15N and 13C resonance assignments of a non-structural protein NS2B of Zika virus	640	X
50996	SDS-Micelle bound alpha-Synuclein	665	X
50997	Zinc finger	323	X
50998	Backbone assignment of human prolactin at pH 7.0 and 5.5	1150	X
51003	Role of active site loop dynamics in ligand release from E. coli dihydrofolate reductase	294	X
51004	Role of active site loop dynamics in ligand release from E. coli dihydrofolate reductase	258	X
51006	Assignment of the full length A6 mouse prion protein at 37degC pH 4	581	X
51007	Assignment of the full length Q216R mouse prion protein	577	X
51008	A novel in vitro Ab40 polymorph, which was used to study the PET agent flutemetamol binding to Ab40.	194	X
51009	A novel in vitro Ab40 polymorph, which was used to study the PET agent flutemetamol binding to Ab40.	225	X
51010	Sequential backbone resonance assignment of AT-rich interaction domain of BAF250b	1201	X
51011	1H, 15N, 13C resonance assignment of the N-terminal domain (1-285) of yeast Atg9	1612	X
51012	Backbone resonance assignments of KRAS Q61H mutant bound to GDP	1299	X
51013	Human Amylin HNa-PEGylated	320	X
51014	Human Amylin HNz-PEGylated	319	X
51015	Olduvai domain CON1 assignments at 25C	452	X
51016	Olduvai domain CON1 assignments at 5C	294	X
51018	Backbone 1H, 13C and 15N chemical shift assignments for the C-Terminal phosphorylated intrinsically disordered Gab1	340	X
51019	Backbone 1H, 13C and 15N chemical shift assignments for the C-Terminal non-phosphorylated intrinsically disordered Gab1	340	X
51020	1H, 13C and 15N NMR assignments of an engineered Methyl CpG binding domain (MBD) protein	800	X
51021	NMR resonance assignments of the monomer of RNase P protein from Thermotoga maritima	497	X
51022	Backbone assignments of truncated form of TagA from Thermoanaerobacter italicus	551	X
51023	FLN5 A3A3	192	X
51024	S64V-EmrE, drug free, pH 5.0	1051	X
51025	S64V-EmrE with harmane, pH 5.6	752	X
51026	S64V-EmrE with TPP, pH 5	1040	X
51027	E14Q-EmrE drug free, low pH	597	X
51028	FLN5 A3A3E6	194	X
51029	AMOTL1 178-384	814	X
51030	E14Q-EmrE with 16mM TPP, low pH	306	X
51031	E14Q-EmrE with harmane, low pH	306	X
51032	loxP spacer 10-mer	117		X
51033	Chemical shift assignments of ANAC046(172-338)	685	X
51034	WT Pin1 with pCDC25c ligand	1782	X
51035	loxP spacer 12-mer	81		X
51036	loxP spacer 16-mer	258		X
51037	loxP spacer 22-mer	33		X
51038	Hsp104_NTD	621	X
51039	1H, 13C, 15N Chemical Shift Assignments for ERD14 K-segment B	58	X
51040	Backbone 1H, 13C, and 15N Chemical Shift Assignments for ERD14 K-segment A	49	X
51041	Backbone 1H, 13C, and 15N Chemical Shift Assignments for ERD14 K segment C	58	X
51042	Backbone 1H, 13C, and 15N Chemical Shift Assignments for S100A4 C-terminal peptide	44	X
51043	WT Pin1 with 5x FFpSPR ligand	1711	X
51044	AILV methyl assignments of hpMR1 bound to Ac-6-FP, bB2m and TAPBPR	327	X
51045	AILV methyl assignments for beta 2 microglobulin bound to hpMR1 and Ac-6-FP	123	X
51046	AILV assignments of hpMR1 bound to bovien beta 2 microglobulin and Ac-6-FP	378	X
51047	lox4 spacer 16-mer	149		X
51048	Backbone chemical shift assignments for the post-fusion six-helix bundle (6HB) state of SARS-CoV-2 S2 protein	372	X
51050	Monomeric Cdk2 bound to roscovitine	673	X
51051	S. cerevisiae SERF	324	X
51052	Assignment of nsp3a-nucleoprotein complex of SARS-CoV-2	1071	X
51054	MS3494	1140	X
51055	Chemical shifts and relaxation data from DREB2A 243-276	206	X
51056	Chemical shifts and relaxation data from DREB2A with RCD1-RST	485	X
51057	RBM5 RRM1	353	X
51058	RBM5 RRM1-ZnF1-RRM2 (C191G)	372	X
51059	NMR assignments of the Fc fragment of human immunoglobulin G1 glycoprotein non-fucosylated, non-galactosylated (G0) glycoform	360	X
51061	mMLKL	546	X
51062	Backbone assignment of ATF4 transactivation domain	1079	X
51063	NaKd18 in 100 mM K+	526	X
51064	NaKd18 in 600 mM Na+	386	X
51065	Assignment of S100A8/S100A9 in Human Calprotectin in the Absence of Ca(II) Ions	565	X
51066	Assignment of S100A8/S100A9 in Human Calprotectin in complex with Ca(II) Ions	808	X
51067	FUS RGG1 (164-267)	340	X
51068	FUS RGG2 (372-422)	147	X
51069	FUS RGG3 (453-507)	241	X
51070	PRC1_DD	901	X
51071	NMR-driven structure of KRAS4B-G12D-GTP homodimer on a lipid bilayer nanodisc	150	X
51072	15N, 13C, and 1H resonance assignments of Jarastatin a disintegrin of Bothrops jararaca.	751	X
51073	The 1H, 15N, and 13C resonance assignments of the truncated Dengue Virus capsid protein with the deletion of the intrinsically disordered N-terminal region	516	X
51074	Backbone and Ile, Leu, Val methyl groups resonances assignment of Cov-Y domain of SARS-CoV-2 non-structural protein 3	1841	X
51075	FLN5 filamin domain side-chain chemical shift assignments	892	X
51076	Methyl side-chain chemical shift assignments for ribosomal protein bL12	56	X
51077	Backbone and side-chain resonance assignments of the harmonin homology domain 2 (HHD2) of human RTEL1	922	X
51078	Backbone and side-chain resonance assignments of the harmonin homology domain 1 (HHD1) of human RTEL1	906	X
51079	Structural effects of m6A modification of the Xist A repeat AUCG tetraloop and its recognition by YTHDC1	144			X
51080	Assignment of 1H, 13C, 15N backbone chemical shifts of SERBP1 149-400	977	X
51081	FOXO4 (aa 14-217)	790	X
51083	Backbone and Sidechain 1H, 13C, and 15N Chemical Shift Assignments for Domain 3 of Heligmosomoides polygyrus protein Transforming Growth Factor Beta Mimic 1 (TGM-1 D3)	1012	X
51084	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Domain 3 of Heligmosomoides polygyrus protein Transforming Growth Factor Beta Mimic 1 (TGM-1 D3) as bound to Transforming Growth Factor Beta Receptor 2 (TbRII)	378	X
51085	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Transforming Growth Factor Beta Receptor 2 (TbRII) as bound to Domain 3 of Heligmosomoides polygyrus protein Transforming Growth Factor Beta Mimic 1 (TGM-1 D3)	520	X
51086	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Transforming Growth Factor Beta Receptor 1 (TbRI) as bound to Domain 2 of Heligmosomoides polygyrus protein Transforming Growth Factor Beta Mimic 1 (TGM-1 D2)	343	X
51087	Backbone chemical shift assignment and dynamics of N-terminal domain of ClpB from Francisella tularensis type VI secretion system	676	X
51090	Sequence-specific 1H, 15N, and 13C chemical shift assignment of the acidic domain of the human oncoprotein MDMX	575	X
51091	1H, 13C, and 15N Chemical Shift Assignments for Perna viridis foot protein 5b	944	X
51092	Assignment of BRCA1-A complex subunit RAP80 35-124 C70S, 97-103 poly A linker	504	X
51093	Backbone 1H, 13C and 15N Chemical Shift Assignments of GB1_pSu9(1-69) construct	597	X
51094	NISTmAb-scFv	2163	X
51096	1H, 13C and 15N chemical shift assignments of the GYF cytoplasmic domain of the GltJ protein from Myxococcus xanthus	947	X
51097	Resonance assignments and Residual Dipolar Couplings for Human Beta-2 microglobulin (b2m)	539	X
51098	Backbone and methyl resonance assignments of beta-2 microglobulin in complex with HLA-B*44:05/EEFGRAFSF	548	X
51099	Methyl resonance assignments of beta-2 microglobulin in complex with HLA-B*44:05T73C/EEFGRC	108	X
51100	Methyl resonance assignments of beta-2 microglobulin in complex with HLA-B*44:05T73C/EEFGRC and tapasin	72	X
51101	Backbone assignments of the heavy and light chains from the HLA-A*02:01/b2m/ELAGIGILTV(MART-1) human MHC-I protein complex	1402	X
51102	TIA-1 prion-like domain, backbone chemical shifts	335	X
51104	1H, 13C and 15N chemical shift assignments of the ZnR and GYF cytoplasmic domains of the GltJ protein from Myxococcus xanthus	514	X
51105	Ybt Cy1 D391N	1421	X
51106	1H, 13C and 15N resonance assignments of the first BIR domain of cellular inhibitor of apoptosis protein 1	691	X
51107	1H,15N and 13C backbone chemical shift assignment of Spy29-124	447	X
51108	1H,15N and 13C backbone chemical shift assignment of Spy1-124	529	X
51109	1H,15N and 13C backbone chemical shift assignment of Spy29-124 in complex with Im7A3	426	X
51110	Backbone 1H, 15N Chemical Shift Assignments for RGL1-Ras-association domain	152	X
51111	The 1H, 15N, and 13C resonance assignments of the low-complexity domain from the oncogenic fusion protein EWS-FLI1	560	X
51112	The 1H, 15N, and 13C resonance assignments of the low-complexity domain from the oncogenic fusion protein EWS-FLI1	535	X
51113	The 1H, 15N, and 13C resonance assignments of the low-complexity domain from the oncogenic fusion protein EWS-FLI1	418	X
51114	The 1H, 15N, and 13C resonance assignments of the low-complexity domain from the oncogenic fusion protein EWS-FLI1	1523	X
51115	CASH_8	1072	X
51116	Backbone NMR resonance assignment of the disordered UBact protein from Nitrospira nitrosa	397	X
51117	Backbone resonance assignments and relaxation rates of the zinc finger domain of murine methionine amino peptidase 1	282	X
51118	Backbone resonance assignments of the zinc finger domain of murine methionine amino peptidase 1 in complex with ZNG peptide	280	X
51120	Single residue switches of aggregation in the N-terminal 'master controller' region of alpha-synuclein	665	X
51121	Single residue switches of aggregation in the N-terminal 'master controller' region of alpha-synuclein	635	X
51122	1H, 15N, 13C backbone assignment of ApoE3 NTD at pH 3.5 and 20C	1487	X
51123	1H, 15N, 13C backbone chemical shift assignment of ApoE4-NTD at pH 3.5 20C	1542	X
51124	Backbone 1H, 15N chemical shift assignments of human p53 1-94	127	X
51125	1H, 15N backbone assignment of human p53 TAD2 37-57	39	X
51126	Resonance assignment of the Shank1 PDZ domain	1182	X
51127	A functional SNP regulates E-cadherin expression by dynamically remodeling the 3D structure of a promoter-associated non-coding RNA transcript	1213			X
51128	1H, 13C, and 15N resonance assignment of mouse lipocalin-type prostaglandin D synthase/PGJ2 complex.	1353	X
51129	pre-miRNA-31 BottomA	178			X
51130	ASCC2 CUE domain interaction with monoubiquitin	100	X
51131	Resonance assignment of the isoleucine delta1 methyl groups for beta-arrestin 1 cysteine-less mutant	60	X
51132	1H, 15N and 13C sequence-specific backbone assignment of RRP1B PP1 binding domain	446	X
51133	Backbone 1H, 13C and 15N Chemical Shift Assignments for Stress Granule Key Component G3BP1 RRM domain	540	X
51134	pre-miRNA-31 BottomB	179			X
51135	Chemical shift assignments for D64Y mutant of holo Acyl Carrier Protein from Homo sapiens	1003	X
51137	Assignment of base 15N and 1H chemical shifts for <5_SL5C>	210			X
51138	Assignment of base 15N and 1H chemical shifts for <5_SL5B_GC>	772			X
51139	ASCC2 CUE domain interaction with K63-linked diubiquitin	100	X
51140	H3 tail in 193-bp nucleosome	290	X	X
51141	H3 tail in 145-bp nucleosome	422	X	X
51142	H3 tail in 145-bp nucleosome	83	X	X
51143	H3 tail in 193-bp nucleosome	86	X	X
51144	RNA modifications stabilize the tertiary structure of tRNAfMet by locally increasing conformational dynamics	66			X
51145	K63-linked diubiquitin with 15N-labeled proximal ubiquitin interacting with ASCC2 CUE domain	140	X
51146	K63-linked diubiquitin with 15N-labeled distal ubiquitin interacting with ASCC2 CUE domain	138	X
51147	Backbone NMR assignments of the human TRPV4 intrinsically disordered N-terminus	1010	X
51148	Bicelle-bound alpha-Synuclein	522	X
51149	DENV2 S135A NS3pro/NS2B chemical shifts	1579	X
51150	Apo Thioredoxin	395	X
51151	OmpR	645	X
51152	alpha-Synuclein at low pH and high Temperature	665	X
51154	Solution structure of paxillin LIM2/3	1529	X
51155	Unmodified siRNA	350				X
51156	Backbone NMR resonance assignments of the nucleotide binding domain of the Bacillus subtilis ABC multidrug transporter BmrA in the ADP-bound state	1199	X
51158	Modified siRNA	299				X
51159	Backbone chemical shift assignments of Horcolin	802	X
51160	CtRNHI	1443	X
51161	Backbone assignments of p65 DNA binding domain in complex with DNA.	268	X	X
51162	N88R CtRNHI	290	X
51163	R88N EcRNHI	316	X
51164	Assignment of tRNAIle from Escherichia coli	146			X
51165	Backbone assignment of Verona integron encoded metallo-beta-lactamase 2 (VIM-2)	2542	X
51166	Solid-state NMR assignments of tryptophan synthase of S. typhimurium	2147	X
51167	Chemical Shift Assignment of Methionine-Oxidized Alpha-Synuclein Bound to SDS Micelles	820	X
51169	Solution NMR resonance assignment of PD-L1	545	X
51170	1H, 13C, 15N assignment of cyclosporin L in chloroform	159				X
51171	Characterization of amyloidogenic conformations of monomeric transthyretin from ground-state and excited state NMR Chemical shifts	432	X
51172	Backbone NMR assignments of the chicken TRPV4 intrinsically disordered N-terminus	939	X
51173	Resonance assignment of STIM1 CC1 d296 R304 mutant	314	X
51175	NMR assignments for the C-terminal domain of human RIPK3	1003	X
51176	Backbone resonance chemical shift assignment of Apo FTO	1490	X
51177	Histone H2A and H2B tails within 112-bp hexasome	102	X	X
51178	Histone H2A and H2B tails within 112-bp DNA/pAID nucleosome	839	X	X
51179	Alpha X I domain NMR backbone assignment	848	X
51180	1H/13C/15N Assignments for the transmembrane domains of the potassium channel KcsA WT	391	X
51181	1H/13C/15N Assignments for the transmembrane domains of Kv-like E71V mutant of the potassium channel KcsA	538	X
51182	Human Amylin HNa and HNz PEGylated (Bis-PEGylated)	328	X
51183	Reduced Human Amylin HNz-PEGylated	187	X
51184	1H, 13C, and 15N backbone resonance assignments of a conserved putative cell wall binding domain from Enterococcus faecalis	969	X
51186	Backbone chemical shifts of PreS domain from hepatitis B virus envelope protein	748	X
51187	Backbone and sidechain NMR assignments of the J-domain of co-chaperone Sis1 in complex with EEVD peptide of HSP70	980	X
51188	Backbone and ILV side chain assignment of the catalytic domain of human deubiquitinating enzyme USP7	2140	X
51193	Backbone resonance assignments of transmembrane domain of SARS-CoV-2 spike protein	260	X
51197	1H, 15N Backbone Assignments of Rec3 from GeoCas9	567	X
51198	Tandem WW domains in WWOX: the multifaceted role of WW2	125	X
51200	WWOX-WW1WW2-PY3	121	X
51201	1H-15N HSQC spectrum of cGMP-bound human PKG CBD-B	250	X
51202	WWOX-WW1WW2-PY3PY3	109	X
51203	Backbone resonance assignment of budding yeast Centromeric H3 variant Cse4 N-terminus	376	X
51204	Musashi-1 C terminal deltaSeq1	471	X
51205	Musashi-1 C terminal deltaSeq1	524	X
51206	Musashi-1 C terminal deltaSeq1	427	X
51207	Musashi-1 C terminal deltaSeq1	562	X
51208	Musashi-2 C terminal	424	X
51209	Backbone and sidechain 1H, 15N and 13C resonance assignments of the free tandem zinc finger domain of the tristetraprolin family member from Selaginella moellendorffii	738	X
51210	Backbone and sidechain 1H, 15N and 13C resonance assignments of the RNA bound tandem zinc finger domain of the tristetraprolin family member from Selaginella moellendorffii	771	X		X
51211	13C/15N/1H chemical shift assignments for Human Cytomegalovirus Protease delta221	1490	X
51222	Calmodulin bound to the beta-subunit of the retinal cyclic nucleotide-gated cation channel	1285	X
51223	1H15N HSQC chemical shifts and Relaxation Parameters for Y99C MIF Homotrimers	188	X
51224	1H15N HSQC chemical shifts and Relaxation Parameters for Y99C MIF Mixed Trimers	190	X
51226	Backbone and side-chain chemical shift assignment of mycobacterial antitoxin MazE6 from MazEF6 TA system.	702	X
51227	Backbone and side-chain chemical shift assignment of N-terminal domain (nMazE6) of mycobacterial antitoxin MazE6 from MazEF6 TA system	508	X
51228	Sidechain chemical shift assignments of fully protonated SH3 of chicken alpha-spectrin through 5D and 4D experiments	563	X
51229	The N-terminal domain of RNAse Y is organized as a coiled-coil domain, which displays two different conformations, one of them binding enolase.	762	X
51230	CI2 backbone and methyl assignment	511	X
51231	1H, 13C, and 15N Chemical Shift Assignments for amyloidogenic PAP(85-120) peptide	387	X
51232	Geobacillus stearothermophilus Adenylate Kinase with Zinc	745	X
51233	Geobacillus stearothermophilus Adenylate Kinase with Cobalt	685	X
51234	CI2 I57V backbone and methyl assignment	374	X
51235	CI2 L49I backbone and methyl assignment	374	X
51236	CI2 L49I/I57V backbone and methyl assignment	369	X
51237	Resonance assignments of a phsophomimetic of the C-terminal domain of the P protein of the Nishigahara strain of rabies virus	673	X
51238	1H and 15N Chemical Shift Assignments for T1 RNA	24			X
51239	Backbone resonance assignments of the designed Armadillo repeat protein N(YIII)MC(AII) at pH 7.0	631	X
51240	Backbone resonance assignments of the designed Armadillo repeat protein N(A4)MC(AII) at pH 5.5	559	X
51241	1H and 15N Chemical Shift Assignments for T1-GAAA RNA	24			X
51242	1H and 15N Chemical Shift Assignments for T1-UUCG RNA	24			X
51243	1H and 15N Chemical Shift Assignments for T1-delAU RNA	22			X
51244	1H and 15N Chemical Shift Assignments for T1-add1bp RNA	28			X
51245	1H and 15N Chemical Shift Assignments for T1-add2bp RNA	26			X
51246	1H and 15N Chemical Shift Assignments for T2-mirror RNA	22			X
51247	1H and 15N Chemical Shift Assignments for T2 RNA	24			X
51248	1H and 15N Chemical Shift Assignments for T3 RNA	16			X
51249	1H and 15N Chemical Shift Assignments for T4 RNA	26			X
51253	Solution NMR backbone chemical shift assignment for the La Module of human La-related protein 7	863	X
51254	Solution NMR backbone chemical shift assignment for the extended xRRM2 domain of human La-related protein 7	924	X
51255	Larp1	416	X
51256	Inter-domain flexibility of human SRSF1 tandem RRMs allows flexibility in RNA binding	813	X		X
51257	Denatured State Backbone Assignments for UBA(1) from HHR23A in Guanidine Hydrochloride Solutions	764	X
51258	Backbone and sidechain assignments of Actophorin protein from Entamoeba histolytica	794	X
51259	Islet amyloid polypeptide (amylin) in solution pH 6.5 10degC	171	X
51260	Denatured State Backbone Assignments for Helix 1 from HHR23A Ubiquitin-Associated Domain 1 in Guanidine Hydrochloride Solutions	336	X
51262	histone H3 H4 N-tail in nucleosome	219	X
51264	solution structure of conotoxin vt1.27	105	X
51265	solution structure of conotoxin mr1.7	102	X
51268	Backbone chemical shift assignment of the SARS-CoV-2 receptor binding domain	998	X
51269	Chemical shift assignment of WT myristoylated Hisactophilin at pH 6.2	188	X
51270	Chemical shift assignment of WT myristoylated Hisactophilin at pH 7.7	184	X
51271	Chemical shift assignment of WT non-myristoylated Hisactophilin at pH 7.7	148	X
51272	Chemical shift assignment of I85L myristoylated Hisactophilin at pH 7.7	150	X
51273	Chemical shift assignment of I85L non-myristoylated Hisactophilin at pH 7.7	144	X
51274	Chemical shift assignment of LLLL myristoylated Hisactophilin at pH 7.7	178	X
51275	Chemical shift assignment of LLL non-myristoylated Hisactophilin at pH 7.7	190	X
51276	Chemical shift assignment of LLL non-myristoylated Hisactophilin at pH 6.2	194	X
51277	Chemical shift assignment of LLL myristoylated Hisactophilin at pH 6.2	184	X
51278	Chemical shift assignment of I85L non-myristoylated Hisactophilin at pH 6.2	142	X
51279	Chemical shift assignment of I85L myristoylated Hisactophilin at pH 6.2	150	X
51280	Chemical shift assignment of WT non-myristoylated Hisactophilin at pH 6.2	172	X
51281	Salp15 NMR backbone assignment	491	X
51282	NMR Backbone Assignment of Nup358-Min	413	X
51283	Backbone 1H, 13C, and 15N Chemical Shift Assignments for vRAGE(23-125)	312	X
51284	Solid state NMR chemical shift assignment of the non-structural single-stranded DNA binding protein gVp from fd bacteriophage	443	X
51285	Solid-state NMR study reveals that seeding can lead to in-vivo like fibrils for AA amyloidosis	175	X
51286	CLAMP-interacting disordered region of male-specific lethal protein 2 (Msl2)	288	X
51287	S. cerevisiae SERF sidechain	359	X
51288	Resonance assignment of the enzyme KdgF from Bacteroides eggerthii	1087	X
51289	Calmodulin	1594	X
51290	Amide NH assignments of the S221C mutant of the armadillo designed protein A4M4A tagged with the diamagnetic PCS tag Lu-4R4S-DOTA-M7 and their corresponding PCSs upon tagging with the paramagnetic tag Tm-4R4S_DOTA-M7	439	X
51291	Amide NH assignments of the Q92C mutant of the armadillo designed protein A4M4A tagged with the diamagnetic PCS tag Lu-4R4S-DOTA-M7 and their corresponding PCSs upon tagging with the paramagnetic tag Tm-4R4S_DOTA-M7	435	X
51292	Amide NH assignments of the E15C mutant of the armadillo designed protein A4M4A tagged with the diamagnetic PCS tag Lu-4R4S-DOTA-M7 and their corresponding PCSs upon tagging with the paramagnetic tag Tm-4R4S_DOTA-M7	443	X
51293	1H, 15N, and 13C Chemical Shift Backbone Resonance NMR Assignment of Accumulation-Associated Protein (Aap) Lectin Domain from Staphylococcus epidermidis	1009	X
51294	Backbone assignment of Hepatitis B virus core protein Cp149 dimer by solution NMR at pH 7.5	382	X
51296	1H, 15N & 13C resonance assignment of the periplasmic domain of OutG, major pseudopilin from Dickeya dadantii type 2 secretion system	1292	X
51297	Xylcm8	3565	X
51299	SRSF1 Unphosphorylated	963	X
51301	Backbone and side chain resonance assignment of the intrinsically disordered human DBNDD1 protein	1741	X
51303	Backbone assignment for mature tardigrade HeLEA protein	1099	X
51304	Backbone assignment for human Cdc20 (1-73)	344	X
51305	1H15N HSQC Chemical Shifts and Relaxation Parameters for Reduced WT MIF	176	X
51306	1H15N HSQC Chemical Shifts and Relaxation Parameters for Neutral WT MIF	190	X
51307	1H15N HSQC Chemical Shifts and Relaxation Parameters for Oxidized WT MIF	190	X
51308	1H15N HSQC Chemical Shifts for K66A MIF	180	X
51309	1H15N HSQC Chemical Shifts for C80A MIF	114	X
51310	Encoded Conformational Dynamics of the HIV Splice Site A3 Regulatory Locus: Implications for differential binding of hnRNP Splicing Auxiliary Factors	137			X
51311	Assigned backbone amide and methyl chemical shifts for human Sox2 HMG domain	226	X
51312	Assigned backbone amide and methyl chemical shifts for human Sox2 HMG domain bound to DNA containing the Fgf4 motif	258	X	X
51313	Assigned backbone amide and methyl chemical shifts for human Sox2 HMG domain Y72A mutant bound to DNA containing the Fgf4 motif	252	X	X
51314	human FUS 454-526	250	X
51315	human methylated FUS 454-526	254	X
51316	b2-adrenergic receptor C-terminal domain	360	X
51317	C-terminal domain of the Growth Hormone Secretagogue Receptor type 1a	141	X
51318	C-terminal domain of the Vasopressin V2 receptor	138	X
51319	phosphomimetic variant of the C-terminal domain of the b2-adrenergic receptor	360	X
51320	Backbone and sidechain 1H, 13C, 15N chemical shift assignments for the isolated human HtrA2-PDZ domain	1246	X
51321	Sequence-specific Backbone Resonance Assignments of Human Amyloid-beta(1-42) in 28% Acetonitrile at pH 2.0	245	X
51322	Sequence-specific Backbone Resonance Assignments of Human Amyloid-beta(1-42) at pH 7.0	221	X
51323	Sequence-specific Backbone Resonance Assignments of Human Amyloid-beta(1-42) at pH 2.0	321	X
51324	NMR Parameters of the Reduced, Unfolded Short Isoform of Hypogastrura harveyi "snow flea" Antifreeze Protein	813	X
51325	N-terminal domain of SARS-CoV-2 Nsp8 protein	920	X
51326	PBRM1 Bromodomain 2	532	X
51327	Backbone 1H, 13C and 15N chemical shift assignments for the N-terminal SH3 domain of Drk	570	X
51328	phosphomimetic variant of the C-terminal domain of the ghrelin receptor type 1a	150	X
51329	PBRM1 Bromodomain 4	540	X
51330	phosphomimetic variant of the C-terminal domain of the vasopressin V2 receptor	147	X
51331	Solid-state NMR 13C and 15N resonance assignment of Vibrio sp. SemiSWEET transporter in lipid bilayers	425	X
51332	Structural insights into the mechanism of p53 regulation by MDM2 acidic domain	966	X
51333	Structural insights into the mechanism of p53 regulation by MDM2 acidic domain	948	X
51334	MDM2AD	409	X
51335	MDM2 AD in complex with p53 DBD	311	X
51336	Backbone assignment of human PEX13 C-terminal region	625	X
51337	5caC-containing dsDNA 12mers at three pH conditions	297		X
51338	Chemical shift assignment of Sa1_V90T at 5 degrees Celsius	465	X
51339	Chemical shift assignment of Sa1_V90T at 30 degrees Celsius	462	X
51340	Backbone and side chain solution NMR assignment of truncated form of small hepatitis D virus antigen Delta60-S-HDAg	1491	X
51341	NMR Assignment of Backbone (1H, 15N, and 13C) resonances of Histone Like DNA binding protein of Helicobacter pylori (Hup-P64A) variant	424	X
51342	SH2 domain from mouse SH2B1	1524	X
51343	TrkA_eJTM_TMD_wt	277	X
51344	TrkA-eJTM-TMD-5PG	286	X
51345	TrkA-eJTM-TMD-K410C	757	X
51347	Backbone assignments for Indole-3-glycerol phosphate synthase hyper-thermophilic homolog from Sulfolobus solfataricus R43S mutant (SsIGPS.R43S)	1103	X
51348	NPSL2_Frag1	252			X
51349	NPSL2_Frag2	199			X
51350	NPSL2	270			X
51351	1H, 13C and 15N resonance assignments of TSR3 domain of human Thrombospondin-1	776	X
51352	1H,13C,15N backbone assignment of the human interleukin-1 receptor antagonist C66A/C122A	684	X
51353	Backbone NMR assignment of the human TRPV1 ion channel N-terminal intrinsically disordered region	683	X
51354	Backbone NMR assignment of the human TRPV2 ion channel N-terminal intrinsically disordered region	501	X
51355	Backbone and side-chain NMR assignment of the human TRPV3 ion channel N-terminal intrinsically disordered region	1177	X
51356	1H, 13C and 15N resonance assignments of fucosylated TSR3 domain of human Thrombospondin-1	775	X
51357	1H, 13C and 15N resonance assignments of TbBDF5-bromo1 domain from Trypanosoma brucei	863	X
51358	1H, 13C and 15N resonance assignments of diglycosylated TSR3 domain of human Thrombospondin-1	633	X
51359	Backbone resonance assignments of the N-terminal domain of Sam68	191	X
51360	Backbone resonance assignments of the C-terminal domain of Sam68	207	X
51361	1H, 13C and 15N Backbone Chemical Shift Assignments of the SH3 domain of the JNK-interacting protein 2, conformations corresponding to proline 664 cis-trans isomerization	570	X
51362	Structural basis for tRNA recognition and regulation of METTL1-WDR4 methyltransferase	313	X
51363	15N-1H chemical shifts for the unphosphorylated murine Syk tandem SH2 domains (Ser 8 to Gln 264)	302	X
51364	TrkB-TM dimer	578	X
51365	15N-1H chemical shifts for the unphosphorylated murine Syk tandem SH2 domains (Ser 8 to Gln 264) complexed with ITP peptide	234	X
51366	15N-1H chemical shifts for the unphosphorylated murine Syk tandem SH2 domains (Ser 8 to Gln 264) complexed with N-IHP peptide	250	X
51367	15N-1H chemical shifts for the unphosphorylated murine Syk tandem SH2 domains (Ser 8 to Gln 264) complexed with C-IHP peptide	262	X
51368	15N-1H chemical shifts for the murine Syk tandem SH2 domains phosphorylation mimic construct (tSH2-PM, Ser 8 to Gln 264 with Y130E)	332	X
51369	15N-1H chemical shifts for the murine Syk tandem SH2 domains phosphorylation mimic construct (tSH2-PM, Ser 8 to Gln 264 with Y130E) complexed with ITP peptide	226	X
51370	15N-1H chemical shifts for the murine Syk tandem SH2 domains phosphorylation mimic construct (tSH2-PM, Ser 8 to Gln 264 with Y130E) complexed with N-IHP peptide	284	X
51371	15N-1H chemical shifts for the murine Syk tandem SH2 domains phosphorylation mimic construct (tSH2-PM, Ser 8 to Gln 264 with Y130E) complexed with C-IHP peptide	292	X
51372	15N-1H chemical shifts for the murine Syk tandem SH2 domains flexible linker construct [tSH2-FX, Ser 8 to Gln 264 with interdomain residues 119-162 replaced by a 20-amino-acid flexible linker (GGS)3GS(GGS)3]	286	X
51373	15N-1H chemical shifts for the murine Syk tandem SH2 domains flexible linker construct [tSH2-FX, Ser 8 to Gln 264 with interdomain residues 119-162 replaced by a 20-amino-acid flexible linker (GGS)3GS(GGS)3] complexed with ITP peptide	248	X
51374	15N-1H chemical shifts for the murine Syk tandem SH2 domains flexible linker construct [tSH2-FX, Ser 8 to Gln 264 with interdomain residues 119-162 replaced by a 20-amino-acid flexible linker (GGS)3GS(GGS)3] complexed with N-IHP peptide	242	X
51375	15N-1H chemical shifts for the murine Syk tandem SH2 domains flexible linker construct [tSH2-FX, Ser 8 to Gln 264 with interdomain residues 119-162 replaced by a 20-amino-acid flexible linker (GGS)3GS(GGS)3] complexed with C-IHP peptide	260	X
51376	Backbone chemical shifts of Spd1	550	X
51377	Backbone and side-chain chemical shift assignments for a rosetta-designed BDBV-MPER immunogen	852	X
51378	N-terminal domain of human HSP90 alpha1 form in complex with 5-[4-(2-Fluoro-phenyl)-5-oxo-4,5-dihydro-1H-[1,2,4]triazol-3-yl]-N-furan-2-ylmethyl-2,4-dihydroxy-N-methyl-benzamide	1333	X
51379	1H, 13C, and 15N resonance assignments of human glutathione peroxidase 4	2109	X
51380	1H, 13C and 15N Backbone Chemical Shift Assignments of GTP-bound Rab3a	824	X
51381	Backbone Chemical Shift Assignments of the S. cerevisiae Tom22(1-74)	324	X
51382	Backbone assignment of the Sec14 domain of the RhoGEF Kalirin	755	X
51384	SH3-DNAse1L3-CTD	458	X
51388	1H and 13C chemical shifts for a peptide encompassing residues 2-19 of the human formin INF2 in 30% TFE	199	X
51389	1H and 13C chemical shifts for a peptide encompassing residues 2-19 of the human formin INF2 in aqueous solution	393	X
51390	HN-S CTD	387	X
51391	NMR Evidence for the Conformational Change of Phage Protein gVp Upon Binding to ssDNA	497	X
51392	drosophila pAbp RRM2	282	X
51393	drosophila pAbp RRM3	339	X
51394	drosophila pAbp RRM4	301	X
51395	drosophila pAbp PABC	292	X
51396	Mouse complexin-1 C-terminal domain chemical shift information	298	X
51397	Mouse complexin-1 C-terminal domain + DPC micelles chemical shift information	285	X
51398	PARP14 macro domain 2 free form	2085	X
51399	PARP14 macro domain 2 ADPr bound	2017	X
51400	1H, 13C, and 15N Chemical Shift Assignments for amyloidogenic SEM1(68-85) peptide	173	X
51401	SNAC-mEpoR-TM	389	X
51402	Bacillus subtilis SepF protein assembly (wild type)	389	X
51403	Backbone chemical shifts of VN NS1 W182A effector domain	951	X
51404	Backbone chemical shifts of PR8 NS1 W187A effector domain	965	X
51405	NMR resonance assignments of the DNA binding domain of mouse Junctophilin-2	1054	X
51406	1H, 13C, and 15N Chemical Shift Assignments for amyloidogenic SEM1(68-107) peptide	230	X
51407	1H and 13C chemical shifts for a peptide encompassing residues 2-36 of the human formin INF2 in aqueous solution	351	X
51408	1H and 13C chemical shifts for a peptide encompassing residues 2-36 of the human formin INF2 in 30% TFE	347	X
51410	Bicelle-bound conformation of HIV-1 gp41 ectodomain	271	X
51411	1H, 13C and 15N backbone chemical Shift assignments of the extracellular region of human PD-L1 (residues 19-239)	845	X
51412	1H, 13C and 15N Backbone Chemical Shift Assignments of the N-terminal IgV-like domain of human PD-L1 (residues 19-134)	516	X
51413	Bromodomain Interactions with Acetylated Histone 4 Peptides in the Tandem Domain BRD4 -- Effects on Domain Dynamics and Internal Flexibility	382	X
51414	Bromodomain Interactions with Acetylated Histone 4 Peptides in the Tandem Domain BRD4 -- Effects on Domain Dynamics and Internal Flexibility	206	X
51415	Bromodomain Interactions with Acetylated Histone 4 Peptides in the Tandem Domain BRD4 -- Effects on Domain Dynamics and Internal Flexibility	210	X
51416	Bromodomain Interactions with Acetylated Histone 4 Peptides in the Tandem Domain BRD4 -- Effects on Domain Dynamics and Internal Flexibility	222	X
51417	Bromodomain Interactions with Acetylated Histone 4 Peptides in the Tandem Domain BRD4 -- Effects on Domain Dynamics and Internal Flexibility	208	X
51418	Bromodomain Interactions with Acetylated Histone 4 Peptides in the Tandem Domain BRD4 -- Effects on Domain Dynamics and Internal Flexibility	552	X
51419	Backbone chemical shift assignments of R86A mutant of the Akt1 PH domain	561	X
51420	Backbone 1H, 13C, and 15N Chemical Shift Assignments for EZH2 loop at 310K and 278K	1144	X
51421	Backbone 1H, 13C, and 15N Chemical Shift Assignments for T345D mutant of EZH2 loop	635	X
51422	1H, 13C and 15N backbone chemical shifts for human calmodulin in aqueous solution	721	X
51423	Backbone resonance assignments and relaxation rates for the apo form of the solute binding domain of the ergothioneine transporter EgtU	1322	X
51424	Backbone resonance assignments and relaxation rates for the ergothioneine-bound form of the solute binding domain of the ergothioneine transporter EgtU	1317	X
51427	B-Myb association with DNA is mediated by its negative regulatory domain and Cdk phosphorylation	416	X
51428	Variant 5 isolated CTD	307	X
51429	Full-length Variant 5 (CTD only)	218	X
51430	ILV Methyl NMR Resonance Assignments of the 81 kDa E. coli b-clamp T45R/S107R	636	X
51431	ILV Methyl NMR Resonance Assignments of the 81 kDa E. coli b-clamp	636	X
51432	Bcl-xl-delC UV exposed assigned chemical shifts used for TALOS calculation	162	X
51433	Variant 8 CTD	271	X
51434	ILV methyl chemical shift assignments for apo COQ8A-Ndel250	264	X
51435	ILV chemical shift assignments for COQ8A in the presence of 1 mM 2-propylphenol	248	X
51436	ILV methyl chemical shift assignments for COQ8A in the presence of 1 mM 2-propylphenol and 1 mM Triton X-100	236	X
51437	Backbone assignment of S. pombe PCNA	1162	X
51438	Deuterated chemical shifts of TcART	874	X
51439	1H, 13C,15N assignment of human CISD3 mitochondrial protein	285	X
51440	Identification and characterization of an RRM-containing, RNA binding protein in Acinetobacter Baumannii	388	X
51441	Solution NMR backbone chemical shift assignment for Tetrahymena Ctc1 OB-A domain	328	X
51442	Solution NMR backbone chemical shift assignment for Tetrahymena Ctc1 OB-A and p50 peptide	429	X
51443	Solution NMR backbone chemical shift assignment for Tetrahymena p50 peptide	79	X
51444	Isoleucine d1-methyl chemical shift assignments for FhaC in lipid nanodiscs	60	X
51445	Chemical shift assignments for alanine and valine methyls of Robo1-Ig1-2-LnLoop	116	X
51447	Calmodulin bound to the C-terminal calmodulin-binding site of the beta-subunit of the retinal cyclic nucleotide-gated cation channel	1450	X
51448	HigA2	468	X
51449	Backbone chemical shifts of DNA binding domain of Cytidine Repressor	367	X
51451	1H, 13C Chemical Shift Assignments for 13C Methionine Labeled ACKR3 in complex with CXCL12	28	X
51452	1H, 13C Chemical Shift Assignments for 13C Methionine Labeled ACKR3 in complex with VUN701	20	X
51453	1H, 13C Chemical Shift Assignments for 13C Methionine Labeled ACKR3 in complex with LIH383	16	X
51454	1H, 13C Chemical Shift Assignments for 13C Methionine Labeled ACKR3 in complex with CCX777	20	X
51455	Near complete backbone assignment of a C145A variant of the main protease from SARS-CoV-2	2828	X
51456	Near complete backbone assignment of a C145A variant of the main protease from SARS-CoV-2 complexed with native N-terminal substrate SAVLQSGFRK	1347	X
51457	Backbone 1H, 13C and 15N chemical shift assignments of cysteine mutated ubiquitin (UbK6C)	215	X
51458	Backbone 1H, 13C and 15N chemical shift assignments of cysteine mutated ubiquitin (UbK29C)	215	X
51459	Backbone 1H, 13C and 15N chemical shift assignments of cysteine mutated ubiquitin (UbK33C)	215	X
51460	Backbone 1H, 13C and 15N chemical shift assignments of cysteine mutated ubiquitin site-specifically modifed with propargyl acrylate (UbK6C-PA)	215	X
51461	Backbone 1H, 13C and 15N chemical shift assignments of cysteine mutated ubiquitin site-specifically modifed with propargyl acrylate (UbK29C-PA)	215	X
51462	Backbone 1H, 13C and 15N chemical shift assignments of cysteine mutated ubiquitin site-specifically modifed with propargyl acrylate (UbK33C-PA)	215	X
51463	Backbone 1H, 13C and 15N chemical shift assignments of ubiquitin C-terminally functionalized with an azide group (UbG75Aha)	226	X
51464	Backbone 1H, 13C and 15N chemical shift assignments of the proximal domain of a K6-linked ubiquitin dimer (K6-linked diUb) comprising an artificial triazole linkage	215	X
51465	Backbone 1H, 13C and 15N chemical shift assignments of the proximal domain of a K29-linked ubiquitin dimer (K29-linked diUb) comprising an artificial triazole linkage	215	X
51466	Backbone 1H, 13C and 15N chemical shift assignments of the proximal domain of a K33-linked ubiquitin dimer (K33-linked diUb) comprising an artificial triazole linkage	215	X
51467	Backbone 1H, 13C and 15N chemical shift assignments of the distal domain of a K6-linked ubiquitin dimer (K6-linked diUb) comprising an artificial triazole linkage	226	X
51468	Backbone 1H, 13C and 15N chemical shift assignments of the distal domain of a K29-linked ubiquitin dimer (K29-linked diUb) comprising an artificial triazole linkage	226	X
51469	Backbone 1H, 13C and 15N chemical shift assignments of the distal domain of a K33-linked ubiquitin dimer (K33-linked diUb) comprising an artificial triazole linkage	226	X
51470	apo macro domain of Hepatitis E virus	1601	X
51471	ADPr bound macro domain of Hepatitis E virus	1638	X
51472	Backbone amide chemical shifts for PBRM1-BD2	212	X
51473	IL1R8	619	X
51474	tirE Coiled Coil	540	X
51475	53BP1 1140-1225	353	X
51476	Androgen Receptor C-terminal NTD	431	X
51478	Relaxation peaklist data of TcART	348	X
51479	Androgen Receptor AF1star	1403	X
51480	Androgen Receptor NTD	1707	X
51481	Chemical Shift Assignments of CT-IC 216-260	524	X
51483	Solid-state NMR assignment of fibrils formed by tau(297-391)	196	X
51485	Chemical shift assignments of the C-terminal domain of AKAP5 (AKAP79), residues 300-427	250	X
51486	Assignment of SAM1-SASH1 domain	306	X
51487	Chemical Shift Assignments RECQ4(322-400)	808	X
51488	Backbone assignment of the LCC PETase	1055	X
51489	NMR assignment of the mCherry protein	1006	X
51490	UNC-89 SH3 domain (residues 61-128)	322	X
51491	MEC-2 C-terminal disordered region (residues 372-481)	352	X
51492	NTD TDP-43 with 3% SB3-10	648	X
51494	Backbone 1H, 13C, and 15N Chemical Shift Assignments for TDP-43 low complexity domain with methionine sulfoxide modifications	944	X
51495	Backbone and side chain NMR assignment of the heme-nitric oxide/oxygen binding (H-NOX) domain from Nostoc punctiforme	1815	X
51496	1H, 13C and 15N Backbone Chemical Shift Assignments of the R502E SH3 variant of the JNK-interacting protein 1	293	X
51497	Nervy homology 2 domain (NHR2) from AML-ETO	105	X
51500	Miro2 N-terminal GTPase domain bound to GTP	981	X
51502	1H, 13C, and 15N chemical shift assignments of MqsR in complex with its canonical antitoxin MqsA (Residues 1-76)	264	X
51503	1H, 13C, and 15N chemical shift assignments of MqsR	355	X
51504	Assignment of 1-44 residues of nucleocapsid protein of SARS-CoV-2	209	X
51505	Backbone 1H, 13C and 15N Assignments of MAX(1-21)	135	X
51506	Solid-state NMR 1H-13C-15N assignment of African cichlid nackednavirus capsid protein	723	X
51507	Human PPARg2 AF-1 domain	741	X
51508	Backbone 1H, 13C, and 15N Chemical Shift Assignments for ASCb	663	X
51509	Backbone 1H, 13C, and 15N Chemical Shift Assignments for engineered protein ASC3X	663	X
51510	NMR and biochemical characterization of the interaction between FGFR1 juxtamembrane domain and phospholipids	265	X
51512	Backbone 1H, 13C, and 15N chemical shift assignments for the chromoshadow domain (residue 112-176) of human heterochromatin protein 1a (HP1a).	250	X
51513	Backbone 1H, 13C and 15N chemical shift assignments, experimental 3JHN-HA scalar couplings, and 15N-relaxation rates of the C-terminal portion of human CHMP4B (residues 121-224)	801	X
51514	Backbone 1H, 13C and 15N chemical shift assignments, experimental 3JHN-HA scalar couplings, and 15N-relaxation rates of the C-terminal portion of human CHMP4C (residues 121-233)	909	X
51515	Partial assignment of SARS-COV-2 main protease R298A mutant	606	X
51516	1H, 13C, 15N NMR assignment of Engrailed2 homeodomain in anionic bicelles	480	X
51517	hnRNP A18	1179	X
51518	CaBP1 C-Lobe Bound to CaV1.2 IQ-motif	443	X
51519	lambda bacteriophage protein Orf63	490	X
51520	bacteriophage lambda Ea22 C-terminal domain	794	X
51521	Backbone and side chain NMR assignments for the ribosome maturation factor P (RimP) from Staphylococcus aureus	1209	X
51522	Region of Trak2 that interacts with Miro2 N-terminal GTPase	897	X
51523	Backbone assignments of BARD1 Ser-141-216	397	X
51524	BARD1 Ser-141-216: complex with dsDNA	271	X	X
51525	BARD1 Ser-141-216: complex with bubDNA	96	X	X
51526	Backbone chemical shifts of calcium-loaded human calmodulin at pH 7 and 37degC	559	X
51527	Calcium-loaded human calmodulin in complex with the antagonist calmidazolium	480	X
51528	1H and 13C chemical shifts of a peptide derived from the membrane proximal external region of HIV-1 gp41 in DPC micelles	287	X
51531	1H and 13C chemical shifts of a peptide derived from the membrane proximal external region of HIV-1 gp41 in 25% HFIP	613	X
51532	NMR structure of DNAJA1 amino acids 1-107	1096	X
51533	Sequential NMR assignment of human protein DPCD	754	X
51534	Sox2-Nterminal(aa1-42)	189	X
51535	Backbone assignment for Functional Amyloid in pseudomonas FapA	316	X
51536	1H and 13C chemical shifts for retroenantio crotalicidin in DPC micelles	752	X
51537	1H and 13C chemical shifts for retroenantio Ctn[15-34] in DPC micelles	576	X
51538	Backbone assignment for Functional Amyloid in pseudomonas FapB	609	X
51539	Backbone assignment for Functional Amyloid in pseudomonas FapC	824	X
51541	Staphylococcus Aureus Protein A, Immunoglobulin-binidng B domain	219	X
51542	1H, 13C and 15N resonance assignments for the BRCT domain of the kinetoplastid kinetochore protein KKT4 from Trypanosoma brucei	1810	X
51543	1H and 15N assignments for [R238A]-NS1B-CTD bound to 5'ppp-hp RNA	260	X		X
51544	1H and 15N assignments for [R238A]-NS1B-CTD bound to 16-bp dsRNA	258	X		X
51546	Cadmium-loaded form of C. elegans MTL2	308	X
51547	Near complete 1H, 15N and 13C resonance assignments of the MBD double mutant	826	X
51548	Near complete 1H, 15N and 13C resonance assignments of the wild-type MBD from MeCP2	793	X
51550	MITF81-204 NMR assignments	588	X
51558	1H, 13C, and 15N backbone resonance assignments of human VPS37A N-terminal domain from 1 to 148 residues in buffer	623	X
51565	Chemical Shift Assignment of Inhibitor-3_1-78	308	X
51566	Chemical Shift Assignment of Inhibitor-3	458	X
51567	Androgen receptor (AR) polyQ derived peptide L4Q16 variant L3A	98	X
51568	Androgen receptor (AR) polyQ derived peptide L4Q16 variant L3E	106	X
51569	Androgen receptor (AR) polyQ derived peptide L4Q16 variant L3F	96	X
51570	Androgen receptor (AR) polyQ derived peptide L4Q16 variant L3H	100	X
51571	Androgen receptor (AR) polyQ derived peptide L4Q16 variant L3I	102	X
51572	Androgen receptor (AR) polyQ derived peptide L4Q16 variant L3K	106	X
51573	Androgen receptor (AR) polyQ derived peptide L4Q16 variant L3M	106	X
51574	Androgen receptor (AR) polyQ derived peptide L4Q16 variant L3R	100	X
51575	Androgen receptor (AR) polyQ derived peptide L4Q16 variant L3S	102	X
51576	Androgen receptor (AR) polyQ derived peptide L4Q16 variant L3T	98	X
51577	Androgen receptor (AR) polyQ derived peptide L4Q16 variant L3V	100	X
51578	Androgen receptor (AR) polyQ derived peptide L4Q16 variant L3W	104	X
51579	Androgen receptor (AR) polyQ derived peptide L4Q16 variant L3Y	97	X
51580	Androgen receptor (AR) polyQ derived peptide L4Q16 variant Q1E	326	X
51581	Androgen receptor (AR) polyQ derived peptide L4Q16 variant Q4E	326	X
51582	Androgen receptor (AR) polyQ derived peptide L4Q16 variant Q5E	341	X
51583	TATA-box binding protein (TBP) derived polyQ peptide (16-mer pQ)	279	X
51584	Backbone 13C and 15N Chemical Shift Assignments for fibrillar Amyloid Beta (1-42) at pH 7.0	73	X
51591	Single alpha helix peptide (P3-7)2	484	X
51592	Synthetic peptide P1-5	120	X
51593	Synthetic peptide P2-6	79	X
51594	Synthetic peptide P3-7	121	X
51595	Synthetic peptide P5-9	39	X
51596	Switchable single alpha helix peptide E(P3-7)3	438	X
51597	Single alpha helix peptide (P3-7)3	431	X
51598	SNAP25a (Rattus norvegicus)	1003	X
51599	hCEACAM1-Ig1-LBP4 Ala and Val methyl chemical shifts	108	X
51600	BIR2 domain of Xiap	322	X
51601	BCATcterm NMR assignments	538	X
51603	Backbone 1H, 15N, 13C chemical Shift Assignments for the wild-type human MDMX acidic domain, residues 170-260	458	X
51604	Backbone 1H, 15N, 13C chemical Shift Assignments for the mutant human MDMX acidic domain, residues 170-260 W200S/W201G	454	X
51605	Backbone 1H, 15N, 13C chemical Shift Assignments for the mutant human MDMX acidic domain, residues 170-260 W239S/W240S	458	X
51606	KH1-2 Fragile X mental retardation protein D331-396	363	X
51607	Assignment of PCaP1	576	X
51608	Single alpha helix peptide u(P3-7)2	78	X
51609	Single alpha helix peptide u(P3-7)3	127	X
51611	1H, 13C and 15N Backbone Chemical Shift Assignments of NUT7	157	X
51613	p53 C-terminal	180	X
51614	FUS ZnF Domain	211	X
51616	Androgen receptor (AR) polyQ derived peptide L4Q16 pH 2.8	155	X
51617	Nish P3	334	X
51618	Bivalirudin in H2O	238	X
51619	RR14	132	X
51620	NMR assignment of NTD (44 - 180) of Nucleocapsid Protein of SARS-CoV-2	702	X
51621	Bivalirudin in DMSO	248	X
51622	Asp-9 bivalirudin, a bivalirudin process impurity, in DMSO	245	X
51623	desGlu13 bivalirudin, a bivalirudin process impurity, in DMSO	236	X
51624	CPSF73-CPSF100 C-terminal heterodimer	2691	X
51625	Backbone 1H, 13C, and 15N chemical shift assignments for the N-terminal fragment of human YY1	1231	X
51627	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the C-terminal Rec domain (apo state) of the hybrid Histidine Kinase CckA (CckARec) from Caulobacter crescentus.	448	X
51628	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the C-terminal Rec domain (BeF3- bound state) of the hybrid Histidine Kinase CckA (CckARec) from Caulobacter crescentus.	474	X
51629	Clovibactin unbound	31	X
51630	Clovibactin-Lipid II bound state	95	X
51631	1H,13C,15N Backbone and side-chain assignments of tandem RRM domains of Npl3	1610	X
51632	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Alpha-synuclein linker region mutant "3AE" bound to SDS micelles	489	X
51633	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Alpha-synuclein linker region mutant "4G" bound to SDS micelles	659	X
51634	Main chain assignment of a RFFL fragment (26-145 aa).	413	X
51635	Backbone 1H, 13C and 15N Assignments of MYC(256-351)	731	X
51636	Backbone 1H, 13C and 15N Assignments of MYC(151-255)	825	X
51637	1H-15N chemical shifts of PHDvC5HCH of NSD2 methyltransferase	194	X
51638	Backbone assignment of cJun TAD 1-151	708	X
51639	Solid State MAS NMR chemical shift assignment of KR2 in DMPC/DMPA proteoliposomes	880	X
51642	KRAS4b(1-169)-G13D GppNHp	860	X
51644	ILV chemical shifts of NaK2K d18	208	X
51645	Full-length NaK ILV chemical shifts	246	X
51646	NaK d18 F92A ILV shifts	298	X
51647	Backbone 1H, 13C and 15N chemical shift assignments of ubiquitin with a modified N-terminal twin-strep tag.	362	X
51648	Backbone chemical shifts of carboxyl terminus of A Family A G protein coupled receptor with MBP	269	X
51649	Ded1p RecA2 domain	1198	X
51650	Ded1p N-terminal IDR	331	X
51651	Rev7/Rev3-RBM1	1464	X
51652	Rev7/Rev3-RBM2	1259	X
51653	the carboxyl terminus of A Family A G protein coupled receptor	100	X
51654	Backbone N and HN Chemical Shift Assignments for RBPMS-A (1-122)	188	X
51655	UBE3A isoform 2 AZUL	1008	X
51656	The 1H, 15N chemical shifts of carboxyl terminus of A Family A G protein coupled receptor with Gs	100	X
51657	Human BLVRB with Bilirubin and NADP	712	X
51658	Identifying the structural and dynamic changes of BLVRB through the catalytic cycle	666	X
51659	Backbone Chemical Shift Assignments of human glutathione peroxidase 4 (GPx4)	556	X
51661	1H, 13C, and 15N resonance assignments of SarA monomer from Staphylococcus aureus in complex with DNA	1610	X	X
51662	1H, 13C and 15N NMR chemical shift assignments of LytM N-terminal domain (residues 26-184)	1341	X
51663	Backbone resonance assignments for a 21-residue peptide corresponding to the SARS-CoV-2 spike C-terminal tail	95	X
51672	GRASP peptide	250	X
51673	1H, 13C, and 15N Chemical Shift Assignments for amyloidogenic SEM1(45-67) peptide	238	X
51674	DinB-PAD	1108	X
51675	DinB-Thumb	659	X
51676	DinBdeltaPAD	1562	X
51677	DinB	1883	X
51678	13C and 15N Resonance Assignments of Alpha Synuclein Fibrils Amplified from Dementia with Lewy Bodies Tissue	225	X
51681	Assignment for optoallosteric GTPase, Cdc42Lov	1114	X
51682	Chemical_shift_FAM122A_29-120	409	X
51683	UGT2B17-C terminus	1546	X
51684	Backbone 1H, 13C and 15N Chemical Shift Assignments and Relaxation Parameters for USP14-Ubl domain	372	X
51685	Backbone 1H, 13C and 15N Chemical Shift Assignments and Relaxation Parameters for Ubl domain and Linker in Full-length USP14	662	X
51687	Backbone and CB chemical shifts of HPy1 repetitive unit from Argiope argentata	944	X
51688	Chemical shift assignments of truncated structured core of HPy1 repetitive unit from Argiope argentata	1475	X
51689	Assignments of human CAPRIN1 residues 607-709 N623TN630T mutant	273	X
51690	Sequence Specific 1H, 13C, and 15N backbone resonance assignments of 70 kDa Penicillin Binding Protein PBP5	2482	X
51691	1H, 13C, and 15N Chemical Shift Assignments for amyloidogenic SEM1(49-67) peptide	237	X
51692	Sidechain Ile, Leu, and Val methyl Chemical Shift Assignments for Penicillin Binding Protein 5	728	X
51695	Chemical shift assignment of the intracellular domain of the prolactin receptor, residues 236-396	725	X
51696	Backbone chemical shift assignment of yeast expressed NIST-Fab light and heavy chain	2027	X
51697	Assignment of pre-miRNA-31 TopA short fragment	113			X
51698	Assignment of pre-miR-31 Top short fragment	194			X
51700	Backbone chemical shifts of human SAFB2 SAP domain	384	X
51701	Backbone chemical shifts of human SAFB2 RRM domain at pH 5.0	417	X
51702	BlaC D179N	749	X
51703	Recombinant Expression and Chemical Amidation of Isotopically Labeled Native Melittin	184	X
51704	Histone H3 Core Domain in Chromatin with Different DNA Linker Lengths Studied by 1H-Detected Solid-State NMR Spectrsocopy	302	X	X
51705	Histone H3 Core Domain in Chromatin with Different DNA Linker Lengths Studied by 1H-Detected Solid-State NMR Spectrsocopy	303	X	X
51706	Histone H3 Core Domain in Chromatin with Different DNA Linker Lengths Studied by 1H-Detected Solid-State NMR Spectrsocopy	410	X	X
51707	Solution state chemical shift NMR assignment of human l-III immunoglobulin light chain FOR005_R49G variant.	389	X
51708	Solution state chemical shift NMR assignment of human l-III immunoglobulin light chain FOR005_GL	392	X
51709	SARS-CoV-2 Nucleocapsid 251-419	527	X
51710	SARS-CoV-2 Phosphorylated Nucleocapsid 1-209 at 35C	517	X
51711	1H, 13C, 15N backbone chemical shift assignments for DDX4 1-236	881	X
51713	Solution NMR assignment of RRM2 Cterminal of human La protein.	1890	X
51714	Partial Backbone Assignment of The Q163C/Q309C Mutant of aMI-domain in the Mg2+-Bound Form	370	X
51715	Calmodulin bound to the GluN1 C0 domain of the NMDA receptor	1586	X
51716	Partial Backbone Assignment of The Q163C/Q309C Mutant of aMI-domain in the Co2+-Bound Form	148	X
51717	Esrrb_aa1-102	466	X
51719	Design and characterization of a protein fold switching network	433	X
51720	1H, 13C, 15N resonance assignment of intrinsically disordered C-terminal fragment of methoprene tolerant protein (MetC)	1226	X
51721	NMR assignment of ethyl-azide-tagged Ubiquitin-T12C	976	X
51723	1H, 13C, 15N chemical shift assignments for soluble domain of Rieske iron-sulfur protein from Chlorobaculum tepidum	2556	X
51724	Backbone chemical shifts of human SAFB2 RRM domain at pH 6.5	180	X
51725	Ubiquitin-T12C (apo)	958	X
51726	1H, 13C and 15N assignments and NOESY peak lists of silver ion-bound SilF from Salmonella typhimurium plasmid pMG101	873	X
51728	Apo-state enNTS1DM4	16	X
51729	1H, 13C, and 15N Chemical Shift Assignments for a-Cobratoxin from Naja Atra	641	X
51730	Resonance assignments of the microtubule-binding domain of the microtubule-associated protein 7 (MAP7)	819	X
51731	Cerato Ulmin	387	X
51735	NT8-13 bound enNTS1DM4	68	X
51736	SR142948A bound enNTS1DM4	20	X
51737	13CH3-methionine assignments of ML314 bound enNTS1DM4	24	X
51738	NT8-13 & ML314 bound enNTS1DM4	24	X
51739	Backbone 1H, 13C and 15N assignments of the apo-acyl carrier protein of Pseudomonas aeruginosa	384	X
51741	EWS RRM-RG2-ZnF	646	X
51742	[D-Cys5,D-Lys16]-STp(5-17), native form	63	X
51743	[D-Cys5,Asp7,Val8,D-Lys16]-STp(5-17), native form	60	X
51744	AbpSH3 0 mM NaCl	138	X
51745	AbpSH3 100 mM NaCl	136	X
51746	AbpSH3 800 mM NaCl	136	X
51747	Backbone Assignment of the S519N variant of SASH1 Pigmentation Associated Disordered Region (SPIDER)	766	X
51748	MERS Nsp9	414	X
51749	Backbone resonance, Cb, and ILV-CH3 assignments of human Atg3 with deletion of 90 to 190 residues and H240Y, V241A, P263G, and H266L mutations in bicelles	1266	X
51753	Human p53 DBD (94-293)	897	X
51754	RC9	60	X
51755	Clr4 protein Solution NMR Chemical Shifts	2193	X
51756	Oct4_aa1-145_tev	619	X
51758	Oct4_aa286-360_tev	364	X
51763	MITF C-terminus backbone assignments	593	X
51766	15N, 1H, 13CA, 13CB and 13CO assignment of human SENP1 419-644	951	X
51768	Chemical shifts of UBQLN1 514-586	429	X
51769	Chemical shifts of UBQLN1 514-589, F547Y at 50 micromolar	142	X
51770	Chemical shifts of UBQLN1 514-589, F547Y at 600 micromolar	196	X
51771	CTADC region of NAP1	44	X
51772	CTADN region of NAP1	48	X
51773	CTADC-H2AH2B complex	486	X
51774	H2AH2B	452	X
51775	R77EH2B hetero dimer	462	X
51776	CTADN-R77EH2B complex	500	X
51777	CTADN-H2AH2B complex	34	X
51779	Bacillus subtilis SepF protein assembly (wild type)	382	X
51780	Nanog_aa1-85	383	X
51781	Backbone assignments of the heavy and light chains from the disulfide mutant HLA-A*02:01-G121C/b2m-H32C/ELAGIGILTV(MART-1) human MHC-I protein complex	1381	X
51782	His6-AviTag-Sox2_aa234-317_C265A	478	X
51783	Chemical Shift Assignments of Retinal Guanylyl Cyclase Activating Protein 5 (GCAP5) with a Mutation (R22A) that Abolishes Dimerization and Enhances Cyclase Activation	1834	X
51784	Backbone 1H, 13C, and 15N Chemical Shift Assignments of a Metal-Free Retinal Guanylyl Cyclase Activating Protein 5 (GCAP5) in Zebrafish Photoreceptors	1421	X
51785	Solid-state NMR assignment data of TasA filaments	1280	X
51786	Rec114:Mei4 minimal structured complex at pH 6.1	556	X
51787	Rec114:Mei4 minimal structured complex at pH 7.4	477	X
51788	Solid-State NMR Assignment of Tsa1 Wild Type, a decameric Peroxiredoxin, in its native oxidized state	420	X
51790	NMR resonance assignments of the Arabidopsis thaliana minimal interaction domains of DRB7.2:DRB4 complex	889	X
51791	NMR resonance assignments of the Arabidopsis thaliana minimal interactions domains of DRB4:DRB7.2 complex	463	X
51792	FapC L2R3C	863	X
51793	FapC Full-Length	1379	X
51794	Backbone resonance assignment of the LEDGF/p52 splice variant	1435	X
51795	Backbone 1H, 13C and 15N chemical shift assignments of the N-terminal portion of Annexin A11-PRD(residues 2-52)	243	X
51796	Backbone 1H, 13C and 15N chemical shift assignments of human S100A6	392	X
51797	Backbone assignment of the extended C-terminal domain of Tetrahymena telomerase protein p65	460	X
51798	Backbone assignment for N-terminal disordered domain of Tetrahymena telomerase protein p65	661	X
51800	1H, 13C and 15N backbone and sidechain assignment of the Burkholderia mallei acyl carrier protein	895	X
51802	Backbone assignment of DnaK C-terminal alpha-helical lid with C-IDR	526	X
51804	1H and 15N chemical shifts of WT RhoA bound to GDP	238	X
51805	1H and 15N chemical shifts of WT RhoA bound to GMPPNP	214	X
51806	1H and 15N chemical shifts of RhoA mutant A161V bound to GDP	188	X
51807	1H and 15N chemical shifts of RhoA mutant A161V bound to GMPPNP	188	X
51808	Stem 1 hairpin of Tytrahymena telomerase RNA	8			X
51809	Stem 1 hairpin with linker of Tytrahymena telomerase RNA	9			X
51810	Backbone chemical shifts for the Drosophila melanogaster Deltex WWE2 domain	817	X
51811	1H, 13C, 15N backbone chemical shift assignments of the extended ARID domain from human AT-rich interactive domain protein 5a (Arid5a)	765	X
51812	1H, 13C, 15N backbone chemical shift assignments of the extended ARID domain from human AT-rich interactive domain protein 5a (Arid5a)	871	X
51813	HN assignments of C8i-acyl carrier protein of Burkholderia mallei	155	X
51814	Backbone Chemical Shift Assignments (1H, 13C, and 15N) for the CH Domain of Yeast Kinetochore Protein Ndc80	568	X
51815	Chemical shifts of HLA-B*0702 in complex with acute myeloid leukemia phosphoneoantigen pMLL747-755	1175	X
51818	Backbone 1H, 13C, 15N Chemical Shift Assignment for Human Transthyretin in Solution	578	X
51820	13C,15N solid-state NMR assignments of H2B globular domain in NCP	473	X	X
51821	Calmodulin bound to a cytosolic domain of the GluN2 subunit of the NMDA Receptor	1539	X
51822	Backbone assignment of MAGEA4-MHD in complex with RAD18-R6BD	318	X
51823	Backbone assignment of MAGEA4-MHD	340	X
51825	Solid-State NMR Assignment of Tsa1 Wild Type, a decameric Peroxiredoxin, in its reduced state	630	X
51826	1H, 13C, 15N resonance assignment of the GltJ N-terminal cytoplasmic region (1-222) from Myxococcus xanthus	919	X
51827	Backbone 1H, 13C, and 15N Chemical Shift Assignments for FASP peptide of hPER2	246	X
51828	Backbone assignment of Mus Musculus FAM122A 1-124	551	X
51829	Backbone assignment of Human SERF1a short form	277	X
51831	Backbone assignment of STIM1 CC3 double mutant (L416S + L423S)	194	X
51832	NMR Resonance Assignment of a Fibroblast Growth Factor 8 splicing isoform b.	1942	X
51833	Differential Structural Features of Two Mutant ADAR1p150 Za Domains Cause Aicardi-Goutieres Syndrome	519	X
51834	hADAR1p150 Zalpha P193A	551	X
51835	Binding of Rho GDP-dissociation inhibitor to its GTPase clients relies on preformed secondary structural properties of the binding interface	817	X
51836	Backbone (1HN, 15N, 13C) resonance assignments for the VirB9 C-terminal domain in the unbound state	363	X
51837	MEG 2.1, isoform 1, peptide B	150	X
51840	1H, 13C and 15N resonance assignments of four MEF2D b-domain peptide constructs (wild type)	312	X
51841	1H, 13C and 15N resonance assignments of four MEF2D b-domain peptide constructs (var3)	302	X
51842	1H, 13C and 15N resonance assignments of four MEF2D b-domain peptide constructs (var4)	287	X
51843	1H, 13C and 15N resonance assignments of four MEF2D b-domain peptide constructs (var8)	304	X
51844	MEG 2.1, isoform 1, peptide A	140	X
51845	MEG 2.1, isoform 1, peptide D	175	X
51846	MEG 2.1, isoform 1, peptide C	143	X
51847	cyanomet cGlbN	661	X
51848	cGlbN-Fe3-bisHis	627	X
51849	apo-cGlbN	528	X
51850	Backbone and side-chain chemical shift assignments of the conformers of the C terminal domain (CTD) of MazE9 antitoxin in Mycobacterium tuberculosis	464	X
51851	MEG 2.1, isoform 2, peptide B	161	X
51852	MEG 2.1, isoform 2, peptide 2A	155	X
51853	MEG 2.1, isoform 3	263	X
51855	Backbone and side-chain chemical shift assignments of the N terminal domain of the MazE9 (nMazE9) antitoxin in Mycobacterium tuberculosis	462	X
51857	Backbone and side-chain chemical shift assignments of the MazE9 antitoxin in Mycobacterium tuberculosis	963	X
51858	Backbone and side-chain chemical shift assignments of the P44A mutant of the MazE9 antitoxin in Mycobacterium tuberculosis	759	X
51859	1H, 13C, 15N chemical shifts of human IL-1b at pH 7.4 and 296 K	592	X
51860	1H, 13C and 15N backbone chemical shifts for N-terminal domain of FtsQ (FtsQ1-99) from Mycobacterium tuberculosis	450	X
51861	Backbone resonance assignment of the PPIase domain (100-213) of the Legionella pneumophila Mip protein	311	X
51867	human Insulin Fibrils	221	X
51869	Resonance assignment of the preQ1 riboswitch from Thermotoga tengcongensis	739			X
51870	AtGRP2 CSD	955	X
51871	1H, 13C, and 15N backbone NMR resonance assignments of TANGO1 (30-139) from Drosophila melanogaster	751	X
51875	CPEB4 N-terminal domain	1986	X
51877	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Vtc2(1-201) in complex with inositol hexaphosphate	743	X
51878	Backbone 1H, 13C, and 15N Chemical Shift Assignments for apo Vtc2(1-201)	933	X
51879	Heterogeneous population of a photoconvertible fluorescent protein mEos4b observed in solution NMR spectroscopy coupled to in-situ sample illumination	3531	X
51880	Assignments for plectasin in complex with Lipid II in membranes	601	X
51881	ARPP19_assignment	472	X
51882	MASTL-phosphorylated ARPP19	467	X
51885	Structure, dynamics and stability of the smallest and most complex 71 protein knot	406	X
51886	Backbone and Sidechain Chemical Shift Assignments for D. melanogaster R2D2 dsRBD1 region	941	X
51887	Abf2	824	X
51888	Backbone chemical shift assignment of Drosophila Khc 855-975	294	X
51890	Assignment of human Dynein Light intermediate chain 2 (LIC2)	391	X
51891	Abf2-HMG1	644	X
51892	1H, 15N and 13C backbone assignments for human PARP-1 BRCT domain	603	X
51893	human full-length PARP-1 free protein 1H and 15N partial assignments	1370	X
51894	human full-length PARP-1 protein DNA-bound 1H and 15N partial assignments	544	X	X
51896	Structure of a new ShKT peptide from the sea anemone Telmatactis stephensoni: ShKT-Ts1.	383	X
51899	cytosolic abundant heat soluble protein motif 1 and 2	318	X
51900	Backbone assignment of human Polymerase Theta Motif 1	381	X
51901	Tst2	247	X
51902	Backbone and side chain chemical shift assignments of purS subunit of phosphoribosylformylglycinamidine synthase enzyme from S. aureus	1124	X
51904	Modifications to the SR-Rich Region of the SARS-CoV-2 Nucleocapsid Regulate Self-Association and Attenuate RNA Interactions	338	X
51905	StASL domain of EMCV IRES J-K-St.	68			X
51906	J domain of EMCV IRES J-K-St	36			X
51907	Backbone resonance assignment of a stabilized neurotensin receptor bound to neurotensin	553	X
51908	Apo-state enNTS1DM4 with PIP2	24	X
51909	NT8-13 bound enNTS1DM4 with PIP2	60	X
51910	ML314 bound enNTS1DM4 with PIP2	24	X
51911	NT8-13 & ML314 bound enNTS1DM4 with PIP2	36	X
51912	Backbone 1H, 13C and 15N resonance assignment of the apo Ubiquitin Specific Protease 7 catalytic domain (residues 208-554)	1508	X
51913	Backbone 1H, 13C and 15N resonance assignment of the Ubiquitin Specific Protease 7 catalytic domain (residues 208-554) in a complex with small molecule ligand	1141	X
51914	NT8-13 bound enNTS1DM4 with beta-Arrestin1-3A	24	X
51915	NT8-13 bound enNTS1DM4 with beta-Arrestin1-3A & PIP2	28	X
51916	ML314 bound enNTS1DM4 with beta-Arrestin1-3A & PIP2	48	X
51917	NT8-13 & ML314 bound enNTS1DM4 with beta-Arrestin-1-3A & PIP2	24	X
51919	1H, 13C, 15N chemical shifts of human IL-1b at pH 7.4 and 309 K	559	X
51920	Backbone assignment of human Polymerase Theta Motif 1 phosphorylated by PLK1	411	X
51921	NT8-13 bound enNTS1DM4 with Galpha-iq & PIP2	44	X
51922	Order parameters of Ile d-, Leu d-, and Val g-methyl groups, and assignment of Ile d-methyl groups of prazosin-bound a1B-AR-B1D1 at 320K	84	X
51923	Order parameters of Ile d-, Leu d-, and Val g-methyl groups, and assignment of Ile d-methyl groups of tamsulosin-bound a1B-AR-B1D1 at 320K	100	X
51924	Order parameters of Ile d-, Leu d-, and Val g-methyl groups, and assignment of Ile d-methyl groups of r-TIA-bound a1B-AR-B1D1 at 320K	76	X
51925	Assignment of Ile d-methyl groups of prazosin-bound a1B-AR-B1D1 at 298K	72	X
51926	Assignment of Ile d-methyl groups of apo a1B-AR-B1D1 at 298K	56	X
51927	NT8-13 & ML314 bound enNTS1DM4 with G alpha iq & PIP2	52	X
51928	Solid-state NMR data for 40-residue Arctic (E22G) Beta-Amyloid Fibril	95	X
51929	Backbone resonance assignments for dengue 4 mini-NS2B in detergent micelles	589	X
51937	1H, 13C, and 15N resonance assignment and secondary structure of the pheromone binding protein 3 of Ostrinia nubilalis (OnubPBP3), an agricultural pest.	1543	X
51938	1H, 13C, 15N chemical shifts of human IL-1b at pH 7.4 and 296 K in the presence of antagonist S-2	680	X
51939	Backbone Assignment of Human Polymerase Theta MOTIF 2	507	X
51940	Backbone Assignment of Human Polymerase Theta MOTIF 2 phosphorylated by PLK1	562	X
51941	1H and 13C NMR assignments for C-terminal panusin	237	X
51942	1H and 13C NMR assignments for panusin	968	X
51943	Solution State NMR Chemical Shift Assignments for Yeast Peroxiredoxin Tsa1 mutated S78D - Backbone 1H, 13C, and 15N and ILV methyl groups	1154	X
51949	Assignments of mature MepS peptidoglycan hydrolase (residues 1-162)	626	X
51950	1H, 13C, 15N chemical shifts of human IL-1b (V47A) at pH 7.4 at 296 K and 309 K	796	X
51951	Chemical Shift Assignments for ZNF750-Z*	307	X
51952	Human eIF4B first half of C-terminal region	729	X
51953	Human eIF4B second half of C-terminal region	879	X
51955	Imino proton assignments of Ext, a transient stemloop downstream of the SARS-CoV-2 5_SL4 RNA element	6			X
51956	Imino resonance assignments of SL4ext, the SARS-CoV-2 RNA element 5_SL4 extended by a transiently folded stemloop	40			X
51957	Human eIF4B C-terminal region	1044	X
51959	minor conformation of s1.1 domain of sA from Bacillus subtilis	583	X
51960	1H, 13C and 15N backbone and side-chain resonance assignments of BMSA1	2734	X
51962	1H Chemical Shift Assignments for amyloidogenic SEM1(86-107) peptide in solution with dodecylphosphocholine micelles	143	X
51963	1H chemical shifts of amyloidogenic SEM1(86-107) peptide	122	X
51964	fl SOX2	995	X
51973	Backbone resonance assignments of Escherichia coli Adenylate kinase C77S	776	X
51974	Chemical shift assignments for the seventh (HhH)2 repeat from Topoisomerase V	899	X
51975	Chemical shift assignments for the sixth and seventh (HhH)2 repeats from Topoisomerase V	769	X
51978	Backbone 1H, 13C, and 15N Chemical Shift Assignments for human PHOX2B C-terminal domain at 278K	719	X
51979	1H, 13C, and 15N Chemical Shift Assignments for human PHOX2B C-terminal domain at 298K	633	X
51981	Backbone chemical shifts of Amelotin at 2 kbar	728	X
51982	Chemical shifts for Amelotin (25-130) at 2 kbar	436	X
51983	Chemical shift assignments for the seventh and eighth (HhH)2 repeats from Topoisomerase V	662	X
51984	1H, 13C, and 15N Chemical Shift Assignments for p53 (1-100)	555	X
51985	1H, 15N and 13C backbone resonance assignments of the D10N variant of beta-phosphoglucomutase (cis K145-P146 peptide bond) in a Mg-bound complex with fructose 1,6-bisphosphate	971	X
51986	1H, 15N and 13C backbone resonance assignments of the D10N,P146A variant of beta-phosphoglucomutase (trans K145-A146 peptide bond) in a Mg-bound complex with fructose 1,6-bisphosphate and an additional Mg ion bound in the active site	1058	X
51987	1H and 15N backbone resonance assignments of the D10N,P146A variant of beta-phosphoglucomutase (trans K145-A146 peptide bond) in a Mg-bound complex with fructose 1,6-bisphosphate	392	X
51988	1H, 15N and 13C backbone resonance assignments of the D10N,P146A variant of beta-phosphoglucomutase (trans K145-A146 peptide bond) in a Mg-bound complex with beta-glucose 1,6-bisphosphate and an additional Mg ion bound in the active site	1044	X
51989	1H, 15N and 13C backbone resonance assignments of the D10N,P146A variant of beta-phosphoglucomutase (cis K145-A146 peptide bond) in a Mg-bound complex with beta-glucose 1,6-bisphosphate	1065	X
51990	1H, 15N and 13C backbone resonance assignments of the D10N,P146A variant of beta-phosphoglucomutase (trans K145-A146 peptide bond) in a Mg-bound complex with beta-glucose 1,6-bisphosphate	660	X
51991	1H, 13C, 15N NMR assignment of the dimeric form of CTD MaSp2 from Latrodectus hesperus	959	X
51992	Resonance assignments for papain-like protease from Severe Acute Respiratory Syndrome Coronavirus 2	675	X
51993	Backbone 13C and 15N Chemical Shift Assignments for Fibrils of Pyroglutamate Amyloid beta (3-42) at pH 2	188	X
51994	1H, 15N and 13C backbone and side chain solution NMR assignments of the TPM domain-containing protein of the thermophilic bacterium Rhodothermus marinus	1666	X
51996	DNAJB6 J-domain	271	X
51997	DNAJB6_JD-GF A50V	497	X
51999	Methyl assignments of the light chain from the open MHC mutant HLA-B*37:01-G121C/b2m-H32C/FEDLRVJSF(photoB37) human MHC-I protein complex	138	X
52001	Backbone Resonance Assignments of Human GDP-bound KRAS4a Isoform	770	X
52002	Backbone Resonance Assignments of Human GMPPNP-bound KRAS4a Isoform	344	X
52003	Identifying structural and dynamics changes during the Biliverdin Reductase B catalytic cycle	715	X
52004	Identifying structural and dynamics changes during the Biliverdin Reductase B catalytic cycle	636	X
52005	Unbound VirB9Ct assignments and 15N-CEST experiments at 35 degrees	156	X
52006	Assignment of Lipidic amyloid-b (1-40) fibril	231	X
52007	Backbone resonance assignments for a 21-residue peptide corresponding to the T21E mutant of the SARS-CoV-2 spike C-terminal tail	96	X
52009	Full assignment of 13C,15N-labeled oncogenic mutant human KRas4B-G12C(1-169) bound to GDP and free of Mg2+ ion at physiological pH	1527	X
52010	SARS-CoV-2 Nucleocapsid protein NTD Y109A mutant	212	X
52012	Chemical shifts of Methanosarcina acetivorans mechanosensitive channel of large conductance(Ma-MscL) in native cellular membranes by solid-state NMR	375	X
52013	1H, 15N, 13C assignments of Clovibactin in DMSO	93				X
52014	Solid-state NMR assignment of side-chain protons of HBV core protein at fast MAS and high field	844	X
52016	Mdm2_aa111-293_human	892	X
52017	KaiBRS-3m	419	X
52018	Backbone 1H, 13C, and 15N chemical shift assignments of the ground state and the fold-switched state of KaiB-RS	661	X
52019	Backbone 1H, 13C, and 15N chemical shift assignments of the fold-switched state of KaiB-TV	277	X
52021	Backbone 1H, 15N and 13C chemical shift assignments for the G-domain of wildtype human K-Ras4B(1-169) bound to GTP at physiological pH	798	X
52022	Backbone and side chain assignments for RNA recognition motif (RRM) 1 of CP29A from Arabidopsis thaliana	764	X
52023	Backbone 1H, 15N and 13C chemical shift assignments for the G-domain of human K-Ras4B(1-169) G12D mutant bound to GTP at physiological pH	811	X
52024	Backbone 1H, 15N and 13C chemical shift assignments for the G-domain of human K-Ras4B(1-169) G12C mutant bound to GTP at physiological pH	822	X
52025	Backbone assignments for RNA recognition motif (RRM) 2 of CP29A from Arabidopsis thaliana	351	X
52028	Mdm2 aa111-230 4C4A human	583	X
52030	Ded1p C-terminal IDR	267	X
52031	Ded1p C-terminal IDR R540K, R544K, F548G, R545K, R550K, R554K, Y556G, R557K, W567G, R571K, R573K, F577G, R578K, W583G, W592G	217	X
52032	Ded1p C-terminal IDR R540G, R544G, R545G, R550G, R554G, R557G, R571G, R573G, R578G	228	X
52033	Ded1p C-terminal IDR R540K, R544K, R545K, R550K, R554K, R557K, R571K, R573K, R578K	228	X
52034	Ded1p Reca1 domain	842	X
52035	FapA	471	X
52040	AtMed25ACID	681	X
52041	AtMed25ACID + DREB2A	276	X
52042	AtMed25ACID + DREB2A ABS	270	X
52043	AtMed25ACID + DREB2A RIM	270	X
52044	CEP192 442-533	680	X
52045	1H, 13C, 15N and 31P chemical shift assignment of poly(UG) fold RNA	511			X
52046	Assignment of PRPF40A N-terminal extended WW12 construct	564	X
52047	Chemical shift assignments for GB1-N-Myc 18-59 fusion	787	X
52049	An analysis of nucleotide-amyloid interactions reveals selective binding to codon-sized RNA	39	X		X
52051	Backbone resonance assignments for UBE2T	878	X
52057	NMR assignment of the N-terminal region of the Translocated Intimin Receptor (res. 61 to 200)	1174	X
52059	Chemical shifts of hHR23A 2-363	3062	X
52060	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the region 310-350 for TDP-43 C-terminal domain engineered variant 5M to A inside CR	155	X
52061	Backbone 1H and 15N Chemical Shift Assignments for the region 310-350 for TDP-43 C-terminal domain engineered variant 6F to A	78	X
52062	Backbone 1H and 15N Chemical Shift Assignments for the region 310-350 for TDP-43 C-terminal domain engineered variant 5M to A outside CR	78	X
52063	A conformational switch in the c-MYC transactivation domain	244	X
52064	NMR assignment of the N-terminal region of the Translocated Intimin Receptor (res. 61 to 200)	1146	X
52065	DNAJB6 JD-GF F89I	489	X
52066	Chemical shift assignments for N-Myc 1-137	1003	X
52067	Chemical shift assignments for N-Myc 64-137	360	X
52068	Chemical shift assignment of the ClpL-N-terminal domain from Listeria monocytogenes	624	X
52070	dGAE(297-391) tau CTE-like filaments	382	X
52071	Backbone assignment of Ca2+ bound Arabidopsis thaliana Calmodulin1	715	X
52075	NMR Assignments and Structure for the Dimeric Kinesin Neck Domain	704	X
52077	TRBP2_dsRBD2 chemical shift assignment and dynamics data.	635	X
52078	1H and 15N chemical shift assignments of K6-linked diubiquitin	282	X
52079	CIN85(163-333)-R227A/R229A	1369	X
52080	CIN85(163-333)-R229A	1365	X
52081	CIN85(163-333)	1253	X
52087	C-terminal domain of AtBCCP1	986	X
52088	PH domain of Akt-like kinase in Trypanosoma cruzi	852	X
52089	Solution structure of the extreme C-terminus of the Bordetella pertussis filamentous hemagglutinin prodomain	1302	X
52090	Chemical shifts of Ost4 protein assigned by solid state NMR	184	X
52091	DNAJB6 JD-GF F91I	488	X
52092	Solution NMR chemical shift assignments for a subdomain construct of 7SK SL3 RNA in the SL3a state	208			X
52093	1H-15N-BEST-TROSY spectra for alpha-synuclein	266	X
52094	1H-15N-BEST-TROSY spectra for alpha-synuclein in the presence of JM-domain VAMP2 peptide (aa sequence: KLKRKY)	798	X
52095	1H-15N-BEST-TROSY spectra for alpha-synuclein in the presence of NT-domain VAMP2 peptide (aa sequence: NLTSNR)	266	X
52098	DNAJB6 JD-GF F100V	481	X
52099	backbone 13C and 15N chemical shift assignment of the conductance domain of Influenza A M2 protein in DPhPC proteoliposomes	132	X
52100	Solution NMR structure of Bcl-2-xL bound to compound 35	2109	X
52103	Backbone assignment of SPIN-cys-aureus	325	X
52104	Solid State NMR chemical shift of Ost4V23D	166	X
52105	1H and 15N chemical shift assignments of K6-linked di-ubiquitin with chain-terminating mutations	284	X
52108	Backbone 1H and 15N chemical shift assignments of K29-linked diubiquitin	278	X
52109	Chemical shifts for IAA17/AXR3 N-terminal	1053	X
52114	thermostable WW domain basic scaffold to design functional b-sheet miniproteins	403	X
52115	Backbone 1H and 15N chemical shift assignments of K33-linked diubiquitin	278	X
52121	d(CpG)3	96		X
52122	d(5mCpG)3	92		X
52123	r(CpG)3	88			X
52124	r(CpG)6	36			X
52125	8mG4 d(CpG)3	137		X
52126	8mG4 r(CpG)3	168			X
52127	1H and 15N chemical shift assignments of K48-linked di-ubiquitin with chain-terminating mutations	284	X
52129	Solution Structure of RsgI9 CRE domain from C. thermocellum	1904	X
52130	Backbone assignment of C-teminus of yeast Oxa1	1544	X
52133	Backbone and sidechain chemical shift assignment of DRB3 dsRBD1	795	X
52137	Backbone assignment of ubiquitin carboxyl-terminal hydrolase L1 (UCH-L1)	1050	X
52138	Backbone assignment of the R178Q mutant of ubiquitin carboxyl-terminal hydrolase L1 (UCH-L1)	850	X
52139	1H and 15N chemical shift assignments of K48-linked di-ubiquitin	282	X
52140	1H and 15N chemical shift assignments of K63-linked di-ubiquitin with chain-terminating mutations	284	X
52141	Backbone 1H, 13C,and 15N chemical shift assignments for human SERF2	478	X
52142	1H, 15N and 13C chemical shift assignments for the D2 domain of the human DEAD-box RNA helicase DDX3X	973	X
52143	1H, 15N and 13C chemical shift assignments for the D1 domain of the human DEAD-box RNA helicase DDX3X	1216	X
52144	Backbone 1H, 13C and 15N Chemical Shift Assignment of Mouse Siderocalin (Lipocalin 2)	580	X
52145	NMR assignment of LytM catalytic domain	486	X
52146	NMR assignment of lysostaphin catalytic domain	515	X
52147	RNA binding protein hMEX3B can specifically recognize HLA-A mRNA to promote tumor immune escape	1023	X
52150	Solution structure of thioredoxin from Pisum sativum	1139	X
52151	Backbone and sidechain chemical shift assignment of DRB3 dsRBD2	1042	X
52152	Endo-b-1,4-xylanase (Xylanase A) WT peak assignments from Bacillus subtilis	815	X
52153	Endo-b-1,4-xylanase (Xylanase A) D11F/R122D mutant from Bacillus subtilis	658	X
52156	LTA-binding domain of SlpA, the S-layer protein from Lactobacillus amylovorus	561	X
52158	NMR analysis of the homodimeric structure of a D-Ala-D-Ala metallopeptidase, VanX, from vancomycin-resistant bacteria	1935	X
52160	MRE11 565_595	72	X
52162	Human Rev1-BRCT Domain	397	X
52169	Clostridioides peptidoglycan fragment dimer	34	X
52170	1H, 13C and 15N chemical shift assignment of PhoSL (Pholiota squarrosa Lectin)	487	X
52171	Sipa assignment	793	X
52173	NMR assignment of the Y5pCMF variant of human HuR RRM1 protein	755	X
52178	SIRT1 1-54	219	X
52179	Backbone assignement of the antiapoptic protein human Bfl-1	454	X
52180	SurA Ile and Met methyl assignments	172	X
52181	SIRT1 1-84	307	X
52182	SIRT1 1-124	516	X
52183	SIRT1 141-233	145	X
52184	SIRT1 109-233	294	X
52186	DBC1 52-120	313	X
52187	aMED25-ACID(551-680)	1564	X
52188	Synthetic Ramoplanin A2 Analogue	425	X
52192	INCENP_33aa	72	X
52193	ModA - molybdate binding protein at two pHs	3195	X
52194	INCENP-complex	48	X
52197	Partial solid-state NMR 13C, 15N resonance assignments of the two conformations of Bj-SemiSWEET in native celular membranes	790	X
52200	ModA - molybdate binding protein at two pHs (data with bound molybdate)	2023	X
52202	Rat Metabatropic Glutamate Receptor 3 WT C-Terminal Domain	135	X
52205	MrkA monomer of Klebsiella pneumoniae type III fimbriae	2090	X
52206	Rat Metabatropic Glutamate Receptor 2 WT C-Terminal Domain	146	X
52207	SDHAF4 assembly factor of Human Complex II	432	X
52208	Backbone chemical shift assignments for HMG-D Y12F mutant free protein	286	X
52209	Chemical shifts of constitutively monomeric CXCL12	768	X
52210	NMR assignments for ZNF711-7	272	X
52211	1H 15N assignments for the C384A mutant of the C-terminus of UGT1A free form	260	X
52212	1H 15N assignments for the C384A mutant of the C-terminus of UGT1A in the presence of UM28	244	X
52213	1H 15N assignments for the C384A mutant of the C-terminus of UGT1A in the presence of 3E08_20	244	X
52214	1H 15N assignments for the C384A mutant of the C-terminus of UGT1A in the presence of 3E08	236	X
52215	SCoV-2 s2m delta	817			X
52217	1H, 13C, and 15N Chemical Shift Assignments for amyloidogenic SEM1(86-107) peptide	274	X
52218	NMR assignments of capsid protein protrusion domain of Dragon grouper nervous necrosis virus at pH 5	616	X
52226	NMR chemical shifts of the human Roquin-1 ZnF domain	575	X
52228	Assignment of trastuzumab-scFab	2607	X
52233	R15B I415-G613	802	X
52234	Backbone Assignments of Sis1 J-domain and Gly-rich region	442	X
52237	1H, 13C and 15N backbone and sidechain assignment of the BRCT domain of Mtb LigA	980	X
52238	Backbone 1H, 13C, and 15N assignments of the C-terminal alpha helical domain from M. Bovis lactoferrin binding receptor B.	854	X
52243	Enabling Site-Specific NMR Investigations of Therapeutic Fab using a Cell-Free Based Isotopic Labeling Approach: Application to anti-LAMP1 Fab.	1920	X
52244	H2A and H2B chemical shifts in the Xenopus H2A/H2B heterodimer	952	X
52245	Backbone assignment of GLYCINE RICH RNA-BINDING PROTEIN 7 from Arabidopsis thaliana	440	X
52246	1H and 15N Chemical Shifts of alpha7nAChR ICD without PICK1	258	X
52247	1H and 15N Chemical Shifts of alpha7nAChR ICD with PICK1	258	X
52248	1H and 15N Chemical Shifts of PICK1 without alpha7nAChR ICD+TMD	162	X
52249	1H and 15N Chemical Shifts of PICK1 with alpha7nAChR TMD+ICD	162	X
52251	Mdm2aa214_226_pT218_pS220	63	X
52252	15N13C Chemical Shift Assignment of the NL63 ETM (7-37)	167	X
52253	Backbone 1H, 15N and 13C Chemical shift Assignments for TAR DNA-binding protein of 43 kDa C-terminal low-complexity	536	X
52254	Backbone 1H, 15N and 13C Chemical shift Assignments for S333D phosphomimetic variant of TAR DNA-binding protein of 43 kDa C-terminal low-complexity	536	X
52255	Mdm2aa211-223 pS215-pT218	60	X
52256	Mdm2aa214_226 pS220	67	X
52257	Mdm2aa211_223 pS215	62	X
52258	Efg1 N prion-like domain assignments	818	X
52265	Backbone assignments for MALT1 E549A mutation	820	X
52266	Backbone chemical shift assignment of HoxA9 protein	293	X
52269	MTMR7 coiled coil domain	189	X
52270	pfUCHL3	984	X
52271	1H, 13C, and 15N backbone and methyl group resonance assignments of ricin toxin A subunit (RTA)	1953	X
52273	Abl 1b isoform wild type SH3-SH2-KD (aa 83-534) apo	448	X
52274	Adalimumab Fab	2476	X
52284	Efg1 C-PrLD assignments	924	X
52286	Backbone Assignments of Ydj1 J-domain and Gly-rich region	415	X
52287	Backbone Assignments of Ydj1 G70N mutant J-domain and Gly-rich region	345	X
52289	Mdm2aa111-333 phosphorylated by CK1d	878	X
52292	NMR assignment CDCA3 WT	1430	X
52293	Abl 1b isoform wild type SH3-SH2-KD (aa 83-534) in complex with asciminib	376	X
52294	Backbone chemical shift assignment of apo- Biotin carboxyl carrier protein (BCCP) domain of Streptococcus pneumoniae d39	292	X
52295	Backbone chemical shift assignment of holo-Biotin carboxyl carrier protein (BCCP) domain of Streptococcus pneumoniae d39.	231	X
52296	Abl 1b isoform wild type SH3-SH2-KD (aa 83-519) apo	428	X
52297	Abl 1b isoform wild type SH3-SH2-KD (aa 83-519) in complex with imatinib	524	X
52298	Abl 1b isoform wild type SH3-SH2-KD (aa 83-517) apo	428	X
52300	Abl 1b isoform wild type SH3-SH2-KD (aa 83-517) in complex with imatinib	534	X
52301	Abl 1b isoform wild type SH3-SH2-KD (aa 83-515) apo	424	X
52302	Abl 1b isoform wild type SH3-SH2-KD (aa 83-515) in complex with imatinib	506	X
52303	ZBP1 Tandem Zalpha Domains	950	X
52304	Backbone chemical shifts for the human Fc gamma receptor 3a / CD16a soluble extracellular domain that is glycosylated with two N-glycans at N162 and N45	591	X
52305	Abl 1b isoform E528K SH3-SH2-KD (aa 83-534) apo	378	X
52306	Abl 1b isoform E528K SH3-SH2-KD (aa 83-534) in complex with imatinib	542	X
52307	Abl 1b isoform wild type SH3-SH2-KD (aa 83-534) in complex with GNF-5	408	X
52308	Backbone chemical shift assignments of human ZNF706	302	X
52310	Abl 1b isoform wild type SH3-SH2-KD (aa 83-534) in complex with PD166326	374	X
52313	Vcom1	64	X
52314	Ancy-m, Ancestral Mobius cyclotide	219	X
52315	Ancy-b, Ancestral Bracelet cyclotide	178	X
52316	Vcom2	69	X
52317	1H, 13C, and 15N backbone resonance assignments of E. coli Peptide Deformylase (1-147) bound to 2-(5-bromo-1H-indol-3-yl)-N-hydroxyacetamide	657	X
52318	1H, 13C, and 15N backbone resonance assignments of E. coli Peptide Deformylase (1-147) bound to 2-(5-bromo-1H-indol-3-yl)-N-hydroxyacetamide	199	X
52320	An extended interaction site determines binding between AP180 and AP2 in clathrin mediated endocytosis	937	X
52322	An extended interaction site determines binding between AP180 and AP2 in clathrin mediated endocytosis	823	X
52323	An extended interaction site determines binding between AP180 and AP2 in clathrin mediated endocytosis	700	X
52324	An extended interaction site determines binding between AP180 and AP2 in clathrin mediated endocytosis	956	X
52325	An extended interaction site determines binding between AP180 and AP2 in clathrin mediated endocytosis	493	X
52326	An extended interaction site determines binding between AP180 and AP2 in clathrin mediated endocytosis	628	X
52337	13C and 15N Chemical Shift Assignment for Abeta 40 amyloid fibrils polymorph 1 (P1)	170	X
52338	13C and 15N Chemical Shift Assignment for Abeta 40 amyloid fibrils polymorph 2 (P2)	129	X
52339	Abl 1b isoform wild type SH3-SH2-KD (aa 83-534) in complex with imatinib	592	X
52340	4E-tau(297-407) in vitro AD C-shaped	280	X
52343	Ubiquitin L50A mutant	212	X
52344	Ubiqitin L50A mutant pressure unfolded	216	X
52345	Backbone assignments of E. coli RfaH	718	X
52346	CPEB4 N-terminal domain isoform lacking microexon 4	1942	X
52348	NMR Backbone Assignment (1H, 15N, and 13C) resonances of RfaH protein	752	X
52349	Isoform-specific C-terminal phosphorylation drives autoinhibition of Casein Kinase 1	614	X
52351	Backbone 1H, 13C and 15N chemical shift assignments of E. coli C6-crypto-AcpP.	367	X
52352	Backbone 1H, and 15N chemical shift assignments of E. coli C8-crypto-AcpP.	144	X
52353	Backbone 1H, and 15N chemical shift assignments of E. coli C10-crypto-AcpP.	144	X
52355	8-17 DNAzyme in presence of various metal ions	2251		X
52356	1H, 13C, and 15N Chemical Shift Assignments for amyloidogenic SEM2(49-107) peptide	327	X
52357	3x DPR1 dipeptide repeat with sequence (L-Tyr, D-Pip3	93	X
52363	GeoRec1 backbone assignments	462	X
52364	The methyl assignment of E coli Hsp90 N domain	407	X
52365	Chemical shifts, T1, T1rho, heteronuclear NOEs, RDCs of ubiquitin folding intermediate F'	949	X
52366	The methyl assignment of E coli Hsp90 C domain	296	X
52367	The backbone assignment of disordered protein D131D	474	X
52368	The backbone assignment of FtsZ C-terminal disordered tail	233	X
52370	Chemical shifts, T1, T1rho, RDCs of ubiquitin early folding intermediate U'	536	X
52371	1H, 13C and 15N backbone resonance assignment of Cel45A from Phanerochaete chrysosporium	1209	X
52374	NMR chemical shift assignment of odorant binding protein 44a from Drosophila	961	X
52375	Casein Kinase 1 delta 2 tail	17	X
52376	Chemical shifts of folding intermediate N'	472	X
52377	NMR chemical shift assignment of odorant binding protein 44a from Drosophila bound to fatty acid C20:1 (8Z), eicosenoic acid	958	X
52378	BELL2 1H 13C 15N_assignment	1053	X
52379	HIF-1alpha oxygen-dependent degradation domain	859	X
52380	Solid-state NMR backbone chemical shift assignments of a-synuclein amyloid fibrils at fast MAS regime	284	X
52382	Double-hydroxylated HIF-1alpha oxygen-dependent degradation domain	853	X
52383	1H, 13C, and 15N Resonance Assignment of the La Motif of Human La-related Protein 1	1280	X
52384	Chemical shift assignments of a de novo designed 12 stranded transmembrane beta barrel	478	X
52385	C-terminal EF-hand (EF34) Domain of a-actinin-1	749	X
52386	C-terminal EF-hand (EF34) Domain of a-actinin-1 bound to GluN1-C0	570	X
52387	Backbone 1H, 13C, and 15N Chemical Shift Assignments of the C-terminal region of XLF in the full-length XLF protein	297	X
52388	Nanog NTD	93	X
52389	Phosphorylated Nanog NTD	93	X
52390	StREM13 160-198	307	X
52391	StREM13 171-198	222	X
52392	NFkappaB p52 DD (225-328) Homodimer	591	X
52393	StREM13 150-198	395	X
52394	1H, 13C, and 15N Amide Backbone Chemical Shift Assignments for Lcl-CTD	437	X
52395	Complete 1H, 13C, and 15N Chemical Shift Assignments for Lcl collagen-like repeat (CLR) peptide	184	X
52396	PfMATE pH6.8	196	X
52397	PfMATE pH3.7	168	X
52398	The C-terminal region of XRCC4	606	X
52399	BRCT1	506	X
52400	Amide and a-hydrogens extension to the Solid-state NMR assignment of P. horikoshii TET2	1772	X
52412	Backbone and side-chain resonance assignments of GRB2 with a SOS1 PRM and an EGFR phosphorylated peptide	1664	X
52413	Pre-binding plantaricin Ev	88	X
52414	1H-NMR assignments for the Z0 zinc-finger domain of transcription repressor Bcl11A	227	X
52415	Post-binding plantaricin Ev	89	X
52416	Resonance assignment of a loc1p region	172	X
52417	B2_3	927	X
52418	Backbone and aliphatic side-chain chemical shift assignment for 2N4R Tau	4393	X
52420	Neh4ex backbone chemical shifts	231	X
52421	Neh5ex backbone chemical shifts	215	X
52422	Structural insights into the cooperative nucleosome recognition and chromatin opening by FOXA1 and GATA4	830	X
52423	Structural insights into the cooperative nucleosome recognition and chromatin opening by FOXA1 and GATA4	399	X	X
52424	Attenuator hairpin of the Programmed Ribosome Frameshift (PRF) element of SARS-CoV-2	46			X
52425	Helix-I of the Programmed Ribosome Frameshift (PRF) element of SARS-CoV-2	77			X
52426	Helix-II of the Programmed Ribosome Frameshift (PRF) element of SARS-CoV-2	54			X
52427	123-nt Programmed Ribosome Frameshift (PRF) element of SARS-CoV-2	132			X
52428	116-nt Programmed Ribosome Frameshift (PRF) element of SARS-CoV-2	103			X
52440	B19 VP1u receptor-binding domain (RBD)	661	X
52444	NMR Assignment of Backbone (1H, 15N, and 13C) resonances of RfaH protein	1344	X
52445	SARS-CoV-2 Fusion Domain	16	X
52446	SARS-CoV-2 Fusion Domain: K825A Mutant	147	X
52447	Backbone [1H, 13C, 15N] Chemical Shift Assignment for LpAFP	803	X
52448	Streptococcal Protein G antibody-binding domain C2 - variant 3	361	X
52449	Assignment of the Lassa virus glycoprotein 2 transmembrane domain in the prefusion state	178	X
52450	Assignment of the Lassa virus glycoprotein 2 transmembrane domain in the postfusion state	181	X
52451	Assignment of the Lassa virus glycoprotein 2 transmembrane domain G429P mutant in the prefusion state	144	X
52452	Assignment of the Lassa virus glycoprotein 2 transmembrane domain G429P mutant in the postfusion state	148	X
52453	Assignment of the Lassa virus glycoprotein 2 transmembrane domain D432P mutant in the prefusion state	139	X
52454	Assignment of the Lassa virus glycoprotein 2 transmembrane domain D432P mutant in the postfusion state	144	X
52455	Backbone 1H, 15N, and 13C resonance assignments of FF1 domain from P190A RhoGAP in 5 M urea.	386	X
52456	Backbone 1H, 15N, and 13C resonance assignments of FF1 domain from p190A RhoGAP in 8 M urea.	304	X
52459	Chemical shift assignment for the ORF6 C-terminal region from SARS-CoV-2	273	X
52460	Chemical shift assignment for the N-terminally acetylated ORF6 C-terminal region from SARS-CoV-2	182	X
52461	1H, 13C and 15N resonance assignments for the acetyltransferase domain of the kinetoplastid kinetochore protein KKT23 in the presence of acetyl coenzyme A	1716	X
52468	SY-tagged Tm1 I/C C-terminal Domain 13C 15N Fibril Assignments	196	X
52475	Solution NMR backbone assignment of SorcinFL	902	X
52476	NMR chemical shift assignments of modified tRNAAsp from Escherichia coli	129			X
52477	NMR chemical shift assignments of unmodified tRNAAsp from Escherichia coli	58			X
52478	NMR chemical shift assignments of modified tRNAPhe from Escherichia coli	60			X
52479	NMR chemical shift assignments of unmodified tRNAPhe from Escherichia coli	48			X
52480	NMR chemical shift assignments of modified tRNAVal from Escherichia coli	68			X
52481	NMR chemical shift assignments of unmodified tRNAVal from Escherichia coli	58			X
52486	MMMKPD1 water	50	X
52492	Sequence-Specific Backbone assignment of the PP2A-binding domain (aa 62-108) of Eya3	244	X
52496	3x DPR1 dipeptide repeat with sequence (L-Tyr, D-Pip)3	93	X
52497	1x DPR1 dipeptide repeat with sequence (L-Tyr, D-Pip)1	58	X
52498	1H, 15N and13C resonance assignments of S2A/H64A double mutant of human carbonic anhydrase II	2213	X
52499	1x DPR2 dipeptide repeat with sequence (AMPA, L-Pro)1	50	X
52500	5x DPR1 dipeptide repeat with sequence (L-Tyr, D-Pip)5	85	X
52501	Backbone 1H, 13C, and 15N Chemical Shift Assignments for a Cys-less mutant of hVDAC-2	819	X
52503	1H, 13C, and 15N backbone chemical shift assignments of TauK18	642	X
52504	10x DPR2 dipeptide repeat with sequence (AMPA, L-Pro)10	59	X
52520	AILV Methyl Chemical Shifts for Mutant TAPBPR-bound HLA-A*02:01/TAX9 complex	320	X
52524	PHL4 Resonance Assignments	641	X
52525	PHL4 Effector Domain Assignments	1208	X
52529	1H, 13C, and 15N chemical shift assignments for ubiquitin with K27M mutation	691	X
52530	HvfA-DSR2-3 modified peptide	230	X
52531	HvfA-DSR2- 3 unmodified peptide	167	X
52542	Backbone resonance assignemnts of HUWE1 HECT domain N-lobe	1075	X
52543	Structure and functional studies of Avt1, a novel peptide from the sea anemone Aulactinia veratra	229	X
52544	Backbone resonance assignemnts of HUWE1 HECT domain N-lobe truncation D4141-4216	896	X
52545	NMR chemical shifts for a 37-residue peptide corresponding to exon-5 of murine ameloblastin (AB2) in the presence of 20% deuterated dodecylphosphocholine (dPC).	327	X
52546	NMR chemical shifts for a 37-residue peptide corresponding to exon-5 of murine ameloblastin (AB2) free in solution at pH 6.3.	275	X
52548	Backbone NMR Resonance Assignment for the T45R_S107R E. coli b-clamp	1161	X
52549	Backbone NMR Resonance Assignment for the Wild Type E. coli b-clamp	650	X
52550	Human CHCHD10 N-Terminus	381	X
52551	Human CHCHD2 N-Terminus	491	X
52554	tau-2N4R	2421	X
52555	Backbone assignments for TALE Homeodomain Transcription Factor Meis1	300	X
52557	The 1H, 15N, and 13C resonance assignments of a single-domain antibody against imunnoglobulin G	1326	X
52559	BcX E78Q W9A	534	X
52560	BcX E78Q Y69A	534	X
52561	1H/13C chemical shift assignment of alanine methyl groups of Cerebral dopamine neurotrophic factor (C-CDNF, 127-187 aa)	24	X
52562	NMR resonance assignment for the Rtt103 CID domain from C. thermophilum	1065	X
52564	1H, 13C and 15N backbone resonance assignment of the calcium-activated EndoU endoribonuclease	1255	X
52566	BcX E78Q	535	X
52569	Backbone chemical shift assignment of E.coli CcdB_G100T toxin in complex with CcdA-c (residue 50-72) from CcdAB TA system -A	358	X
52570	Backbone chemical shift assignment of E.coli CcdB_G100T toxin in complex with CcdA-c (residue 50-72) from CcdAB TA system -B	320	X
52579	Trp-cage fortified Tc5b-Exenatide chimera (Ex-4-Tc5bQR) at 310K	149	X
52584	Assignments of 2H13C15N labelled full length GlpG based on 1H detected solid-state NMR experiments	623	X
52587	Cc ProXp-ala	1904	X
52588	NMR resonance assignments of FtsY at 298 K	660	X
52595	13C, 15N and 1H Assigned Chemical Shifts for Staphylococcus aureus Response Regulator ArlR DNA-binding domain	1250	X
52597	Backbone 1H, 13C, and 15N Chemical Shift Assignments for WT transthyretin	340	X
52598	Backbone 1H, 13C, and 15N Chemical Shift Assignments for A97S transthyretin	358	X